Katherine A McCulloch1, Kingston Zhou1, Yishi Jin1. 1. Division of Biological Sciences, Section of Neurobiology, University of California San Diego, La Jolla, California, United States of America.
Abstract
Neuropeptides are secreted molecules that have conserved roles modulating many processes, including mood, reproduction, and feeding. Dysregulation of neuropeptide signaling is also implicated in neurological disorders such as epilepsy. However, much is unknown about the mechanisms regulating specific neuropeptides to mediate behavior. Here, we report that the expression levels of dozens of neuropeptides are up-regulated in response to circuit activity imbalance in C. elegans. acr-2 encodes a homolog of human nicotinic receptors, and functions in the cholinergic motoneurons. A hyperactive mutation, acr-2(gf), causes an activity imbalance in the motor circuit. We performed cell-type specific transcriptomic analysis and identified genes differentially expressed in acr-2(gf), compared to wild type. The most over-represented class of genes are neuropeptides, with insulin-like-peptides (ILPs) the most affected. Moreover, up-regulation of neuropeptides occurs in motoneurons, as well as sensory neurons. In particular, the induced expression of the ILP ins-29 occurs in the BAG neurons, which were previously shown to function in gas-sensing. We also show that this up-regulation of ins-29 in acr-2(gf) animals is activity-dependent. Our genetic and molecular analyses support cooperative effects for ILPs and other neuropeptides in promoting motor circuit activity in the acr-2(gf) background. Together, this data reveals that a major transcriptional response to motor circuit dysregulation is in up-regulation of multiple neuropeptides, and suggests that BAG sensory neurons can respond to intrinsic activity states to feedback on the motor circuit.
Neuropeptides are secreted molecules that have conserved roles modulating many processes, including mood, reproduction, and feeding. Dysregulation of neuropeptide signaling is also implicated in neurological disorders such as epilepsy. However, much is unknown about the mechanisms regulating specific neuropeptides to mediate behavior. Here, we report that the expression levels of dozens of neuropeptides are up-regulated in response to circuit activity imbalance in C. elegans. acr-2 encodes a homolog of human nicotinic receptors, and functions in the cholinergic motoneurons. A hyperactive mutation, acr-2(gf), causes an activity imbalance in the motor circuit. We performed cell-type specific transcriptomic analysis and identified genes differentially expressed in acr-2(gf), compared to wild type. The most over-represented class of genes are neuropeptides, with insulin-like-peptides (ILPs) the most affected. Moreover, up-regulation of neuropeptides occurs in motoneurons, as well as sensory neurons. In particular, the induced expression of the ILP ins-29 occurs in the BAG neurons, which were previously shown to function in gas-sensing. We also show that this up-regulation of ins-29 in acr-2(gf) animals is activity-dependent. Our genetic and molecular analyses support cooperative effects for ILPs and other neuropeptides in promoting motor circuit activity in the acr-2(gf) background. Together, this data reveals that a major transcriptional response to motor circuit dysregulation is in up-regulation of multiple neuropeptides, and suggests that BAG sensory neurons can respond to intrinsic activity states to feedback on the motor circuit.
Neural circuits are dynamic, changing their properties in response to experience. These changes are critical for maintaining circuit homeostasis and in processes like memory. Many factors such as c-Fos and BDNF, are activated early in response to increased neural activity and further regulate the expression of downstream genes [1]. These early-acting genes are also involved in many neurological diseases. For example, mutations in the activity-dependent transcriptional repressor gene Mecp2 are associated with Rett’s syndrome [2]. Mecp2 is necessary for the transcriptional up-regulation of BDNF, a key early-acting gene regulating synaptic plasticity [3].Neuropeptides are small, secreted molecules that play neuro-modulatory roles in all animals. Neuropeptides have an extraordinarily diverse set of functions, including in feeding, mood, and reproduction, among others. Secreted neuropeptides bind to G-protein coupled receptors (GPCRs) on target cells to modulate neuronal activity. Neuropeptides can act on cells post-synaptic to where they are secreted from, but can also act over long distances. Neuropeptide expression can be changed by experience, for example, the expression of Neuropeptide Y(NPY) changes in response to a myriad of stressors. NPY can inhibit anxiety in multiple stress models [4], and may also play a role in neurological diseases, such as epilepsy [5]. Although multiple neuropeptides have been implicated in diseases, much remains unknown about how they are regulated [5,6].The nematode C. elegans has long been an important experimental model for investigating the regulation of neuronal circuits. The well-defined connectomics of its nervous system, in combination with powerful genetics and molecular tools, enable in vivo dissection of neural circuit regulation with high resolution. C. elegans locomotion is controlled through the balanced activities of cholinergic excitatory neurons and GABAergic inhibitory neurons to promote contraction and relaxation of body-wall muscle, respectively [7]. The locomotor circuit has been used to identify multiple conserved genes that regulate synaptic transmission [8,9]. The gene acr-2 encodes a neuronal acetylcholine receptor subunit that is expressed in cholinergic motoneurons. A Valine-to-Methionine mutation causes a gain-of-function in acr-2 [acr-2(gf)] that results in a hyperactive channel [10]. The acr-2(gf) mutation affects a highly conserved residue within the pore-lining TM2 domain, and similar mutations in the humanCHRNB2 cholinergic receptor subunit are associated with Autosomal Dominant Frontal Lobe Epilepsy (ADFLE) [11]. acr-2(gf) worms show uncoordinated (or Unc) movement as well as spontaneous whole-body shrinking, or convulsion.Over 100 neuropeptide genes have been identified in C. elegans. These genes produce neuropeptides that fall into three classes: FMRFamide-like peptides (FLP), neuropeptide-like proteins (NLP) and insulin-like peptides (ILP) [12]. As with neuropeptides in humans, each neuropeptide gene produces a pro-neuropeptide, that is subjected to several enzymatic processing steps. The flp and nlp genes can generate several neuropeptides from a single locus through enzymatic cleavage by the pro-protein convertase egl-3 and the endopeptidase egl-21 [13,14]. Similar to humaninsulin and insulin-like growth factors, the ins loci produce a single peptide, that is activated from the pro-insulin peptide through the enzymatic activity of egl-3 and a related pro-protein convertase kpc-1 [15].Previous work has shown that the neuropeptides flp-18 and flp-1 are important for regulating neurotransmission in acr-2(gf) mutants [16]. Loss of both flp-18 and flp-1 resulted in enhancement of acr-2(gf) motor defects. Additionally, flp-18 expression was up-regulated in cholinergic motoneurons to inhibit convulsion of acr-2(gf) animals in a homeostatic manner. However, loss of function in the gene unc-31/CAPS, which is required for neuropeptide secretion, suppressed acr-2(gf) convulsion, suggesting that other neuropeptides function to promote circuit hyperactivity [17]. Using a cell-type specific transcriptomic approach, we identified over 200 genes whose expression was significantly altered in acr-2(gf) neurons compared to wild type. Among them, genes involved in neuropeptide signaling were significantly over-represented in this gene list. One of these, ins-29, has not been previously characterized. Expression reporters for ins-29 are weakly or not expressed in BAG gas-sensing neurons in wild type, and ins-29 expression is clearly increased in acr-2(gf) animals. The increased ins-29 expression in BAG neurons of acr-2(gf) adults is activity-dependent and requires the transcription factor ets-5, which has been shown previously to act embryonically to make BAG functionally competent [18]. Although BAG neurons interact with the motor circuit to respond to environmental cues, our data indicates that intrinsic activity states modulate expression of genes in the sensory BAG neuron, which then feed-back on the motor circuit. Finally, we present functional evidence supporting that the concerted action of several neuropeptides underlies motor circuit hyperactivity.
Results
Expression profiling of adult cholinergic neurons
We performed cell-type specific RNA-seq analyses, using the Pacr-2::gfp reporter juIs14 to isolate GFP expressing neuronal cells by FACS followed by RNA-seq (Materials and methods, S1 Table) [10,19,20,21]. Besides expression in the ventral cord cholinergic motoneurons (VA, VB, DA, and DB), GFP expressed from juIs14 is also present in several unidentified neurons in the head and tail [10]. RNA-seq data from isolated wild-type neurons was analyzed with the Cufflinks program to identify expressed genes (Materials and methods, S2 Table). The gene list for the neurons labeled by Pacr-2::gfp from wild type animals was compared with a recent study that profiled major tissue-types in adult C. elegans [22]. We found that almost all of the genes identified in our dataset (~95%) were also detected in a pan-neuronal analyses of expressed genes (Fig 1A), but shared very little overlap with tissue-specific expression profiles identifying enriched transcripts in hypodermis and muscle (Fig 1A). This comparison suggests our samples were relatively free of contamination from surrounding non-neuronal tissue. We also compared our gene list to previous analysis of a subset of cholinergic motoneurons (VA and DA) labeled with Punc-4::gfp [23]. Although the cell-types analyzed in these studies are not identical (A-type only vs. neurons expressing Pacr-2::gfp), and they were performed at different life stages (larval vs. young adult in this study) using different techniques (microarray vs. RNA-seq in this study), over half of the genes (~75%) from our dataset were also identified by microarray in larval type A motoneurons (Fig 1B). These include core cholinergic genes such as unc-17/VAChT (Avg. FPKM = 484.1) and pan-neuronal genes such as unc-13 (Avg. FPKM = 90.9), required for synaptic vesicle priming [24,25]. Additionally, both of these datasets were relatively free of transcripts enriched in GABAergic motoneurons. Thus, this comparison shows the genes identified in our sample are highly enriched for those that are validated to be expressed and function in cholinergic neurons.
Fig 1
Differential expression analyses of acr-2(gf) neurons compared to wild type.
A. Few genes identified as expressed in isolated adult neurons labeled by Pacr-2::gfp are enriched in hypodermal or muscle datasets [22]. In contrast, almost all of the genes identified as expressed in cholinergic neurons labeled by Pacr-2::gfp are identified in pan-neuronal data-sets. Shown are Venn Diagrams with overlaps between the indicated data sets. The number in each region indicates the number of genes in that category. Hypodermis, muscle, and neuronal datasets are from Kaletsky et al. (2018). Statistics for significance of overlap were performed using a hypergeometric distribution with the phyper function in R. B. Genes identified in previous expression profiling of larval cholinergic motoneurons, including core neuronal and cholinergic markers, are identified by RNA-seq of Pacr-2::gfp expressing neurons [23]. The Venn Diagram displays that over half of genes identified by microarray as expressed in larval A-type motoneurons are also identified by RNA-seq in adult cholinergic neurons that express Pacr-2::gfp. The number in each region indicates the number of genes in that category. Larval A-type motor neuron expression data is from Von Stetina et al. (2007). Statistics for significance of overlap were performed using a hypergeometric distribution with the phyper function in R. C. Histogram of log2(Fold Change) for significantly different genes. Most genes that were different in acr-2(gf) compared to wild type were up-regulated at around 2-fold. D. GO-term analyses of genes significantly different in acr-2(gf) neurons compared to wild type (see Materials and methods). Genes involved in neuropeptide and G-protein signaling (which included neuropeptide genes) were the most affected.
Differential expression analyses of acr-2(gf) neurons compared to wild type.
A. Few genes identified as expressed in isolated adult neurons labeled by Pacr-2::gfp are enriched in hypodermal or muscle datasets [22]. In contrast, almost all of the genes identified as expressed in cholinergic neurons labeled by Pacr-2::gfp are identified in pan-neuronal data-sets. Shown are Venn Diagrams with overlaps between the indicated data sets. The number in each region indicates the number of genes in that category. Hypodermis, muscle, and neuronal datasets are from Kaletsky et al. (2018). Statistics for significance of overlap were performed using a hypergeometric distribution with the phyper function in R. B. Genes identified in previous expression profiling of larval cholinergic motoneurons, including core neuronal and cholinergic markers, are identified by RNA-seq of Pacr-2::gfp expressing neurons [23]. The Venn Diagram displays that over half of genes identified by microarray as expressed in larval A-type motoneurons are also identified by RNA-seq in adult cholinergic neurons that express Pacr-2::gfp. The number in each region indicates the number of genes in that category. Larval A-type motor neuron expression data is from Von Stetina et al. (2007). Statistics for significance of overlap were performed using a hypergeometric distribution with the phyper function in R. C. Histogram of log2(Fold Change) for significantly different genes. Most genes that were different in acr-2(gf) compared to wild type were up-regulated at around 2-fold. D. GO-term analyses of genes significantly different in acr-2(gf) neurons compared to wild type (see Materials and methods). Genes involved in neuropeptide and G-protein signaling (which included neuropeptide genes) were the most affected.
Differential expression analyses between wild-type and acr-2(gf) neurons
We are interested in the genes differentially expressed in response to altered neuronal activity. The transcriptome of neurons labeled by Pacr-2::gfp in adult acr-2(gf) mutants was compared to those from wild type animals for changes in gene expression using DESeq2. This analysis identified 234 genes as significantly mis-expressed in acr-2(gf) mutants (S2 Table) [26,27]. We found flp-18 to be significantly up-regulated in acr-2(gf), as predicated from our previous studies [16]. Analysis of the distribution of the fold change data using a histogram showed that a majority of the changes were up-regulation, at around 2-fold (Fig 1C). GO-term analyses [28] indicated that genes involved in neuropeptide signaling were highly enriched in our gene list (Fig 1D). In total, the expression of 21 neuropeptide genes were identified as significantly up-regulated in acr-2(gf) neurons, representing approximately 18% of the estimated 113 neuropeptide genes identified in C. elegans (Fig 2A) [12]. Of these, several insulin-like peptides (ILP) were the most up-regulated (Fig 2A, S2 Table). In addition, none of these ILP genes were detected as expressed in wild type samples (S2 Table). Together, these data indicate that the major response to altered motor circuit activity at the transcriptional level is to increase neuropeptide gene expression.
Fig 2
Neuropeptides are up-regulated in head neurons in acr-2(gf) animals.
A. Log2(Fold Change) values for all up-regulated neuropeptides in acr-2(gf) animals are shown, grouped by class, as identified with DESeq2 analyses. Neuropeptides of each class were affected. (*P<0.05, **P<0.01, ***P<0.001). B-E. Differential expression of neuropeptide transcriptional reporters in the head of acr-2(gf) animals compared to wild type. (B,D) The arrow points to the SMB neuron expressing the Pflp-12 transcriptional reporter (juEx7964) in wild type based on shape and location. Dashed arrows point to the bilateral pair ectopically expressing the reporter in acr-2(gf). Dashed lines indicated approximate outline of the animal. The posterior fluorescent signal in both strains is the co-injection marker labeling coelomocytes.(C,E) Pnlp-1::gfp (juEx7879) expression is both increased in the same cells as wild type and also ectopically expressed. Brackets delineate the anterior and posterior pharyngeal bulbs, respectively.
Neuropeptides are up-regulated in head neurons in acr-2(gf) animals.
A. Log2(Fold Change) values for all up-regulated neuropeptides in acr-2(gf) animals are shown, grouped by class, as identified with DESeq2 analyses. Neuropeptides of each class were affected. (*P<0.05, **P<0.01, ***P<0.001). B-E. Differential expression of neuropeptide transcriptional reporters in the head of acr-2(gf) animals compared to wild type. (B,D) The arrow points to the SMB neuron expressing the Pflp-12 transcriptional reporter (juEx7964) in wild type based on shape and location. Dashed arrows point to the bilateral pair ectopically expressing the reporter in acr-2(gf). Dashed lines indicated approximate outline of the animal. The posterior fluorescent signal in both strains is the co-injection marker labeling coelomocytes.(C,E) Pnlp-1::gfp (juEx7879) expression is both increased in the same cells as wild type and also ectopically expressed. Brackets delineate the anterior and posterior pharyngeal bulbs, respectively.To validate the RNA-seq analyses, we analyzed transcriptional reporters for the most up-regulated neuropeptide gene of each class. flp-12 and nlp-1 were the most up-regulated neuropeptides of their respective classes. These genes have been implicated in context-dependent behaviors. flp-12 is involved in male locomotion, and nlp-1 functions in food-evoked turning behaviors [29,30]. 2kb upstream sequences of flp-12 and nlp-1 were used to generate GFP reporters, and both reporters showed expression in neurons in the head, similar to published studies of these neuropeptides (Fig 2B–2E) [31,32]. In acr-2(gf), the flp-12 reporter showed a different expression pattern than wild type, with ectopic expression in a pair of neurons close to the ganglion (Fig 2B and 2D). Similarly, the nlp-1 reporter was up-regulated and expressed in additional cells in acr-2(gf) animals compared to wild type (Fig 2C and 2E). Therefore, this analysis provides an explanation for the increased RNA levels detected in RNA-seq of acr-2(gf), and also shows that increased locomotor excitation may cause mis-expression of these neuropeptide genes.
acr-2(gf) increases expression of ins-29 and acr-2 in BAG sensory neurons
Among all up-regulated neuropeptides, ins-25 and ins-29 showed the most dramatic increase (Fig 2A). As the expression pattern and function of these ILPs is unknown, we investigated their expression patterns in further detail. ins-25 and ins-29 are in an operon on Chromosome I, with ins-29 being upstream of ins-25, separated by 697bp intergenic sequence (Materials and methods, Fig 3A). We used 2kb upstream sequences of ins-29 to drive GFP expression. In wild type animals, the Pins-29 transcription reporter was sometimes weakly expressed in two neurons in the head, but often expressed in just one neuron or no GFP expression was detected (Fig 3B). However, in acr-2(gf) animals, consistent strong expression of GFP was observed in the same two head neurons (Fig 3C). These neurons are likely sensory, as they extend dendrites out to the nose of the animal.
Fig 3
Expression of ILP genes and acr-2 is up-regulated in two head neurons in acr-2(gf) animals.
A. Shown is the gene structure of ins-29 and ins-25 loci. Also shown are diagrams of the ins-29 transcription reporters and expression constructs used in this study (Listed in S1 Table). Two ins-29 expression constructs were made, one that contained SL2::mKate2 sequence to monitor transgene expression, the other has mKate2 in-frame fused to INS-29, without the SL2 trans-splice sequence. B-C. Pins-29::gfp is expressed in two head neurons in acr-2(gf). scale bar:10μm. (B) in wild-type Pins-29::gfp(juEx7742) is often detected in one or zero cells in the head. (C) In acr-2(gf), Pins-29::gfp is strongly expressed in two head neurons. D-I. A Pins-29::ins-29::SL2::mKate2 reporter(juEx7966) co-localizes with Pacr-2::gfp(juIs14) expression in acr-2(gf) animals, but not in wild type. scale bar:10μm. Cell bodies expressing mKate2 are labeled by an arrow. (D) In wild type animals, Pins-29::ins-29::SL2::mKate2(juEx7966) is weakly or not expressed in the head. Shown is an animal expressing the transgene in a single neuron. (E) Pacr-2::gfp is expressed in multiple neurons in the head of wild type animals. (F) Expression of ins-29 and acr-2 transcriptional reporters do not overlap in wild type animals, suggesting that acr-2 is not normally expressed in the same neurons as ins-29 in wild type. (G) Expression of Pins-29::ins-29::SL2::mKate2 in acr-2(gf) is similar to that of Pins-29::gfp observed in (C). (H) Expression of Pacr-2::gfp reporter in acr-2(gf) animals. (I) Co-localization is observed between the ins-29 reporter and Pacr-2::gfp in acr-2(gf) animals. In all images, animals are rolled ventral-side up for easy visualization of neuron pairs. The dashed lines represent the approximate outline of the animal. The two processes in the head of animals expressing the Pins-29::ins-29::SL2::mKate2 are mechanosensory neuron dendrites labeled by the Pmec-4::gfp co-injection marker. Beading observed in some images (i.e. the Pacr-2::gfp in E, H) is due to rolling the animals in 10% agarose.
Expression of ILP genes and acr-2 is up-regulated in two head neurons in acr-2(gf) animals.
A. Shown is the gene structure of ins-29 and ins-25 loci. Also shown are diagrams of the ins-29 transcription reporters and expression constructs used in this study (Listed in S1 Table). Two ins-29 expression constructs were made, one that contained SL2::mKate2 sequence to monitor transgene expression, the other has mKate2 in-frame fused to INS-29, without the SL2 trans-splice sequence. B-C. Pins-29::gfp is expressed in two head neurons in acr-2(gf). scale bar:10μm. (B) in wild-type Pins-29::gfp(juEx7742) is often detected in one or zero cells in the head. (C) In acr-2(gf), Pins-29::gfp is strongly expressed in two head neurons. D-I. A Pins-29::ins-29::SL2::mKate2 reporter(juEx7966) co-localizes with Pacr-2::gfp(juIs14) expression in acr-2(gf) animals, but not in wild type. scale bar:10μm. Cell bodies expressing mKate2 are labeled by an arrow. (D) In wild type animals, Pins-29::ins-29::SL2::mKate2(juEx7966) is weakly or not expressed in the head. Shown is an animal expressing the transgene in a single neuron. (E) Pacr-2::gfp is expressed in multiple neurons in the head of wild type animals. (F) Expression of ins-29 and acr-2 transcriptional reporters do not overlap in wild type animals, suggesting that acr-2 is not normally expressed in the same neurons as ins-29 in wild type. (G) Expression of Pins-29::ins-29::SL2::mKate2 in acr-2(gf) is similar to that of Pins-29::gfp observed in (C). (H) Expression of Pacr-2::gfp reporter in acr-2(gf) animals. (I) Co-localization is observed between the ins-29 reporter and Pacr-2::gfp in acr-2(gf) animals. In all images, animals are rolled ventral-side up for easy visualization of neuron pairs. The dashed lines represent the approximate outline of the animal. The two processes in the head of animals expressing the Pins-29::ins-29::SL2::mKate2 are mechanosensory neuron dendrites labeled by the Pmec-4::gfp co-injection marker. Beading observed in some images (i.e. the Pacr-2::gfp in E, H) is due to rolling the animals in 10% agarose.To confirm that the ins-29 expression construct was expressed in cells labeled by Pacr-2::gfp, we generated an ins-29 expression construct containing the endogenous ins-29 trans-spliced to mKate2 (Fig 3D–3I). The Pins-29::ins-29::SL2::mKate2 expression pattern was similar to Pins-29::gfp (Fig 3B–3D and 3G). We then generated strains co-expressing Pins-29::ins-29::SL2::mKate2 and Pacr-2::gfp. In wild-type, Pacr-2::gfp was expressed in several unidentified neurons in the head, in addition to its reported expression in ventral cord cholinergic motoneurons [10]. No co-localization was observed between Pacr-2::gfp and the Pins-29::ins-29::SL2::mKate2 in wild type animals that showed expression of the ins-29 reporter (Fig 3D–3F). However, in acr-2(gf) animals, the expression of Pins-29::ins-29::SL2::mKate2 showed co-localization with Pacr-2::gfp (Fig 3G–3I). This result suggests that, although total mRNA levels of acr-2 in neurons are not significantly affected by the acr-2(gf) mutation, there is increased expression of acr-2 in some head neurons compared to wild type.The dendrite morphology and cell position of cells expressing ins-29 suggested that they were likely to be the BAG neurons, which are known for their role in gas-sensing, particularly CO2 avoidance (Fig 3C) [33,34,35]. To confirm that the cells expressing ins-29 were indeed BAG neurons, animals were generated co-expressing the Pins-29::ins-29::SL2::mKate reporter and an integrated GFP marker for BAG [Pgcy-33::gfp] (Fig 4A–4F). We observed that in acr-2(gf) animals, where the ins-29 reporter expression was consistently detected, the expression of mKate2 completely overlapped with GFP (Fig 4D–4F). For those wild type animals that expressed the ins-29 reporter, mKate2 also overlapped with the BAG GFP marker (Fig 4A–4C).
Fig 4
ins-29 is expressed in BAG neurons and is regulated by motor circuit activity.
A-F. Pins-29 reporter is expressed in BAG neurons. Cell bodies expressing indicated reporters are labeled by an arrow. (A) In wild type animals, expression of Pins-29::ins-29::SL2::mKate2 in a single neuron in the head is shown. This reporter is often not expressed at all or in a single neuron in wild type, similar to the transcriptional GFP reporter (B) Pgcy-33::gfp labels BAG neurons in the head. (C) Overlap between the two reporters can be observed in one neuron in wild type. (D) Expression of Pins-29::ins-29::SL2::mKate2 is observed in two head neurons in acr-2(gf), similar to the transcriptional GFP reporter. (E) Expression of Pgcy-33::gfp in acr-2(gf) is similar to wild type in acr-2(gf). (F) Complete overlap is observed between the two reporters in acr-2(gf). GFP-only signal is from the Pmec-4::gfp co-injection marker. Scale bar:10μm. In all images, animals are rolled in 10% agarose to facilitate visualization of BAG neuron pairs. Beading observed in some images (i.e. the Pgcy-33::gfp and Pmec-4::gfp in B) is due to the mounting procedure. G. Almost all acr-2(gf) animals express Pins-29::gfp(juEx7742) in both BAG neurons, however mutation of ets-5 causes animals to exhibit more similar Pins-29::gfp expression patterns as wild type. To assay Pins-29::gfp expression, animals were scored for detectable GFP in 0, 1, or 2 BAG neurons. N for each genotype is labeled in the bar. H. Loss-of-function of the TRPM channel gtl-2, which almost completely suppresses acr-2(gf) convulsion and locomotion phenotypes, also restores Pins-29::gfp(juEx7742) expression to wild-type patterns. To assay Pins-29::gfp expression, animals were scored for detectable GFP in 0, 1, or 2 BAG neurons. N for each genotype is labeled in the bar. I. Expression of acr-2(gf) in BAG neurons does not cause convulsions. Shown are convulsion rates of acr-2(gf) animals and transgenic animals expressing cell-type specific acr-2(gf). Pgcy-33::acr-2(gf)::gfp (juEx8070, juEx8071, arrays also contain Pins-29::gfp sequence) does not result in convulsion. Punc-129::acr-2(gf)::gfp (juEx8068, juEx8069) induces convulsion, albeit at a lower frequency than in acr-2(gf) mutants. Box-and-whisker plots are shown with the middle bar representing the median. ***P<0.001, One-way ANOVA followed by Bonferroni post-hoc test. N≥13 for each genotype. J. Expression of acr-2(gf) in a subset of motor neurons, but not BAG neurons, causes almost complete penetrance of Pins-29::gfp expression in BAG neurons. To assay Pins-29::gfp expression, animals were scored for detectable free GFP in cell body and dendrites in 0, 1, or 2 BAG neurons. Animals carrying Pgcy-33::acr-2(gf)::gfp arrays (juEx8070, juEx8071, arrays also contain Pins-29::gfp sequence) or Punc-129::acr-2(gf)::gfp (juEx8068, juEx8069, arrays also contain Pins-29::gfp sequence) were scored. N for each genotype is labeled in the bar.
ins-29 is expressed in BAG neurons and is regulated by motor circuit activity.
A-F. Pins-29 reporter is expressed in BAG neurons. Cell bodies expressing indicated reporters are labeled by an arrow. (A) In wild type animals, expression of Pins-29::ins-29::SL2::mKate2 in a single neuron in the head is shown. This reporter is often not expressed at all or in a single neuron in wild type, similar to the transcriptional GFP reporter (B) Pgcy-33::gfp labels BAG neurons in the head. (C) Overlap between the two reporters can be observed in one neuron in wild type. (D) Expression of Pins-29::ins-29::SL2::mKate2 is observed in two head neurons in acr-2(gf), similar to the transcriptional GFP reporter. (E) Expression of Pgcy-33::gfp in acr-2(gf) is similar to wild type in acr-2(gf). (F) Complete overlap is observed between the two reporters in acr-2(gf). GFP-only signal is from the Pmec-4::gfp co-injection marker. Scale bar:10μm. In all images, animals are rolled in 10% agarose to facilitate visualization of BAG neuron pairs. Beading observed in some images (i.e. the Pgcy-33::gfp and Pmec-4::gfp in B) is due to the mounting procedure. G. Almost all acr-2(gf) animals express Pins-29::gfp(juEx7742) in both BAG neurons, however mutation of ets-5 causes animals to exhibit more similar Pins-29::gfp expression patterns as wild type. To assay Pins-29::gfp expression, animals were scored for detectable GFP in 0, 1, or 2 BAG neurons. N for each genotype is labeled in the bar. H. Loss-of-function of the TRPM channel gtl-2, which almost completely suppresses acr-2(gf) convulsion and locomotion phenotypes, also restores Pins-29::gfp(juEx7742) expression to wild-type patterns. To assay Pins-29::gfp expression, animals were scored for detectable GFP in 0, 1, or 2 BAG neurons. N for each genotype is labeled in the bar. I. Expression of acr-2(gf) in BAG neurons does not cause convulsions. Shown are convulsion rates of acr-2(gf) animals and transgenic animals expressing cell-type specific acr-2(gf). Pgcy-33::acr-2(gf)::gfp (juEx8070, juEx8071, arrays also contain Pins-29::gfp sequence) does not result in convulsion. Punc-129::acr-2(gf)::gfp (juEx8068, juEx8069) induces convulsion, albeit at a lower frequency than in acr-2(gf) mutants. Box-and-whisker plots are shown with the middle bar representing the median. ***P<0.001, One-way ANOVA followed by Bonferroni post-hoc test. N≥13 for each genotype. J. Expression of acr-2(gf) in a subset of motor neurons, but not BAG neurons, causes almost complete penetrance of Pins-29::gfp expression in BAG neurons. To assay Pins-29::gfp expression, animals were scored for detectable free GFP in cell body and dendrites in 0, 1, or 2 BAG neurons. Animals carrying Pgcy-33::acr-2(gf)::gfp arrays (juEx8070, juEx8071, arrays also contain Pins-29::gfp sequence) or Punc-129::acr-2(gf)::gfp (juEx8068, juEx8069, arrays also contain Pins-29::gfp sequence) were scored. N for each genotype is labeled in the bar.The transcription factor ets-5 is required for BAG development and function [18]. To determine if ets-5 is involved in the expression of ins-29 in acr-2(gf), an ets-5(0) acr-2(gf) double mutant strain with Pins-29::gfp was generated. Penetrance of expression was quantified by scoring for presence of GFP expression in zero, one, or both BAG neurons (Fig 4G). Very few wild-type animals expressed the transgene in both BAG neurons (31%), while most acr-2(gf) animals (99%) did. We found a marked decrease in the expression of the Pins-29::gfp reporter in ets-5(0) acr-2(gf) mutants, similar to wild type. Altogether, these data indicate that in acr-2(gf) animals, ins-29 is up-regulated in sensory BAG neurons in an ets-5-dependent manner.
ins-29 expression in BAG neurons is regulated by systemic acr-2(gf) activity
To address whether the up-regulation of Pins-29::gfp in response to acr-2(gf) is dependent on neuronal activity, we next tested if reduction in motor circuit hyperactivity could restore expression of ins-29 to wild type. The TRPM channel gtl-2 is expressed in non-neuronal tissues, such as the hypodermis, and regulates motor circuit hyperexcitation via systemic ion homeostasis [36]. Null mutation of gtl-2 almost completely suppresses acr-2(gf) convulsion and locomotion phenotypes. The expression of Pins-29::gfp was analyzed in both gtl-2(0) and gtl-2(0); acr-2(gf) backgrounds. Animals were scored for GFP expression in zero, one, or both neurons (Fig 4H). gtl-2(0) animals alone resembled wild type. The expression pattern of Pins-29::gfp in gtl-2(0); acr-2(gf) animals also resembled wild type. This result supports the idea that the changes in neuropeptide expression are likely due to systemic motor activity.In light of the finding that acr-2 expression was up-regulated in BAG neurons (Fig 3D–3I), we wished to discriminate whether ins-29 expression was regulated by acr-2(gf) activity in BAG neurons or the motor circuit. We expressed acr-2(gf) cDNA in a subset of motor neurons or in BAG neurons and assessed Pins-29::gfp expression. As previously reported, expression of acr-2(gf) using the unc-129 promoter (which drives expression in the ventral cord DA and DB motoneurons) caused animals to display an Unc phenotype as well as convulsions, albeit at a lower frequency than acr-2(gf) mutants (Fig 4I) [37]. In contrast, BAG neuron-specific expression of acr-2(gf) driven by the gcy-33 promoter did not cause convulsion. We quantified penetrance of Pins-29::gfp reporter expression in animals expressing acr-2(gf) in cholinergic motoneurons or BAG neurons and found that almost all animals expressing acr-2(gf) in this small set of cholinergic motoneurons showed expression of the Pins-29::gfp reporter in both BAG neurons, similar to acr-2(gf) mutant animals (Fig 4J). However, animals with the Pgcy-33::acr-2(gf) transgenes had much lower penetrance of Pins-29 reporter expression. Taken together, this data support that increasing motor circuit activity results in a cell non-autonomous effect on ins-29 expression in BAG neurons.Neuropeptides are typically secreted from the cell in which they are produced and can act at a distance (endocrine signaling) as well as on post-synaptic or nearby cells (paracrine signaling). We next sought to address whether INS-29 can be secreted, by generating a transgene expressing INS-29::mKate2 fusion protein. Secreted molecules are present in the coelom (or interstitial fluid), which are generally taken up by the coelomocytes. We found mKate2 in the vacuoles of posterior coelomocytes in both wild type and acr-2(gf) animals (S1 Fig). This observation shows that INS-29 is secreted and may therefore act on multiple cells and tissues within the animal.
Insulin-like peptides and flp-12 coordinately promote motor circuit activity
Next, we addressed whether these neuropeptides expressed from head neurons affect motor circuit function. Genetic null [designated as (0)] mutations were used to determine if candidate up-regulated neuropeptides had functional roles in the acr-2(gf) motor circuit (Materials and methods, Fig 5A). We focused on the most up-regulated neuropeptide genes of each class. Single loss of function mutations of ins-25, ins-29, flp-12, or nlp-1 did not significantly affect convulsion rate of acr-2(gf) (Fig 5B and 5C). Additionally, a large deletion mutation, ju1580, that removed both ins-29 and ins-25 did not significantly affect convulsion rate (Fig 5B and 5C, designated as ins-29(0) ins-25(0)). However, a slight decrease in convulsion rate was detected in flp-12(0) acr-2(gf) animals (Fig 5C). Therefore, several combinations were made between flp-12(0) acr-2(gf) animals and null alleles of ins-29ins-25 or flp-24, the second most up-regulated flp gene. Analysis of convulsion rates in these strains showed that deletion of flp-12 with either flp-24 or ins-29ins-25 resulted in a significant decrease in convulsion rate compared to acr-2(gf) alone (Fig 5C). This analysis suggests that these neuropeptides act in a combinatorial manner to promote circuit hyperactivity.
Fig 5
ILPs and flp-12 coordinately promote motor circuit activity.
A. Shown is the ins-29 and ins-25 gene structure with illustrations of the deletion mutants used in this study. ok2773 is a 354bp deletion in ins-25. ju1776 is a 568bp deletion in ins-29. ju1580 is a 2.2kb deletion of both ins-25 and ins-29, and a similar deletion, ju1596, is made in ins-27(ok2474) genetic background, which is ~6kb 3’ to ins-25. B. Convulsion rate of acr-2(gf) combined with different combinations of deletions in genes for insulin-like peptides up-regulated in acr-2(gf) neurons is shown as convulsions/minute. None of these combinations had a statistically significant effect of convulsion rate. Box-and-whisker plots are shown with the middle bar representing the median (One-way ANOVA followed by Dunnett’s test. N≥18). C. Convulsion rates for indicated genotypes are shown. Deletion of flp-12 in combination with either flp-24(0) or deletion of both ins-29 and ins-25 causes a statistically significant reduction in convulsion rate. Box-and-whisker plots are shown with the middle bar representing the median (*P<0.05, **P<0.01. One-way ANOVA followed by Dunnett’s test. N≥19). D. Over-expression of either flp-12 or ins-29 suppresses convulsion. Over-expression arrays of flp-12(juEx7964) or ins-29(juEx7966, juEx7967) were crossed into indicated mutant backgrounds and scored for convulsion. Box-and-whisker plots are shown with the middle bar representing the median (*P<0.05, **P<0.01, ***P<0.001. One-way ANOVA followed by Dunnett’s test. N≥19).
ILPs and flp-12 coordinately promote motor circuit activity.
A. Shown is the ins-29 and ins-25 gene structure with illustrations of the deletion mutants used in this study. ok2773 is a 354bp deletion in ins-25. ju1776 is a 568bp deletion in ins-29. ju1580 is a 2.2kb deletion of both ins-25 and ins-29, and a similar deletion, ju1596, is made in ins-27(ok2474) genetic background, which is ~6kb 3’ to ins-25. B. Convulsion rate of acr-2(gf) combined with different combinations of deletions in genes for insulin-like peptides up-regulated in acr-2(gf) neurons is shown as convulsions/minute. None of these combinations had a statistically significant effect of convulsion rate. Box-and-whisker plots are shown with the middle bar representing the median (One-way ANOVA followed by Dunnett’s test. N≥18). C. Convulsion rates for indicated genotypes are shown. Deletion of flp-12 in combination with either flp-24(0) or deletion of both ins-29 and ins-25 causes a statistically significant reduction in convulsion rate. Box-and-whisker plots are shown with the middle bar representing the median (*P<0.05, **P<0.01. One-way ANOVA followed by Dunnett’s test. N≥19). D. Over-expression of either flp-12 or ins-29 suppresses convulsion. Over-expression arrays of flp-12(juEx7964) or ins-29(juEx7966, juEx7967) were crossed into indicated mutant backgrounds and scored for convulsion. Box-and-whisker plots are shown with the middle bar representing the median (*P<0.05, **P<0.01, ***P<0.001. One-way ANOVA followed by Dunnett’s test. N≥19).We also sought to restore convulsion frequency in ins-29(0) ins-25(0); flp-12(0) acr-2(gf) compound mutants by over-expressing wild type ins-29 or flp-12 in ins-29(0) ins-25(0); flp-12(0) acr-2(gf) mutant animals. Interestingly, over-expression of either ins-29 or flp-12 alone in acr-2(gf) animals also partially suppressed convulsion frequency to a similar degree as the neuropeptide compound mutant background (Fig 5D). This observation implies that over-expression of either ins-29 or flp-12 can act in a dominant and interfering manner to suppress acr-2(gf) convulsion.We further asked whether these neuropeptide genes affected synaptic transmission in the locomotor circuit using pharmacological assays. Aldicarb is an acetylcholinesterase inhibitor which leads to buildup of acetylcholine at the synaptic cleft and eventual paralysis in wild type animals [38]. Mutants that increase or decrease cholinergic activity display increased or decreased sensitivity to aldicarb. acr-2(gf) animals are more sensitive to aldicarb, consistent with their hyperactivity as described by previous electrophysiology and pharmacology analysis [10]. ins-29(0) ins-25(0); flp-12(0) acr-2(gf) animals were similar to acr-2(gf) alone on aldicarb, indicating that overall neurotransmission was not strongly affected by these mutations (Fig 6A, S3 Table). ins-29(0) ins-25(0); flp-12(0) mutants were also not significantly different from wild type animals on aldicarb (S4 Table). Levamisole is an agonist for the post-synaptic cholinergic receptors on muscle [39,40]. Resistance or sensitivity to levamisole can represent changes in muscle responsiveness. In these experiments, we found that ins-29(0) ins-25(0); flp-12(0) acr-2(gf) animals were less sensitive to levamisole than acr-2(gf) alone (Fig 6B, S5 Table). However, ins-29(0) ins-25(0); flp-12(0) triple mutants showed similar levamisole sensitivity to wild type (S6 Table). This result suggests that these neuropeptides may function post-synaptically to affect motor circuit function, and their function is only observed in the acr-2(gf) background, consistent with these peptides being differentially expressed in response to acr-2(gf) hyperactivity.
Fig 6
ILPs regulate post-synaptic muscle excitability.
A. Aldicarb sensitivity shown as percentage of animals not paralyzed after 1hour on the drug. No significant difference was observed (Two-way ANOVA followed by Dunnett’s test, compared to acr-2(gf) alone.). Each data point represents one trial and 10 animals per genotype were scored per trial. Data is also shown in S3 Table. B. Levamisole sensitivity of neuropeptide mutants in the acr-2(gf) background at 15min. Deletion of insulin-like peptides with flp-12(0) significantly reduces levamisole sensitivity compared to acr-2(gf) at this timepoint. Each data point represents one trial and 10 animals per genotype were scored per trial (*P<0.05, Two-way ANOVA followed by Dunnett’s test compared to acr-2(gf) single mutant.). Data is also shown in S5 Table. C. Effect of ins-29 over-expression on levamisole sensitivity. Shown are a subset of mutant strains analyzed in Fig 6B also carrying the ins-29 over-expression transgene (juEx7966). Over-expression of ins-29 can restore acr-2(gf) levels of levamisole sensitivity to that of ins-29(0) ins-25(0); acr-2(gf) strains, but also inhibits levamisole sensitivity in wild-type circuits. Each data point represents one trial and 10 animals per genotype were scored per trial (***P<0.001, *P<0.05. Two-way ANOVA followed by Bonferroni test.). Data is also shown in S7 Table.
ILPs regulate post-synaptic muscle excitability.
A. Aldicarb sensitivity shown as percentage of animals not paralyzed after 1hour on the drug. No significant difference was observed (Two-way ANOVA followed by Dunnett’s test, compared to acr-2(gf) alone.). Each data point represents one trial and 10 animals per genotype were scored per trial. Data is also shown in S3 Table. B. Levamisole sensitivity of neuropeptide mutants in the acr-2(gf) background at 15min. Deletion of insulin-like peptides with flp-12(0) significantly reduces levamisole sensitivity compared to acr-2(gf) at this timepoint. Each data point represents one trial and 10 animals per genotype were scored per trial (*P<0.05, Two-way ANOVA followed by Dunnett’s test compared to acr-2(gf) single mutant.). Data is also shown in S5 Table. C. Effect of ins-29 over-expression on levamisole sensitivity. Shown are a subset of mutant strains analyzed in Fig 6B also carrying the ins-29 over-expression transgene (juEx7966). Over-expression of ins-29 can restore acr-2(gf) levels of levamisole sensitivity to that of ins-29(0) ins-25(0); acr-2(gf) strains, but also inhibits levamisole sensitivity in wild-type circuits. Each data point represents one trial and 10 animals per genotype were scored per trial (***P<0.001, *P<0.05. Two-way ANOVA followed by Bonferroni test.). Data is also shown in S7 Table.We also asked if transgenic over-expression of ins-29 could rescue the levamisole phenotype of ins-29(0) ins-25(0); flp-12(0) acr-2(gf) animals. Animals expressing the Pins-29::ins-29::SL2::mKate2 transgene in wild-type or mutant backgrounds were assessed for levamisole sensitivity. We observed that over-expression of ins-29 in wild type exhibited a levamisole resistance phenotype, indicating that ins-29 can inhibit post-synaptic activity in the absence of acr-2(gf) when over-expressed (Fig 6C, S7 Table). On the other hand, and in contrast to the convulsion analyses, ins-29 over-expression did not affect the levamisolehypersensitivity of acr-2(gf) animals, and acr-2(gf) animals with or without the transgene had similar levamisole sensitivity profiles. ins-29 over-expression, however, significantly rescued the suppression of acr-2(gf) by ins-29(0) ins-25(0); flp-12(0) mutations. These results of ins-29 over-expression indicate that the function of these neuropeptides in motor circuit regulation may be context-dependent, with different activities depending on the genetic background and state of the circuit.
Discussion
Using neuronal-type specific RNA-seq, we identified over 200 genes whose expression levels are altered in response to hyperactivity in the motor circuit of C. elegans. Genes encoding neuropeptides were over-represented in this list, and we validated that fluorescent reporters for ins-29, flp-12, and nlp-1 were over- and/or ectopically-expressed in acr-2(gf) animals compared to wild type. These data support the conclusion that the major transcriptional response to motor circuit hyperactivity in C. elegans is by altering neuropeptide gene expression. Bioinformatic analyses of upstream sequences did not identify common motifs in the promoter regions of theses neuropeptides, suggesting that multiple transcriptional pathways may be involved in these changes. Indeed, the fluorescent reporters analyzed here showed diverse expression patterns as well as varied changes in expression, from over-expression in the same cells as wild type, to ectopic expression patterns.ILPs were the most up-regulated genes identified by RNA-seq in acr-2(gf). We have previously shown that loss of function mutations in unc-31/CAPS, which is required for the release of the majority of neuropeptides, reduce convulsion rate of acr-2(gf) mutants, indicating that the release of unidentified neuropeptides modulates motor circuit hyperactivity [16,17]. Here, we show that loss of the ILP genes ins-29 and ins-25, along with flp-12, can reduce convulsion of acr-2(gf) animals. This effect is modulatory, as mutation of these neuropeptides partially suppresses, but does not block, convulsion. The effects of these peptides are in contrast to our previous studies on a different neuropeptide flp-18, which is also up-regulated in cholinergic motoneurons of acr-2(gf) (this study), yet loss of flp-18 function, together with loss of flp-1, increased convulsion of acr-2(gf) animals [16]. These data are consistent with many studies showing that neuropeptide modulation involves combinatorial and redundant action of different peptides that can have varied effects on epileptic states [5]. Paradoxically, we further find that overexpression of wild type ins-29 or flp-12 in acr-2(gf) reduced convulsion. We speculate that the observed effects from overexpressing each peptide reflect promiscuity of receptors for the neuropeptides. Indeed, the variety of effects observed by ins-29 over-expression would be consistent with it affecting multiple pathways. Future studies will involve defining specific receptors for each peptide to clarify their function.The expression and function of ins-29 has not been previously characterized. Examination of ins-29 transcriptional reporters showed expression in the gas-sensing BAG neurons, with increased intensity and more penetrant expression in both BAG neurons detected in acr-2(gf) compared to wild type. Furthermore, co-labeling also showed up-regulation of acr-2 itself in these neurons. We show that the regulation of ins-29 expression in BAG neurons is activity-dependent. For example, genetic suppression of acr-2(gf) by null mutation of gtl-2 restored Pins-29::gfp expression to wild type patterns. BAG neurons are necessary for C. elegans to respond to changes in environmental CO2 [33]. The observation that ins-29 is expressed in the BAG sensory neurons, rather than motoneurons or pre-motor interneurons, was surprising. For example, whereas flp-18 is expressed from the cholinergic motoneurons to affect acr-2(gf) activity and motor function, ins-29 expression is increased in sensory neurons in the head and INS-29 is secreted. Together, these results indicate that genes involved in cholinergic neurotransmission including the acr-2 cholinergic receptor subunit gene, as well as the insulin-like peptide gene ins-29 are up-regulated in BAG neurons due to motor circuit hyperactivity in the acr-2(gf) background. Neuropeptide signaling from BAG has been shown previously to interact with another cholinergic circuit, the egg-laying circuit [41]. flp-17 and flp-10 secreted from BAG act in parallel with cholinergic signaling to inhibit egg-laying. It is proposed that signaling from BAG integrates favorable environmental signals with the egg-laying circuit.The BAG-specific transcription factor ets-5 also regulates Pins-29::gfp expression. Analysis of the ins-29 promoter did not reveal a clear ets-5 biding site, and it is possible this effect in indirect. ets-5-dependent pathways, therefore, are necessary for the increased expression of Pins-29::gfp in response to acr-2(gf). This result also indicates a function for ets-5 beyond development and maintenance of BAG neuron identity, but in modifying transcription in the BAG neurons under different physiological conditions in mature animals.In humans, seizure is a common co-morbidity of diabetes. In vitro analysis has also found, for example, that IGF signaling can be neuroprotective in response to injury, but can also promote epileptogenesis [42]. Insulin peptide signaling may also play a role in Alzheimer’s Disease (AD) [6]. Although the role for insulin signaling in the brain is still unclear, levels of insulin and insulin receptors are markedly decreased in the brains of ADpatients. Our data show that in C. elegans, ILP signaling is altered by aberrant cholinergic activity to modulate circuit function.
Materials & methods
C. elegans genetics
C. elegans strains were maintained at 20–22°C. For RNA-seq experiments, CZ631(juIs14[Pacr-2::gfp]) and CZ5808 (juIs14[Pacr-2::gfp]; acr-2(n2420gf)) were used. S1 Table contains a list of all strains. All genetic null alleles are designated by (0) in the text.CRISPR mutagenesis was performed as described previously, via co-CRISPR with dpy-10 marker [43]. Two sgRNAs were designed to bind outside the ins-29 and ins-25 region [ins-29
TTGGCGCCCAGCGCCGTTGT GGG, ins-25
CAGATCTTCGATTGGGACGG CGG]. To make the ins-29(ju1776) single deletion, the 5’ ins-29 sgRNA was injected, and CRISPR editing resulted in a 568bp deletion spanning the entire first exon of ins-29. Both sgRNAs were injected into wild-type or ins-27(ok2474) animals, and a ~2.2kb mutation that deleted both ins-29 and ins-25 was obtained, resulting in an ins-29(0) ins-25(0) double mutant (ju1580) or ins-29(0) ins-25(0) ins-27(0) triple mutant (ju1596 ok2474), respectively. These compound mutations were outcrossed, and then introduced into acr-2(gf). Most crosses (except those described below) were done using standard methods. See S8 Table for genotyping primers.Construction of double mutant strains with flp-12(ok2309) or ets-5(tm866) with acr-2(gf) was made using the MT6448 lon-2(e678) acr-2(gf) strain. flp-12 (X:-7.20) and ets-5 (X:-6.20) are to the left of acr-2 (X:-2.56) on the X chromosome. We generated heterozygotes of the genotype: lon-2(e678) acr-2(gf) X/[flp-12(ok2309) or ets-5(tm866)] X. Non-long, convulsing progeny were isolated from the next generation and genotyped for the gene of interest.
Sample preparation for RNA-seq
Samples were prepared for dissociation and FACS essentially as described [19,44]. Animals were synchronized by hypochlorite treatment. Eggs were isolated from wild type N2, CZ631, and CZ5808 gravid adults and allowed to hatch overnight and arrest at the L1-stage. Synchronized L1s were plated onto 15cm NGM plates seeded with OP50 bacteria. Approximately 8–10,000 L1s were plated to 15–20 plates for each strain. As N2 cells are only needed to control for the FACS sort, only 5 plates were prepared. These plates were incubated at 20°C for 72hr to reach adulthood prior to collection.The entire process of cell preparation and sort was completed in a single day. Animals were washed off plates and spun down and then washed in M9 media to remove bacteria. Typically, pellets for each strain would be ~500μl in volume, and these would be split into two tubes. 750μl of lysis buffer (200μM DTT, 0.25% SDS, 20mM HEPES pH8.0, 3% sucrose) was added to each tube and samples were incubated for approximately 6–7 minutes. Worms were then rapidly washed in M9 five times. Next, 500μl of 20mg/ml freshly made pronase solution was added. Samples were incubated in pronase approximately 20 minutes. Every 2–3 minutes, each sample was disrupted by pipetting with a P200, and samples were monitored for dissociation with a dissection microscope. When large worm chunks were no longer visible under the dissection microscope, the reaction was stopped by adding 250μl ice cold PBS-FBS solution (1X PBS solution with 2% Fetal Bovine Serum). Samples were then centrifuged in the cold at top speed in a microcentrifuge for 10 minutes, and pelleted cells were resuspended in 500μl FBS. Cells were then syringe-filtered (5μm pore). Samples were spun again in the cold and resuspended in ½ the starting volume of FBS. 80,000–100,000 GFP+ cells were collected for each sample at the UCSD Flow Cytometric Core in Moore’s Cancer Center. Cells were sorted directly into Trizol LS and stored at -80°C until preparation. RNA was isolated using Qiagen RNAeasy kit.
RNA-seq analyses
RNA library preparation and sequencing were performed at the Institute for Genomic Medicine at UCSD. RNA libraries were prepared with Illumina TruSeq kit. Libraries were sequenced on an Illumina HiSeq4000. Data analyses were performed using the Galaxy platform [27]. We obtained 50–70 million single-end reads/sample. Reads for each sample were mapped and aligned using TopHat [45]. Identification of expressed genes in wild type was determined using Cufflinks. “Expressed” genes were selected by filtering for genes with an FPKM >10 in both replicates. This analysis produced 1,812 transcripts (S2 Table). Using the BioVENN site, our list of “expressed genes” from wild type neurons was compared with those identified as enriched in adult epidermis and muscle and expressed in neurons by RNA-seq, as well as larval A-type motoneurons by microarray [22,23,46]. For differential expression analyses between wild type and acr-2(gf) neurons, BAM files were loaded into the HTSEQ program and then analyzed by DESeq2 for differential expression analyses (S2 Table) [26,47]. GO-term enrichment analysis was performed using the GOrilla algorithm for enrichment of Biological Process terms[28]. Data analyses were performed in Microsoft Excel, R, and Graphpad Prism. Sequencing datasets have been deposited in the Gene Expression Omnibus (Accession GSE139212).
Convulsion and pharmacological analyses
All behavior observations reported here were made on mutations that were outcrossed with N2 for at least 4 times. Convulsions were defined as simultaneous contraction of the body wall muscles producing a rapid, concerted shortening in body length. The convulsion frequency for day-1 adult animals was calculated during a 90-second period of observation. For levamisole sensitivity, ten day-1 adult animals were transferred to fresh plates containing 1 mM levamisole. Animals were scored for paralysis ever 15 minutes for 1 hour. Sensitivity to 500 μM or 1mM aldicarb was assessed by transferring ten day-1 adults to fresh aldicarb plates and by monitoring worms for paralysis every 30 minutes by gently touching the animal with a platinum wire. Drug sensitivity was quantified from at least three independent experiments.
Imaging and microscopy
Images of fluorescent reporter lines were taken on a Zeiss LSM 700 or 800 confocal microscope. Animals were mounted in thick agarose (10%) and rolled with the ventral side up for consistent imaging. Hyperstacks were processed in ImageJ. (For images in Fig 4, Pgcy-33::gfp strains, gains were set at 500V for mKate2 and 500V for GFP. For images in Fig 3, of juIs14 strains, gains were set at 550V for mKate2 and 600V for GFP.). All images are taken using the 63X objective. Scoring of Pins-29::gfp expression in Fig 4 was performed using a Zeiss Axioplan 2 compound microscope at the 63X objective unless otherwise indicated. A neuron was scored as “expressed” if GFP signal was clearly visible in the cell body and dendrites through the eyepiece (with expression in acr-2(gf) as a baseline comparison). Images of INS-29::mKate2 in coelomocytes was were captured using a Zeiss AxioImager compound microscope with the 100X objective.
Molecular biology and C. elegans transformation
Transcriptional gfp reporters (pCZ1002, pCZ1003) were made using Gibson assembly into pPD95.75. Vector was cut using restriction enzymes and PCR-amplified promoters were inserted. Approximately 2kb upstream of each neuropeptide gene was used as putative promoter sequence. Primers used for Pins-29 were (gene-specific sequence in uppercase): Forward 5’tgcatgcctgcaggtcgactCTTTAAAATGGTTAATTTTGTAGTTAG3’/Reverse 5’tggccaatcccggggatcctTTTTTTATTTCACAATATAATATACTTTATAC3’. Primers used for Pnlp-1 were: Forward 5’tgcatgcctgcaggtcgactTTGTTTTATCCAACATTATTCAC3’/Reverse 5’tggccaatcccggggatcctCGTTGCCTCAAGTTGATG3’. To generate mKate2 reporters for neuropeptide expression constructs (pCZ1004, pCZ1005), GFP sequence in pPD95.75 was replaced with SL2-mKate2 sequence. Genomic sequences for flp-12 or ins-29 was then amplified from genomic DNA and inserted into the modified pPD95.75 vector using Gibson Assembly. Primers for ins-29: Forward 5’aagcttgcatgcctgcaggtCTTTAAAATGGTTAATTTTGTAGTTAG3’/Reverse 5’tgaaagtaggatgagacagcTCAAGCAAGATTTGAAGG3’. Primers for flp-12 were: Forward 5’tgcatgcctgcaggtACAACAAAAGTATTTTTGACG3’/ Reverse 5’agtaggatgagacagcCTACTTTCGTCCAAATCG3’. These sequences include the entire coding sequence plus 2kb upstream promoter. To generate the mKate2-tagged ins-29 construct (pCZ1006), the SL2 sequence was deleted from the Pins-29::ins-29::SL2::mKate2 construct using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the Pgcy-33::acr-2(gf)::gfp transgene (pCZ1007), the unc-129 promoter from pCZGY1262 generated by Qi et al. [37] was replaced with the published gcy-33 promoter [48] by restriction enzyme digest and ligation. Pgcy-33 was amplified from genomic DNA using mutagenic primers inserting 5’ and 3’ restriction enzyme sites HindIII and Pst1, respectively, and used to replace in the Punc-129 promoter. A list of plasmids used in this study can be found in S1 Table.cDNAs were generated using the SuperScript RT kit from Invitrogen. 2μg input RNA (from synchronized young adult acr-2(gf) populations) was used for each RT reaction. RNA was extracted and isolated using Trizol reagent and chloroform extraction. 1μl of RT (~100ng) was used in each PCR reaction. Nested reactions were used for amplifying both ins-29 and ins-25 cDNAs. For ins-29, the first reaction used either SL1 or SL2 forward primer with a gene specific reverse primer: 5’ gcaagatttgaaggacagcac 3’. In the second reaction 2μl of the first PCR was used with Primers: Forward 5’TTCTGTAAATTTGTATTCCTGATC, Reverse 5’ GATTTGAAGGACAGCACAAT 3’. For ins-25, the first reaction used either SL1 or SL2 forward primers with a gene specific reverse primer: 5’ caaatttgggcaacacatattc 3’. In the second reaction, 2μl of the first PCR reaction was used with Primers: Forward 5’ ATGTTGTTCAAAATCATCATT 3’, Reverse 5’ GGGCAACACATATTCTTCAG 3’. Product using the SL2 primer was only detected for ins-25 transcript and verified by Sanger sequencing.C. elegans transgenic multi-copy arrays were generated using standard protocols [See S1 Table for list of transgenic strains made in this study] [49]. Reporter DNA was typically injected at 25ng/μl concentration. The flp-12 over-expression plasmid was injected at 5ng/μl, as injection at 25ng/μl failed to yield transgenics.
INS-29 is secreted in wild type and acr-2(gf) animals.
A-F. Shown is expression of directly tagged INS-29 (Pins-29::ins-29::mKate2, juEx8066) in a posterior coelomocyte of D1 adults. (A-C) Shown are fluorescent, differential interference contrast (DIC) and overlay, respectively, of a posterior coelomocyte in wild type carrying the juEx8066 transgene (D-F) Shown are fluorescent, DIC, and overlay images of a posterior coelomocyte in acr-2(gf). Arrows in all images indicate the larger vacuoles in this cell which contain INS-29::mKate2. Scale bar = 10μm.(PDF)Click here for additional data file.
Strains and plasmids used in this study.
(DOCX)Click here for additional data file.
Transcriptome analyses of wild type and acr-2(gf) neurons.
(XLSX)Click here for additional data file.
Aldicarb timecourse for neuropeptide mutants with acr-2(gf).
(DOCX)Click here for additional data file.
Aldicarb timecourse for neuropeptide mutants.
(DOCX)Click here for additional data file.
Levamisole timecourse for neuropeptide mutants with acr-2(gf).
(DOCX)Click here for additional data file.
Levamisole timecourse for neuropeptide mutants.
(DOCX)Click here for additional data file.
Levamisole timecourse for ins-29 over-expression.
(DOCX)Click here for additional data file.
Genotyping primers.
(DOCX)Click here for additional data file.
Transfer Alert
This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.6 Jan 2020PONE-D-19-30924Neuronal transcriptome analyses reveal novel neuropeptide modulators of excitation and inhibition imbalance in C. elegansPLOS ONEDear Dr. Jin,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.As you can see, while both reviewers appreciate the interest of the work, they have serious concerns about the absence of key supportive experiments and, arising from this, the interpretations presented. Essential data requested include details of the expression of manipulated genes (e.g. ins-29) and mutants/knockdown in specific cell types (e.g. BAG neurons). Additional substantive mechanistic evidence is essential given the highly unusual scenario proposed whereby increased activity of Acr-2 induces enhanced expression of the acr-2 locus.We would appreciate receiving your revised manuscript by Feb 20 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Brian D. McCabe, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: I Don't KnowReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: In this paper, the authors asked whether upregulation of cholinergic activity would induce homeostatic responses in the cholinergic neurons, counteracting the increased activity. To this end, they used a gain-of-function mutation in a neuronal acetylcholine receptor in C. elegans, acr-2(gf), which induces convulsions in the animal. The authors assessed which genes are upregulated, by RNAseq. They found that several neuropeptide genes were upregulated, and studied the expression pattern and the functional effects of the most upregulated peptides in modulating / counteracting function of acr-2(gf). ins-25, ins-29, flp-12 and nlp-1 were the most upregulated neuropeptide genes. INS-29 is expressed, unexpectedly, in a gas sensory neuron, BAG. The authors then analyzed whether loss of function of these peptides would lead to a change in the convulsions induced by acr-2(gf). They find that single mutations of the candidate neuropeptide genes did not have any effects, but triple-deletion of ins-29, ins-25 and flp-12 reduced the convulsions. This is surprising, as if anything, one would have expected that the overexpressed peptides are inhibitory, and that in their absence, there should be more convulsions. Actually, when the authors overexpressed flp-12 and ins-29, this reduced the convulsions.The work presented in the paper is technically sound and the questions is of interest. The findings are interesting and I do not doubt the work per se, however, the current state does not allow a conclusive understanding of what is going on. The logic of the findings is not making sense, as the induced hyperactivity of the cholinergic system would be expected to induce upregulation of systems that can counterbalance this hyperactivity, i.e. classical homeostatic responses to allow maintaining somewhat normal functionality of the nervous system. However, knock out of the upregulated neuropeptide genes caused a reduction of the convulsions rather than further increase. The authors should comment on this paradox in the discussion, particularly as overexpression also caused reduction of convulsion (which is more in line with expectations).Altering the function of neuropeptide signaling often results in surprising findings that are not easily reconciled. At stage, the work is premature and asks for more experiments to understand the precise nature of the phenotypes. Possibly, the imbalance in the motor nervous system is more complex due to the effects on GABAergic signaling, which is usually co-stimulated when cholinergic neurons are active. Also, have the authors considered that genes downregulated may have an important role here, e.g. because they are normally promoting (cholinergic) nervous system function?Specific points:The authors say that they analyzed the expressome of adult cholinergic neurons. This is imprecise, because they used the acr-2 promoter-driven GFP to isolate cells for RNAseq. However, while acr-2 is expressed in many cholinergic motor neurons, it is also expressed in numerous unidentified cells, which are not necessarily cholinergic. For example, BAG, in which the INS-29 neuropeptide is overexpressed (as well as ACR-2), is a glutamatergic neuron (Pereira et al., 2015, eLife). Thus, the wording should be adjusted.The authors show that acr-2 is expressed in BAG neurons, and that acr-2 expression itself is upregulated in BAG in the acr-2(gf) background. This overexpression is surprising – why would the intrinsic acr-2 locus respond to hyperactivity of its own product by upregulation? One would rather expect a downregulation. In this context: Does ACR-2 activity in BAG lead to increased INS-29 release due to depolarization of BAG? Upregulation of a peptide generally counteracting cholinergic hyperactivity, but in a neuron outside the cholinergic system, implies that some signal from these motor neurons is released in response to their hyperactivity, which is sensed in BAG and leads to upregulation of INS-29. This would then lead to increased release of INS-29 peptides. However, if ACR-2 itself is expressed in BAG neurons, increased INS-29 release may not be in response to acr-2(gf) in the cholinergic system but simply because acr-2 is more active in BAG and the cell is more depolarized. To test this the authors could knock down acr-2(gf) in BAG neurons, cell-specifically, and test if these animals still show compensatory activity of ins-29.In Fig 5C, most animals of ins-29ins-25(0); flp-12(0); acr-2(gf) were paralyzed. However, they were almost non-paralyzed in Table S3 (60 min time point).Minor points:1) In Fig. 4B, there is expression of gcy-33 in the dorsal cord. This is surprising as gcy-33 expression was previously described only in BAG, URX, AQR and PQR – do the authors know which cells these are?2) In Fig 5A, flp-24(0); nlp-12(0) and ins-29ins-25(0); flp-12(0) partially blocked acr-2(gf). Did they affect cholinergic function also in a normal nervous system (i.e., without acr-2(gf)?3) In Fig 5D, can the phenotype of ins-29ins-25(0); flp-12(0); acr-2(gf) be rescued by flp-12 or ins-29 overexpression?Reviewer #2: In this aper, the authors describe their transcriptomic analysis of the BAG neurons and up-regulation of one of the insulin-like genes ins-29 in the acr-2(gf) background. This finding seams interesting.However, the authors did not examine how the ins-29 up-regulation is relevant to the phenotype of acr-2(gf).a The authors bad better show the following points.1. Where (in which neurons) is the ins-29 originally expressed?The transgene ins-29p::gfp (or other reporters) can address this question.2. Is the up-regulation of ins-29 expression responsible for the phenotype of acr-2(gf)?The gene disruption of ins-29 (using the tm1922 mutant) in acr-2(gf) can easily address this question.In addition, in the double mutant above, a rescue experiment of ins-29 in a BAG neurons-specific mannercan enforce the responsibility of ins-29.3. Is the ins-29 translated and secreted after over transcription in BAG neurons under the acr-2(gf) background?The transgene acr-2p::ins-29::mcherry can address this question.Otherwise, the authors should explain how the over transcription of ins-29 itself induce the phenotype of theacr-2(gf) mutant.After the address of authors to my comments, I would like to accept their paper.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.30 Mar 2020please see the file 'response to reviewers'Submitted filename: Response to reviewers.docxClick here for additional data file.18 May 2020Neuronal transcriptome analyses reveal novel neuropeptide modulators of excitation and inhibition imbalance in C. elegansPONE-D-19-30924R1Dear Dr. Jin,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Brian D. McCabe, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: Partly**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: No**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: No**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: all fine, thank you for addressing my comments, the authors made a good job and the paper may now be accepted**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: No22 May 2020PONE-D-19-30924R1Neuronal transcriptome analyses reveal novel neuropeptide modulators of excitation and inhibition imbalance in C. elegansDear Dr. Jin:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Brian D. McCabeAcademic EditorPLOS ONE
Authors: Maelle Jospin; Yingchuan B Qi; Tamara M Stawicki; Thomas Boulin; Kim R Schuske; H Robert Horvitz; Jean-Louis Bessereau; Erik M Jorgensen; Yishi Jin Journal: PLoS Biol Date: 2009-12-22 Impact factor: 8.029
Authors: Esther Serrano-Saiz; Richard J Poole; Terry Felton; Feifan Zhang; Estanisla Daniel De La Cruz; Oliver Hobert Journal: Cell Date: 2013-10-24 Impact factor: 41.582
Authors: Yingchuan B Qi; Michelle D Po; Patrick Mac; Taizo Kawano; Erik M Jorgensen; Mei Zhen; Yishi Jin Journal: J Neurosci Date: 2013-03-20 Impact factor: 6.167
Authors: Devyn Oliver; Shankar Ramachandran; Alison Philbrook; Christopher M Lambert; Ken C Q Nguyen; David H Hall; Michael M Francis Journal: PLoS Genet Date: 2022-01-28 Impact factor: 5.917