Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and tm5626.

Figure 1. Location of the novel alleles

Description

We report , and as novel deletion alleles of the gene that is the only ortholog of human calmodulin-lysine N-methyltransferase (CAMKMT)1. CAMKMT encodes an evolutionarily conserved enzyme class I protein methyltransferase that acts in the formation of trimethyllysine in calmodulin for calcium-dependent signaling2. CAMKMT mutation is associated with Hypotonia-cystinuria syndrome in human2,3. The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV4. In the screening, all the alleles were detected by nested PCR using the following primer sets, 5’- TCAAGCCACGCCCACACTTA-3’ and 5’- GAAGGCATACAGTGGGGGTA-3’ for the first round PCR and 5’- CGCCCACACTTAATGGTTAT-3’ and 5’- GGGCAGTGTAGGGATACTGT-3’ for the second round PCR. By Sanger sequencing, the 30 bp flanking sequences of the alleles , and were identified as AATCCTTCACACACCACAACAGAAATCCTA – [384 bp deletion] -CGAGGTCACGCCCACACATTGGGCGGAGTT, CCGATGCTCCGTGCTGCTCCAAGTGCTCCG – [627 bp deletion + 9 bp insertion (TAATCTTGT)] – AGTACTCCTACAGTATCCCTACACTGCCCC, and AAAAAAGGATGACGTCACAGTTGCTCCGAT – [256 bp deletion] – ACGCCGATTCGGCAGCCGAATGATCTACAG, respectively. Based on the information about the splicing isoforms of Y48E1C.1 (WormBase, http://www.wormbase.org, WS259), the forth exon of (annotated as non cording RNA) and the second exon of transcripts are deleted in , and (Fig. 1). Presumably, all of the alleles do not affect . According to information of protein in Wormbase, this exon contains a predicted some motif, suggesting hypothetical functional deficiency of , and in the deletion mutants. In addition, these alleles are expected to be usable for comparing functions among the isoform c and the other isoforms. However, no visually obvious phenotypes (Let, Unc, and Dpy) were observed in , and .

Reagents

FX05468 () II (Not outcrossed)

FX05625 () II (Not outcrossed)

FX05626 () II (Not outcrossed)