| Literature DB >> 32550367 |
Jeffrey Zielich1, Sriyash Mangal1, Esther Zanin1, Eric Lambie1.
Abstract
Entities:
Year: 2018 PMID: 32550367 PMCID: PMC7252319 DOI: 10.17912/W2208R
Source DB: PubMed Journal: MicroPubl Biol ISSN: 2578-9430
Figure 1: CRISPR-based dual-marker selection cassette for rapamycin-induced protein dimerization in C. elegans.(A) The codon-optimized fkbp12 sequence together with a NotI site for 3’ homology region insertion was introduced in the mCherry-tag repair donor vector (Norris et al. 2015) to generate vector pEL226. (B) Schematic overview of of CRISPR/Cas9 mediated mcherry::fkbp12 tag of endogenous mex-6, including Cre-mediated excision of the dual marker selection cassette, resulting in strain EJ1269. (C) Injection of 1 mM rapamycin into adult stage gonads (Mangal et al. 2018) of strain EJ1270 expressing FRB::GFP::PH and MEX-6::mCherry::FKBP12 (obtained by crossing EJ1269 into ZAN87, Table 2). (D) Epifluorescence microscopy images of adult stage proximal gonads imaged ~ 6 hours after the gonads were injected with DMSO (n = 4) or 1 mM rapamycin (n = 5). MEX-6::mCherry::FKBP12 signal increases in later stage oocytes and remains cytosolic if 10 % DMSO is injected into the gonad. Arrowheads point to the pachytene region of the gonad where MEX-6::mCherry::FKBP12 is not detectable. Injection of rapamycin induces the binding of the FRB and FKBP12 domains and thereby translocates MEX-6::mCherry::FKBP12 to the plasma membrane of diakinesis-stage oocytes. (E) Epifluorescence microscopy images of 1-cell, 2-cell and 4-cell stage embryos imaged ~ 6 hours after the gonads were injected with DMSO (1-cell stage n = 5; 2-cell stage n = 4; 4-cell stage n = 7) or 1 mM rapamycin (1-cell stage n = 10; 2-cell stage n = 16; 4 cell stage n = 10). 1-cell stage embryos showing a cytosolic anterior gradient and 2-cell / 4-cell stage embryos showing strong expression in the AB lineage (DMSO). Upon rapamycin injection, MEX-6::mCherry::FKBP12 translocates to the plasma membrane in the anterior region (1-cell stage) and the anterior blastomeres (2-cell and 4-cell stage).
| aaacgacggccagtgaattca |
| cttcttcaccctttgagaccata |
| cgagctcctcaagctcgaggc |
tgattacgccaagcttgcg |
Strain | Genotype | References |
| (Mangal | |
This study | ||
This study |