Literature DB >> 32520926

Maternally-Expressed Gene 3 (MEG3)/miR-143-3p Regulates Injury to Periodontal Ligament Cells by Mediating the AKT/Inhibitory κB Kinase (IKK) Pathway.

Yao Dong1, Shuairu Feng1, Feijun Dong1.   

Abstract

BACKGROUND Dysregulated long noncoding RNAs (lncRNAs) are implicated in periodontitis development. Nevertheless, the role and mechanism of lncRNA maternally-expressed gene 3 (MEG3) in periodontitis progression remain unclear. This study aimed to explore how and whether MEG3 affect viability, apoptosis, and inflammatory response in lipopolysaccharide (LPS)-treated periodontal ligament cells (PDLCs). MATERIAL AND METHODS Periodontal ligament tissues were collected from periodontitis patients or normal individuals. PDLCs were obtained from normal periodontal ligament and treated with lipopolysaccharide (LPS). LPS-induced PDLCs injury was assessed via viability, apoptosis and inflammatory response using Cell Counting Kit-8, flow cytometry, quantitative reverse transcription polymerase chain reaction, enzyme-linked immunosorbent assay, and Western blot. The levels of MEG3 and microRNA (miR)-143-3p were examined via quantitative reverse transcription polymerase chain reaction. The protein kinase B(AKT)/inhibitory kappaB kinase (IKK) pathway was analyzed via Western blot. The target correlation of MEG3 and miR-143-3p was determined through dual-luciferase reporter analysis. RESULTS MEG3 level was decreased and miR-143-3p level was upregulated in periodontitis and LPS-treated PDLCs. MEG3 overexpression or miR-143-3p knockdown alleviated LPS-induced viability inhibition, apoptosis promotion, and inflammatory response. MEG3 was a sponge for miR-143-3p. miR-143-3p overexpression weakened the effect of MEG3 on LPS-induced injury. MEG3 overexpression inhibited the activation of AKT/IKK pathway by sponging miR-143-3p in LPS-treated PDLCs. CONCLUSIONS MEG3 overexpression inhibited LPS-induced injury in PDLCs by inactivating the AKT/IKK pathway via sponging miR-143-3p, providing a potential target for treatment of periodontitis.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32520926      PMCID: PMC7301678          DOI: 10.12659/MSM.922486

Source DB:  PubMed          Journal:  Med Sci Monit        ISSN: 1234-1010


Background

Periodontitis is a severe inflammation-related periodontal problem affecting the supporting structures of the teeth, including the periodontal ligament [1]. Periodontitis influences oral health and quality of life of patients [2]. Periodontal ligament cells (PDLCs) play important roles in regulation of periodontal inflammation [3]. Oral microbiota can induce periodontitis [4]; hence, lipopolysaccharide (LPS) as a key bacterial meta-factor, could be used to stimulate periodontal inflammation [5,6]. Noncoding RNAs take part in the regulation of inflammation-related disorders by mediating various cytokines [7]. Numerous long noncoding RNAs (lncRNAs) are aberrantly expressed in periodontitis [8]. The lncRNA maternally-expressed gene 3 (MEG3) has an essential role in cancer progression and metabolic programming [9,10]. The inflammatory response is a major risk for the development of cancers and metabolic diseases [11-13]. Increasing reports suggest that MEG3 participates in the regulation of inflammatory disorders by promoting or inhibiting inflammatory response in various conditions [14-17]. A previous study indicated that MEG3 is underexpressed and regulates osteogenic differentiation in periodontitis [18]. Nevertheless, the role and mechanism of MEG3 in periodontitis are complex and need more exploration. lncRNAs play important roles in periodontitis progression by regulating microRNAs (miRNAs) [19]. Many miRNAs that are expressed in PDLCs are in response to LPS-induced injury [20]. Moreover, miR-143-3p is an inflammatory miRNA, which can promote myocardial inflammation [21,22]. Emerging evidence suggests miR-143-3p expression is enhanced in periodontitis and could be used for detection of periodontitis [23]. Nevertheless, the effect of miR-143-3p on periodontitis occurrence is unclear. The protein kinase B (AKT)/inhibitory κB kinase (IKK) signaling is an important inflammatory pathway [24]. In addition, the AKT pathway can target the nuclear factor-κB (NF-κB) pathway by regulating activation of IKK signaling [25]. The AKT/IKK pathway is activated during periodontal inflammation [26,27], but whether the participation of the AKT/IKK pathway is required for action of the MEG3-mediated mechanism in periodontitis remains unknown. In this research, we established the cellular model of periodontitis using PDLCs challenged with LPS [5,6]. The interleukin 6 (IL-6), IL-18, IL-1β, and tumor necrosis factor-α (TNF-α) are the important inflammatory cytokines in periodontitis development [28-30]. Here, we measured the levels of MEG3 and miR-143-3p and investigated their effect on viability, apoptosis, levels of IL-6, IL-18, IL-1β, and TNF-α, and the AKT/IKK pathway in LPS-treated PDLCs. We also explored the interaction between MEG3 and miR-143-3p.

Material and Methods

Patient tissues

We recruited 25 periodontitis patients and 25 normal people without periodontitis at HwaMei Hospital, University of Chinese Academy of Science. The periodontal ligament samples were harvested from the surface of the root during the premolar extraction and used for RNA isolation. The patients were diagnosed based on the visual and radiographic assessment of the periodontal tissues. Exclusion criteria included patients with smoking, rheumatoid arthritis, and the appearance of any systemic disease. All participants signed the written informed consents. This research was approved by the Ethics Committee of HwaMei Hospital, University of Chinese Academy of Science and adhered to the ethical principles of the World Medical Association Declaration of Helsinki. The clinical examinations were performed by 2 trained experienced examiners.

Cell culture and treatment

PDLCs were isolated from normal periodontal ligament as previously reported [6]. Cells were grown in DMEM (Sigma, St. Louis, MO, USA) containing 10% fetal bovine serum (Biosun, Shanghai, China) and 1% antibiotics (Sigma) and maintained at 37°C in 5% CO2. To induce periodontitis-like injury, PDLCs were exposed to various concentrations (0, 2.5, 5, and 10 μg/mL) of LPS (Sigma) for 12 h.

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis

RNA was isolated using TRIzol (Thermo Fisher, Waltham, MA, USA) and used to generate cDNA using a specific reverse transcription kit (Thermo Fisher). qRT-PCR was performed using the mixture of cDNA, SYBR Green (Vazyme, Nanjing, China), and specific primers. The primers were synthesized by Genscript (Nanjing, China): IL-6 (sense, 5′-CCACCGGGAACGAAAGAGAA-3′, antisense, 5′-TCTCCTGGGGGTATTGTGGA-3′); IL-18 (sense, 5′-ATCGCTTCCTCTCGCAACAA-3′, antisense, 5′-GAGGCCGATTTCCTTGGTCA-3′); IL-1β (sense, 5′-CCTGAGCTCGCCAGTGAAAT-3′, antisense, 5′-TCGTGCACATAAGCCTCGTT-3′); TNF-α (sense, 5′-CTGGGCAGGTCTACTTTGGG-3′, antisense, 5′-CTGGAGGCCCCAGTTTGAAT-3′); MEG3 (sense, 5′-AATCTCGGGCCTTGTCGAAG-3′, antisense, 5′-TCTGGGATGGGACAGGAGTC-3′); miR-143-3p (sense, 5′-TGAGATGAAGCACTG-3′, antisense, 5′-GTGCAGGGTCCGAGGT-3′); U6 (sense, 5′-CTCGCTTCGGCAGCACA-3′, antisense, AACGCTTCACGAATTTGCGT); GAPDH (sense, 5′-CCAGTGCAAAGAGCCCAAAC-3′, antisense, 5′-TCCCGTTTCACTTGTCTCGG-3′). GAPDH (for IL-6, IL-18, or MEG3) and U6 (for miR-143-3p) were used as reference. The relative RNA expression was calculated using the delta-delta cycle threshold method [31].

Enzyme-linked immunosorbent assay (ELISA)

The secretion of inflammatory cytokines was detected via ELISA. PDLCs (5×104 cells/well) were added into 24-well plates and treated with LPS for 12 h. Next, medium was harvested and used to measure the levels of IL-6, IL-18, IL-1β, and TNF-α using corresponding ELISA kits (Thermo Fisher) following the manufacturer’s instructions.

Cell transfection

MEG3 overexpression vector (OE-MEG3) was generated by inserting its sequence into pcDNA3.1 (Thermo Fisher). The empty vector was used as negative control (Vector). siRNA for MEG3 (si-MEG3, 5′-AAGACUUAUAGGAAAGUACUC-3′), siRNA negative control (si-NC, 5′-UUUTGATCAUTGATGAAA-3′), miR-143-3p mimic (5′-UGAGAUGAAGCACUGUAGCUC-3′), mimic negative control (miR-NC, 5′-CGAUCGCAUCAGCAUCGAUUGC-3′), miR-143-3p inhibitor (anti-miR-143-3p, 5′-GAGCUACAGACUACAUCUCA-3′), inhibitor negative control (anti-NC, 5′-UUCUCCGAACGUGUCACGUUU-3′) were generated by GenePharma (Shanghai, China). PDLCs were transfected with 50 nM oligonucleotides or 600 ng vectors with Lipofectamine 3000 reagent (Thermo Fisher). After transfection for 24 h, cells were harvested for further experiments.

Cell Counting Kit-8 (CCK-8) assay

Cell viability was assessed by CCK-8 analysis. PDLCs (1×104 cells/well) were added into 96-well plates and incubated with LPS for 12 h. The samples were prepared in triplicate. Next, 10 μL CCK-8 reagent (Beyotime, Shanghai, China) was added. After incubation for 4 h, the absorbance was detected using a microplate reader (Bio-Gene Technology, Guangzhou, China) with detection wavelength at 450 nm. Cell viability was normalized to that of the control group.

Flow cytometry

Cell apoptosis was analyzed via flow cytometry. PDLCs (2×105 cells/well) were added into 12-well plates and incubated with LPS for 12 h. Next, cells were harvested and resuspended in the binding buffer, followed by interacting with Annexin V-FITC and propidium iodide (PI) (Solarbio, Beijing, China). The apoptotic rate of cells was analyzed with a flow cytometer (Agilent, Hangzhou, China) and shown as the percentage in upper and lower right quadrants.

Western blot analysis

Cells were harvested and lysed in RIPA buffer (Beyotime) containing 1 mM PMSF (Beyotime). After centrifugation for 5 min, protein was collected and quantified using a protein quantification kit (Abbkine, Redlands, CA, USA). Protein samples (20 μg) were loaded in triplicate and separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by transferring to polyvinylidene fluoride membranes (Solarbio). The membranes were blocked with 5% non-fat milk, and then interacted with primary antibodies and secondary antibody. GAPDH was used as a reference. The antibodies were: anti-P65 (ab16502, 1: 1000 dilution, Abcam, Cambridge, MA, USA), anti-phosphorylated P65 (p-P65 S536) (ab86299, 1: 5000 dilution, Abcam), anti-AKT (ab8805, 1: 500 dilution, Abcam), anti-p-AKT (T308) (ab38449, 1: 1000 dilution, Abcam), anti-IKK (ab97406, 1: 2000 dilution, Abcam), anti-p-IKK (Y188) (ab194519, 1: 1000 dilution, Abcam), and anti-GAPDH (ab181602, 1: 10 000 dilution, Abcam), as well as horseradish peroxidase-conjugated IgG (ab205718, 1: 20 000 dilution, Abcam). Next, the membranes were incubated with the BeyoECL Plus kit (Beyotime) and the bands were exposed to films. The relative protein level was normalized to that of the control group.

Dual-luciferase reporter analysis

The complementary sequences between MEG3 and miR-143-3p were searched in starBase (). Luciferase reporter vector psiCHECK-2 (Promega, Madison, WI, USA) was used to construct related vectors. The sequence of MEG3 containing miR-143-3p binding sites was inserted downstream of the luciferase reporter gene in psiCHECK-2, synthesizing the wild-type luciferase constructs wt-MEG3. The mutant-type construct mut-MEG3 was generated by mutating the seed sites of miR-143-3p. PDLCs were co-transfected with 600 ng wt-MEG3 or mut-MEG3 and miR-143-3p mimic or miR-NC for 24 h. Next, luciferase activity was assessed using a dual-luciferase assay kit (Promega).

Statistical analysis

Statistical analysis was carried out using GraphPad Prism 7 (GraphPad, La Jolla, CA, USA). Three independent experiments were conducted. The data with normal distribution are shown as mean±SD. The differences between 2 or multiple groups were compared using the t test or ANOVA followed via Tukey post hoc test. P<0.05 was considered statistically significant.

Results

LPS inhibited viability and promoted apoptosis and inflammatory response in PDLCs

To establish a periodontitis-like injury model in vitro, PDLCs were stimulated with LPS. As shown in Figure 1A–1C, treatment with LPS significantly inhibited viability and increased apoptosis in a concentration-dependent manner. The various doses of LPS led to progressively upregulated mRNA levels of IL-6, IL-18, IL-1β, and TNF-α (Figure 1D–1G). In addition, 10 μg/mL LPS strongly promoted secretion of IL-6, IL-18, IL-1β, and TNF-α and activation of inflammatory-associated NF-κB signaling (Figure 1H–1L). These data indicated that exposure to LPS successfully induced PDLCs injury.
Figure 1

The establishment of a periodontitis model using LPS-treated PDLCs. (A–C) Cell viability and apoptosis were measured in PDLCs after treatment with various concentrations of LPS for 12 h via CCK-8 and flow cytometry. (D–K) The levels of IL-6, IL-18, IL-1β, and TNF-α were detected in PDLCs after treatment with LPS as determined by qRT-PCR and ELISA. (L) The protein levels of P65 and p-P65 were examined in PDLCs after stimulation with LPS as determined by Western blot. * P<0.05.

MEG3 expression was reduced and miR-143-3p was enhanced in periodontitis and LPS-treated PDLCs

To explore the roles of MEG3 and miR-143-3p in periodontitis, their levels were measured. As displayed in Figure 2A and 2B, MEG3 level was decreased in LPS-treated PDLCs in concentration- and time-dependent manners. MEG3 abundance was lower in periodontal ligament tissues of periodontitis compared to normal samples (Figure 2C). In addition, miR-143-3p level was progressively elevated in PDLCs after treatment with LPS (Figure 2D, 2E). Similarly, miR-143-3p abundance was markedly enhanced in periodontitis tissues in comparison to normal samples (Figure 2F). These results suggested that low expression of MEG3 and high expression of miR-143-3p have important roles in periodontitis progression.
Figure 2

The expression of MEG3 and miR-143-3p in periodontitis and LPS-treated PDLCs. (A, B) MEG3 expression was measured in PDLCs after treatment with LPS as determined by qRT-PCR. (C) MEG3 level was assessed in periodontitis tissues and normal samples. (D, E) miR-143-3p abundance was examined in PDLCs following treatment with LPS as determined by qRT-PCR. (F) miR-143-3p level was measured in periodontitis tissues and normal samples. * P<0.05.

MEG3 overexpression attenuated LPS-induced viability inhibition, apoptosis promotion, and inflammatory response in PDLCs

To investigate the function of MEG3 in LPS-induced PDLCs injury, PDLCs were transfected with OE-MEG3 or vector before stimulation with 10 μg/mL LPS for 12 h. The efficacy of OE-MEG3 was validated by a 22-fold increase in MEG3 level (Figure 3A). Furthermore, overexpression of MEG3 reversed LPS-induced inhibition of PDLCs viability (Figure 3B). Upregulation of MEG3 weakened LPS-induced apoptosis of PDLCs (Figure 3C), and MEG3 overexpression reduced the expression of IL-6, IL-18, IL-1β, and TNF-α in LPS-treated PDLCs (Figure 3D–3K). Addition of MEG3 protected against LPS-induced activation of the NF-κB pathway by decreasing phosphorylation of P65 (Figure 3L). These findings showed that MEG3 overexpression decreased LPS-induced PDLCs injury.
Figure 3

The effect of MEG3 on LPS-induced injury in PDLCs. (A) MEG3 expression was detected in PDLCs transfected with MEG3 overexpression vector (OE-MEG3) or Vector. Cell viability (B), apoptosis (C), IL-6, IL-18, IL-1β, and TNF-α levels (D–K), and P65 and p-P65 protein levels (L) were measured in PDLCs transfected with OE-MEG3 or Vector after treatment with LPS. * P<0.05.

miR-143-3p knockdown alleviated LPS-induced viability inhibition, apoptosis promotion, and inflammatory response in PDLCs

To assess the influence of miR-143-3p on LPS-induced PDLCs injury, PDLCs were transfected with anti-miR-143-3p or anti-NC prior to stimulation with 10 μg/mL LPS for 12 h. The transfection of anti-miR-143-3p caused a 65% reduction in miR-143-3p expression (Figure 4A). Knockdown of miR-143-3p alleviated LPS-induced viability inhibition and apoptosis production in PDLCs (Figure 4B, 4C). Downregulation of miR-143-3p weakened the expression of IL-6, IL-18, IL-1β, and TNF-α at mRNA and protein secretion levels in LPS-treated PDLCs (Figure 4D–4K). miR-143-3p inhibition decreased LPS-induced activation of NF-κB signaling in PDLCs (Figure 4L). These results suggested miR-143-3p knockdown repressed LPS-induced PDLCs injury.
Figure 4

The effect of miR-143-3p on LPS-induced injury in PDLCs. (A) miR-143-3p was measured in PDLCs with transfection of anti-miR-143-3p or anti-NC. Cell viability (B), apoptosis (C), IL-6, IL-18, IL-1β, and TNF-α levels (D–K), and P65 and p-P65 protein levels (L) were examined in PDLCs transfected with anti-miR-143-3p or anti-NC after treatment with LPS. * P<0.05.

MEG3 acted as a sponge for miR-143-3p

starBase predicted there were complementary sequences between MEG3 and miR-143-3p (Figure 5A). To validate the target relationship between MEG3 and miR-143-3p, we constructed wt-MEG3 and mut-MEG3 vectors and performed the dual-luciferase reporter analysis. Results showed that luciferase activity of the wt-MEG3 group was decreased by 67% by miR-143-3p mimic, while the activity was not changed in the mut-MEG3 group (Figure 5B). In PDLCs, miR-143-3p expression was negatively regulated by MEG3 (Figure 5C). Moreover, MEG3 overexpression or knockdown weakened or aggravated miR-143-3p abundance after treatment with 10 μg/mL LPS (Figure 5D, 5E). These data indicated that MEG3 was a sponge for miR-143-3p in HDLCs.
Figure 5

The association between MEG3 and miR-143-3p. (A) The binding sites of MEG3 and miR-143-3p were predicted via starBase. (B) Luciferase activity was measured in PDLCs transfected with wt-MEG3 or mut-MEG3 and miR-143-3p mimic or miR-NC. (C) The level of miR-143-3p was measured in PDLCs transfected with OE-MEG3, vector, si-MEG3 or si-NC. (D, E) miR-143-3p level was examined in PDLCs transfected with OE-MEG3, vector, si-MEG3, or si-NC after treatment with LPS. * P<0.05.

miR-143-3p overexpression reversed the effect of MEG3 on LPS-induced viability inhibition, apoptosis promotion, and inflammatory response in PDLCs

To analyze whether miR-143-3p was involved in MEG3-mediated regulation in LPS-induced injury, PDLCs were transfected with vector, OE-MEG3, OE-MEG3+miR-NC, or miR-143-3p mimic before exposure to 10 μg/mL LPS for 12 h. miR-143-3p overexpression reduced the protective role of MEG3 in PDLCs viability in the presence of LPS (Figure 6A). Upregulation of miR-143-3p counteracted MEG3-mediated apoptosis inhibition in LPS-treated PDLCs (Figure 6B). miR-143-3p overexpression reversed the suppressive effect of MEG3 on expression of IL-6, IL-18, IL-1β, and TNF-α in LPS-treated PDLCs (Figure 6C–6J). miR-143-3p weakened the inhibitive effect of MEG3 activation of the NF-κB pathway in LPS-treated PDLCs (Figure 6K). These findings showed that MEG3 inhibited LPS-induced PDLCs injury by regulating miR-143-3p.
Figure 6

The effect of miR-143-3p and MEG3 on LPS-induced injury in PDLCs. Cell viability (A), apoptosis (B), IL-6, IL-18, IL-1β, and TNF-α levels (C–J), and P65 and p-P65 protein levels (K) were measured in PDLCs transfected with vector, OE-MEG3, OE-MEG3+miR-NC, or miR-143-3p after treatment with LPS. * P<0.05.

MEG3/miR-143-3p axis inhibited the AKT/IKK pathway in LPS-treated PDLCs

To explore the potential signaling pathway involved, the levels of proteins in the AKT/IKK pathway were measured. Figure 7A and 7B show that exposure to LPS remarkably induced the phosphorylation of AKT and IKK in PDLCs. Furthermore, MEG3 overexpression weakened the activation of AKT/IKK pathway, and these events were restored by miR-143-3p overexpression. These results show that MEG3 can block the AKT/IKK pathway by sponging miR-143-3p to regulate LPS-induced PDLCs injury.
Figure 7

The effect of MEG3 and miR-143-3p on the AKT/IKK pathway. (A, B) The protein levels of AKT, p-AKT, IKK, and p-IKK were examined in PDLCs transfected with vector, OE-MEG3, OE-MEG3+miR-143-3p mimic, or miR-NC after treatment with LPS, as determined by Western blot analysis. * P<0.05.

Discussion

Periodontitis is an inflammatory disease associated with many chronic disorders and affecting oral health [32]. Dysregulated lncRNAs are involved in the occurrence and development of periodontitis [33]. A previous study assessed 30 lncRNAs which were expressed in periodontitis, in which MEG3 was a downregulated lncRNA regulating osteogenic differentiation [18]. However, how and whether MEG3 can regulate periodontitis needs further study. In this research, we demonstrated that MEG3 could mitigate LPS-induced PDLCs injury by increasing cell viability and decreasing apoptosis and inflammatory response. Moreover, we were the first to identify that MEG3 can target miR-143-3p to regulate the AKT/IKK pathway. Our study indicates that MEG3 has potential in treatment of periodontitis. Downregulation of MEG3 was measured in periodontitis, which was similar to that in previous study [18]. To explore the function of MEG3 in periodontitis in vitro, we performed gain-of-function experiments, and found that MEG3 overexpression protected PDLCs viability from LPS by decreasing cell apoptosis. The pro-inflammatory cytokines IL-6, IL-1β, and TNF-α and T cell regulatory cytokine IL-18 are important regulators of inflammatory injury in periodontitis [34]. The NF-κB pathway is an inflammatory signaling pathway activated by LPS in periodontitis [35,36]. Our research showed that MEG3 suppressed activation of the NF-κB pathway in LPS-treated PDLCs, which was also in agreement with results of a diabetic retinopathy study [17]. By detecting these events, we found that MEG3 inhibited LPS-induced inflammatory response in PDLCs by decreasing IL-6, IL-18, IL-1β, TNF-α, and NF-κB pathway activation, similar to that in rheumatoid arthritis, diabetic retinopathy, and sepsis [16,17,37], but opposite to that in chronic obstructive pulmonary disease and atherosclerosis [15,38]. We hypothesized that this is caused by the alteration of inflammatory microenvironments in different conditions. Collectively, MEG3 appears to play a protective role in periodontitis by inhibiting inflammatory response and increasing cell growth. The crosstalk between lncRNA and miRNA is a key mechanism underlying lncRNA in human diseases [39]. Previous studies have explored multiple targets of MEG3, such as miR-93-5p, miR-218, miR-204, miR-141, and miR-34a [14-17,38]. Because of the presence of various binding sites of MEG3, new targets need to be explored. The present study is the first to identify miR-143-3p was targeted via MEG3 and that miR-143-3p level was enhanced in periodontitis, which is also consistent with previous research [23]. Moreover, knockdown of miR-143-3p inhibited LPS-induced inflammatory injury in PDLCs, which was like that in myocardial hypertrophy [22]. In addition, miR-143-3p overexpression weakened the anti-inflammatory role of MEG3, suggesting that MEG3 inhibits periodontitis progression by decreasing miR-143-3p. The AKT/IKK pathway is an important regulator of the NF-κB pathway in inflammatory conditions [25,40] and is activated in periodontitis [27,41]. Similarly, we also found that the AKT/IKK pathway was activated in LPS-treated PDLCs. Furthermore, MEG3 overexpression inhibited LPS-induced activation of AKT/IKK pathway in PDLCs, which was also in agreement with that in other conditions, such as choriocarcinoma and rheumatoid arthritis [16,42]. miR-143-3p attenuated MEG3-mediated inhibition of the AKT/IKK pathway by restoring the phosphorylation of AKT and IKK, indicating that MEG3 inactivated the AKT/IKK pathway by sponging miR-143-3p in LPS-treated PDLCs. Although previous studies suggested miR-143-3p restrains activation of the AKT/IKK pathway by targeting ITGA6 or MSI2 in gallbladder carcinoma and thyroid cancer [43,44], we hypothesized that the inconsistent results might be induced by different microenvironments. miRNAs usually acquire function by binding the 3′-UTR of mRNA of the target genes. Hence, the exact targets of miR-143-3p that might be associated with MEG3/miR-143-3p axis should be explored in future. Moreover, we did not perform in vivo experiments and animal experiments are needed to further explore the role and mechanism of MEG3 in periodontitis in vivo.

Conclusions

We found that MEG3 expression was decreased in periodontitis, and MEG3 overexpression repressed LPS-induced PDLCs injury, possibly by inactivating the AKT/IKK pathway by sponging miR-143-3p. Our results suggest MEG3 could be a new target for the treatment of periodontitis.
  43 in total

Review 1.  Periodontal diseases.

Authors:  Denis F Kinane; Panagiota G Stathopoulou; Panos N Papapanou
Journal:  Nat Rev Dis Primers       Date:  2017-06-22       Impact factor: 52.329

2.  Long noncoding RNA MEG3 is a tumor suppressor in choriocarcinoma by upregulation of microRNA-211.

Authors:  Li Ji; Xue Li
Journal:  J Cell Physiol       Date:  2019-05-23       Impact factor: 6.384

3.  Identification of a novel salivary biomarker miR-143-3p for periodontal diagnosis: A proof of concept study.

Authors:  K J Nisha; Presanthila Janam; K Harshakumar
Journal:  J Periodontol       Date:  2019-05-10       Impact factor: 6.993

Review 4.  Maternally expressed gene 3 (MEG3): A tumor suppressor long non coding RNA.

Authors:  Soudeh Ghafouri-Fard; Mohammad Taheri
Journal:  Biomed Pharmacother       Date:  2019-07-18       Impact factor: 6.529

5.  Inhibition of microRNA-143-3p attenuates myocardial hypertrophy by inhibiting inflammatory response.

Authors:  Bo Yu; Yanan Zhao; Hongli Zhang; Di Xie; Wei Nie; Kaiyao Shi
Journal:  Cell Biol Int       Date:  2018-09-26       Impact factor: 3.612

6.  Down-regulation of long non-coding RNA MEG3 suppresses osteogenic differentiation of periodontal ligament stem cells (PDLSCs) through miR-27a-3p/IGF1 axis in periodontitis.

Authors:  Yi Liu; Chunpeng Liu; Ankui Zhang; Shichang Yin; Ting Wang; Yan Wang; Meiming Wang; Yixin Liu; Qiaohui Ying; Jinrui Sun; Fulan Wei; Dongxu Liu; Chunling Wang; Shaohua Ge
Journal:  Aging (Albany NY)       Date:  2019-08-09       Impact factor: 5.682

Review 7.  Crosstalk between Long Noncoding RNAs and MicroRNAs in Health and Disease.

Authors:  Ahmed S Bayoumi; Amer Sayed; Zuzana Broskova; Jian-Peng Teoh; James Wilson; Huabo Su; Yao-Liang Tang; Il-Man Kim
Journal:  Int J Mol Sci       Date:  2016-03-11       Impact factor: 5.923

Review 8.  The Link between Fetal Programming, Inflammation, Muscular Strength, and Blood Pressure.

Authors:  Jose Lopez-Lopez; Patricio Lopez-Jaramillo; Paul A Camacho; Diego Gomez-Arbelaez; Daniel D Cohen
Journal:  Mediators Inflamm       Date:  2015-09-27       Impact factor: 4.711

9.  miR-143-3p targeting of ITGA6 suppresses tumour growth and angiogenesis by downregulating PLGF expression via the PI3K/AKT pathway in gallbladder carcinoma.

Authors:  Yun-Peng Jin; Yun-Ping Hu; Xiang-Song Wu; Yao-Shi Wu; Yuan-Yuan Ye; Huai-Feng Li; Yong-Chen Liu; Lin Jiang; Fa-Tao Liu; Yi-Jian Zhang; Ya-Juan Hao; Xi-Yong Liu; Ying-Bin Liu
Journal:  Cell Death Dis       Date:  2018-02-07       Impact factor: 8.469

Review 10.  Periodontitis: A Multifaceted Disease of Tooth-Supporting Tissues.

Authors:  Eija Könönen; Mervi Gursoy; Ulvi Kahraman Gursoy
Journal:  J Clin Med       Date:  2019-07-31       Impact factor: 4.241

View more
  3 in total

Review 1.  Regulation of Methylase METTL3 on Fat Deposition.

Authors:  Gang Luo; Jialing Chen; Zhanjun Ren
Journal:  Diabetes Metab Syndr Obes       Date:  2021-12-20       Impact factor: 3.168

Review 2.  The Expression and Regulatory Roles of Long Non-Coding RNAs in Periodontal Ligament Cells: A Systematic Review.

Authors:  Yifan Lin; Zhongyuan Tang; Lijian Jin; Yanqi Yang
Journal:  Biomolecules       Date:  2022-02-12

Review 3.  MicroRNAs: Harbingers and shapers of periodontal inflammation.

Authors:  Xianghong Luan; Xiaofeng Zhou; Pooria Fallah; Mirali Pandya; Huling Lyu; Deborah Foyle; Dan Burch; Thomas G H Diekwisch
Journal:  Semin Cell Dev Biol       Date:  2021-06-10       Impact factor: 7.499

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.