| Literature DB >> 32539135 |
Qing Zhang1, Jian Zhang1, Mengting Gong1, Ruolan Pan1, Yanchang Liu1, Liming Tao1, Kan He1.
Abstract
Purpose: Fungal keratitis (FK) is an eye disease that can lead to blindness and has a high incidence worldwide. At present, there is no effective treatment for this disease. There are innate immune response mechanisms that protect against fungal infections. One example is C-type lectin receptors (CLRs), which can identify fungal invaders and trigger signal transduction pathways and cellular responses to eliminate pathogens. However, previous studies have focused mostly on single-receptor factors, and a systematic analysis of the genetic factors underlying the pathogenesis of FK has not been conducted. This study aimed to investigate the molecular mechanisms of FK in terms of genomics and to further elucidate its pathogenesis.Entities:
Year: 2020 PMID: 32539135 PMCID: PMC7415296 DOI: 10.1167/iovs.61.6.32
Source DB: PubMed Journal: Invest Ophthalmol Vis Sci ISSN: 0146-0404 Impact factor: 4.799
Quality of Sequencing Samples and Data
| Clean Reads | ||||||
|---|---|---|---|---|---|---|
| Sample | RNA Integrity Number | Reads (n) | Q20 (%) | Q30 (%) | n | % |
| PBS-2 | 9.2 | 70,082,806 | 97.91 | 94.75 | 69,859,772 | 99.68 |
| Af-2 | 8.6 | 76,228,368 | 97.74 | 94.37 | 75,974,668 | 99.66 |
| Af-5 | 8.8 | 75,979,188 | 97.80 | 94.52 | 75,721,772 | 99.66 |
Figure 1.Phenotypic results of the fungal keratitis mouse model. (A) The corneal lesions of the mice in the experimental group (Af group) and the control group (PBS group) were observed under a microscope on the second or fifth day. (B) The corneal pathology scores were assessed in each group (**P < 0.01). (C) The fungal viability was assessed in the Af group. The CFUs in the Af-2 group were significantly higher than in the Af-5 group (*P < 0.05). (D) H&E and GMS staining (400×) was performed in each group. The black arrow indicates conidia, and the blue arrow indicates hyphae.
Figure 2.Sequencing data quality control. (A) FPKM density distribution of the sequencing data. The x-axis represents the log10 (FPKM) value of the gene, and the y-axis represents the distribution density of the genes with corresponding expressions. (B) Boxplot of the FPKM density distribution. (C) Principle component analysis of the sequencing samples. (D) Correlation test of the sequencing samples.
Figure 3.Results of the DEGs associated with fungal keratitis in mice. (A) Volcano plot of the significant DEGs between the PBS-2 group and Af-2 group. (B) Volcano plot of the significant DEGs between the Af-5 group and Af-2 group. The x-axis represents the log2 fold change and the y-axis represents –log10 (P value) of each significant DEG. (C) A heatmap of each significant DEG. (D) Comparison of the DEGs at two different time points. The Venn diagram shows the overlapping up- or downregulated DEGs at two different time points.
Common DEGs During Fungal Infection in the FK Mouse Model
| Regulation | Genes |
|---|---|
| Af-5/Af-2 downregulated; Af-2/PBS-2 downregulated (n = 3) |
|
| Af-5/Af-2 downregulated; Af-2/PBS-2 upregulated (n = 33) |
|
| Af-5/Af-2 upregulated; Af-2/PBS-2 downregulated (n = 93) |
|
| Af-5/Af-2 upregulated; Af-2/PBS-2 upregulated (n = 49) |
|
Enrichment Results of Signal Transduction-Related Pathways in the Af-2/PBS-2 Comparison
| Signaling | Downregulated | Upregulated | |||
|---|---|---|---|---|---|
| Pathway | FDR | Genes, n | Genes, n | Downregulated Genes | Upregulated Genes |
| TNF | 2.32E-11 | 0 | 24 | — |
|
| NF-κB | 2.66E-05 | 1 | 14 |
|
|
| PI3K-Akt | 3.86E-05 | 14 | 17 |
|
|
| JAK–STAT | 7.70E-05 | 2 | 17 |
|
|
| MAPK | 2.03E-03 | 6 | 17 |
|
|
| Rap1 | 1.46E-02 | 6 | 10 |
|
|
| HIF-1 | 3.54E-02 | 0 | 9 | — |
|
Enrichment Results of Signal Transduction-Related Pathways in the Af-5/Af-2 Comparison
| Signaling Pathway | FDR | Downregulated Genes, n | Upregulated Genes, n | Downregulated Genes | Upregulated Genes |
|---|---|---|---|---|---|
| PI3K-Akt | 4.05E-09 | 1 | 42 |
|
|
| MAPK | 3.58E-03 | 4 | 21 |
|
|
| TNF | 1.15E-02 | 7 | 5 |
|
|
| Rap1 | 2.90E-02 | 0 | 17 |
|
|
| Wnt | 3.62E-02 | 1 | 12 |
|
|
| cGMP–PKG | 4.10E-02 | 0 | 14 | — |
|
| Hippo | 4.27E-02 | 0 | 13 | — |
|
Figure 4.Signal transduction-related pathways enriched at different time points. (A) Significant signal transduction-related pathways were enriched in the comparison between the PBS-2 and Af-2 groups. (B) Significant signal transduction-related pathways were enriched in the comparison between the Af-5 and Af-2 groups. The x-axis represents –log10 (FDR), and the y-axis represents the name of each pathway.
qPCR Primers for Inflammatory Cytokines
| Genes | Forward Primers | Reverse Primers |
|---|---|---|
|
| tccagctacgaatctccgac | aggtgctcaggtcattctcc |
|
| ccctgacccaaccacaaatg | ctacatttgccgaagagccc |
|
| aagctgagaaccaagaccca | aagaaatcgatgacagcgcc |
|
| tgagaagctgctaggatcgg | aggcttggaatctgctgagt |
|
| cctcagcctcttctccttcc | agatgatctgactgcctggg |
|
| tgcggagacaacatcgacta | aagttcatgaggatgcgtgc |
|
| gaccaccaccatcttcctca | ccaaccacctccatcagtct |
|
| gctacaatggatggctggtg | gttctgtgtgggtgggagta |
|
| ggtcctctttctgtgctcct | agtggtggagatgtctggtg |
|
| gcaatgcatgagaccctctg | actcaaggcccttctgactc |
|
| cccgttggcaaagatggtag | accttggctaccctgagaac |
Figure 5.Gene expression patterns of inflammatory cytokines revealed by qPCR. The expression patterns of five inflammatory cytokine genes, including IL1B (A), IL6 (B), IL10 (C), IL23 (D), and TNF-α (E), were validated by qPCR. The experiment was performed in triplicate for each group and was repeated three times. The x-axis represents three groups: PBS-2, Af-2, and Af-5. The y-axis represents the relative expression of each gene in the different groups. The gene expression value in PBS-2 was set to 1.
Figure 6.Cytokine expression in mouse corneas evaluated by immunohistochemistry. The expression of five inflammatory cytokines, including IL-1β, IL-6, IL-10, IL-23, and TNF-α, in each group was assessed by immunohistochemistry.
Figure 7.Cytokine expression in fungal keratitis-infected mice tested by multiplex assay. The expression of cytokines, including IL-1β (A), IL-6 (B), IL-10 (C), and TNF-α (D), in the Af-2 and Af-5 groups (n = 5 mice in each group) and in the PBS-2 and PBS-5 groups (n = 5 mice in each group) was measured by Luminex multiplex assay technology. The significance level was determined by one-way ANOVA tests (***P < 0.001, **P < 0.01, *P < 0.05).