NCTD elicits proapoptotic and antiglycolytic effects on colorectal cancer cells via modulation of Fam46c expression and inhibition of ERK1/2 signaling.

Colorectal cancer is a digestive tract malignancy and the third leading cause of cancer‑related mortality worldwide. Norcantharidin (NCTD), the demethylated form of cantharidin, has been reported to possess anticancer properties. Family‑with‑sequence‑similarity‑46c (Fam46c), a non‑canonical poly(A) polymerase, has been reported to be critical in NCTD‑mediated effects in numerous types of cancer, including hepatoma. In the current study, it was found that Fam46c expression was reduced in colorectal cancer tissues and cells. Treatment with NCTD was observed to significantly enhance apoptosis and inhibit glycolysis in colorectal cancer cells. In addition, Fam46c and cleaved caspase 3 expression levels were found to be increased in response to NCTD treatment, in contrast to tumor‑specific pyruvate kinase M2 and phosphorylated ERK expression, which was reduced. Importantly, overexpression of Fam46c exerted similar effects as NCTD treatment on the apoptosis and glycolysis of colorectal cancer cells, whereas Fam46c knockdown strongly attenuated the effect of NCTD. Moreover, epidermal growth factor, which acts as an agonist of ERK1/2 signaling, weakened the effects of NCTD on colorectal cancer cells. Taken together, the results indicated that NCTD promotes apoptosis and suppresses glycolysis in colorectal cancer cells by possibly targeting Fam46c and inhibiting ERK1/2 signaling, hence suggesting that Fam46c may act as a tumor suppressor in colorectal cancer. Thus, the present study identified a novel therapeutic target of NCTD in the clinical treatment of colorectal cancer.

Introduction

Colorectal cancer was the third leading cause of cancer-related deaths worldwide in 2016 (1,2). Its pathogenesis is closely related to various factors, including lifestyle, heredity and colorectal adenoma (3,4). Colorectal cancer often arises at the age of 40–50 years, with the ratio of men to women being 1.65:1 (1). According to previous studies, the incidence of colorectal cancer has been steadily increasing in China over the years, especially in underdeveloped areas (5–7). Currently, the main treatment for colorectal cancer is surgery, accompanied with chemotherapy, immunotherapy and traditional Chinese medicine (8–10). However, due to high rates of recurrence and metastasis, colorectal cancer remains a burden for patients (1,2). Studies have revealed that cancer cells, including colorectal cancer cells, take up high amounts of glucose and rely on glycolysis for ATP generation (11,12). Efficient conversion of glucose into macromolecules is necessary for a number of cellular processes, including cell growth and glycolysis (13). Indeed, cancer cells require high glucose consumption and lactate production to sustain their proliferation (11,12,14,15).

Norcantharidin (NCTD) is the demethylated form of cantharidin, an active ingredient of a traditional medicine, blister beetle, which possesses antitumor properties (16). It is reported that NCTD is easier to synthesize and less toxic than cantharidin, and displays anticancer activity (17–20). NCTD has been found to be involved in suppressing proliferation and inducing apoptosis in a variety of cancer types, including colorectal cancer, hepatoma and breast cancer (21–24). Moreover, NCTD has been found to suppress cancer cell invasion by reducing expression of matrix metalloproteinase-2 and −9 and adhesion molecules, such as E-cadherin and integrin in CT26 colon cancer cells (25,26). NCTD is also capable of inhibiting epithelial-mesenchymal transition (EMT) in colon cancer cells (27), which contributes to the complex pathogenesis of tumors and fibrosis (28,29). Additionally, studies have revealed that members of the mitogen-activated protein kinase (MAPK) family, including p38MAPK, extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), are involved in NCTD-induced cell apoptosis in glioma, colon and breast cancers (18,20,23).

Family-with-sequence-similarity-46c (Fam46c) is a non-canonical poly(A) polymerase that belongs to the Fam46 superfamily of nucleotidyltransferases, along with three other types of Fam46 proteins (Fam46a, b and d). Studies have identified that short progression-free survival and decreased overall survival of multiple myeloma cases are associated with deletions of Fam46c, and Fam46c loss may promote cell survival in myeloma (30–32). Therefore, Fam46c potentially acts as a tumor suppressor in multiple myeloma (33). Fam46c is also closely related to the anticancer effects of NCTD in hepatoma and knockdown of Fam46c may partially attenuate the antimetastatic effects of NCTD on hepatoma (34,35). However, whether Fam46c is involved in the apoptotic and glycolytic effects of NCTD in colorectal cancer remains largely unknown.

Herein, it was found that Fam46c expression was notably reduced in colorectal cancer tissues and cells. NCTD treatment significantly induced cell apoptosis and glycolysis, which was accompanied with changes in related-genes, and was potently counteracted by Fam46c downregulation. Overall, this suggested the potential role of Fam46c as a tumor suppressor in colorectal cancer.

Materials and methods

Patient samples

After obtaining written informed consent from patients with colorectal cancer who were treated at the Shanghai Traditional Chinese Medicine-Integrated Hospital, five paired tumor and paracancer tissues were collected from five patients (age, 18–75 years; sex, 2 females and 3 males) between March 2018 and June 2018, and immediately frozen in liquid nitrogen at −196°C. The inclusion criteria was as follows: 1) Patients must comply with the diagnostic criteria in the ‘Guidelines for the Diagnosis and Treatment of Colorectal Malignancies’ prepared by the Medical Department of the People's Republic of China, and must be clearly diagnosed as a colorectal malignant tumor and 2) the patient must not have received medication 7 days prior to the specimen being obtained. The exclusion criteria included that the specimen could not be contaminated or destroyed. Immunochemistry detection was performed to analyze the expression of Fam46c in these tissues. The experiments in the present study were approved by the Ethics Committee of Shanghai Traditional Chinese Medicine-Integrated Hospital.

Cell culture

Four human colorectal cancer cell lines (CACO2, HT29, LOVO and SW620) and one human normal colorectal mucosa cell line (FHC) were purchased from the Type Culture Collection of the Chinese Academy of Sciences. Cells were cultured in a 5% CO2 humidified-incubator (Thermo Forma 3111, Thermo Fisher Scientific, Inc.) at 37°C with RPMI-1640 medium (cat. no. SH30809.01B; HyClone; GE Healthcare Life Sciences) containing 10% fetal bovine serum (FBS; cat. no. 16000-044, Gibco; Thermo Fisher Scientific, Inc.) and 1% antibodies (penicillin and streptomycin; cat. no. P1400-100; Beijing Solarbio Science & Technology Co., Ltd.) until the beginning of the experiments.

Construction of the lentivirus

Short hairpin (sh)RNA sequences targeting three different sites of the Fam46c gene (NM_017709.3) were synthesized (Table I), and three shRNA constructs were formed by double-strand annealing. In addition, the coding DNA sequence (CDS) region of Fam46c with a length of 1,176 bp was also synthesized (Genewiz, Inc.). Subsequently, 1 µg/µl shRNA constructs and the CDS region were respectively inserted into the AgelI/EcolI restriction sites of the pLKO.1-puro vector (Addgene, Inc.) and the EcoRI/BamHI sites of the pLVX-Puro vector (Addgene, Inc.). Following DNA sequencing (Shanghai Meiji Biomedical Technology Co., Ltd.), 1,000 ng pLKO.1-shFam46c or 1,000 ng pLVX-Puro-Fam46c was co-transfected into 293T cells (American Type Culture Collection) with viral packaging plasmids psPAX2 (100 ng) and pMD2G (900 ng) (Addgene, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), and then the cells were cultured in DMEM (HyClone; GE Healthcare Life Sciences), supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), and maintained in a humidified atmosphere of 37°C and 5% CO2. Virus particles were collected by ultracentrifugation (4°C; 72,000 × g; 2 h) 48 h after transfection.

Table I.

Fam46c-targeting short hairpin RNA sequences.

Name	Sequence (5′→3′)
Fam46c target site 1 (222–240)	CCAGGGATTGCATGTCCTT
Fam46c target site 2 (308–326)	GGACGAGGCAACTTTCCAA
Fam46c target site 3 (1296–1314)	GCAACTTCAGCAACTACTA
Negative control	CAGUACUUUUGUGUAGUACAA

Fam46c, Family-with-sequence-similarity-46c.

Experimental grouping

A total of 5×104 HT29, LOVO or SW620 cells were infected with Fam46c overexpression (Fam46c)/vector or Fam46c interference (shFam46c)/negative control (shNC) lentiviruses (MOI=10), while RPMI-1640 medium-treated cells were used as controls. Efficiency of Fam46c overexpression or knockdown was verified via reverse transcription-quantitative PCR (RT-qPCR) and western blotting after 48 h of infection.

HT29 and LOVO cells were divided and treated as follows: Vehicle, 5 µg/ml NCTD (cat. no. 29745-04-8; Shanghai Aladdin Bio-Chem Technology Co., Ltd.), 10 µg/ml NCTD, Fam46c or control lentivirus, vehicle + shNC, vehicle + shFam46c, 10 µg/ml NCTD + shNC, and 10 µg/ml NCTD + shFam46c. Subsequently, cell apoptosis, glucose consumption and lactate production were examined, and protein-related levels were determined. Further, HT29 cells were treated with vehicle + vehicle, vehicle + 10 µg/ml NCTD, 10 µg/ml EGF (R&D Systems, Inc.; solvent, PBS) + vehicle, and 10 µg/ml EGF + 10 µg/ml NCTD. Next, glucose consumption, lactate production and protein-related levels were determined. The concentrations of NCTD (5 and 10 µg/ml) were determined based on previous studies (36–38).

RT-qPCR assay

After treatment, total RNA from colorectal cancer cells (HT29, LOVO and SW620) was extracted on the ice using TRIzol® reagent (cat. no. 15596-026; Invitrogen; Thermo Fisher Scientific, Inc.) and then quantified and confirmed for RNA integrity. Next, using a RevertAid First Strand cDNA Synthesis kit (cat. no. K1622; Fermentas; Thermo Fisher Scientific, Inc.), 1 µg of RNA was reverse transcribed into cDNA. qPCR was conducted on an ABI 7300 Real-Time PCR system (cat. no. ABI-7300; Applied Biosystems; Thermo Fisher Scientific, Inc.) using an SYBR® Green PCR kit (Thermo Fisher Scientific, Inc.). The following primer pairs were used: Fam46c, forward 5′-GTGCTCCAGGTTCTTCATC-3′, reverse 5′-GAGTCTGCCTGCGTTCAT-3′; GAPDH, forward 5′-AATCCCATCACCATCTTC-3′, reverse 5′-AGGCTGTTGTCATACTTC-3′. The following thermocycling conditions were used: 95°C, 10 min; (95°C, 15 sec; 60°C, 45 sec) ×40 (39). Fam46c mRNA levels were quantified using the 2−ΔΔCq method (40) and normalized to the internal reference gene GAPDH.

Western blotting

Following treatment, total protein from colorectal cancer cells (HT29, LOVO and SW620) was extracted using RIPA buffer containing protease and phosphatase inhibitor (cat. no. R0010; Beijing Solarbio Science & Technology Co., Ltd.), followed by quantification using a BCA kit (cat. no. 23223; Thermo Fisher Scientific, Inc.). Then, 25 µg of protein were separated on a 10% SDS-PAGE gel. The separated proteins were subsequently transferred onto a polyvinylidene fluoride membrane (cat. no. HATF00010; EMD Millipore). Membranes were blocked in 5% skimmed milk (BD Biosciences) for 1 h at room temperature and then incubated at 4°C overnight with the following primary antibodies purchased from Cell Signaling Technology, Inc.: Fam46c (1:500; cat. no. ab169699), PKM2 (1:500; cat. no. ab137852), cleaved caspase 3 (1:500; cat. no. ab2302; all from Abcam), ERK1/2 (1:1,000; cat. no. 9102), p-ERK1/2 (1:1,000; cat. no. 9101) and GAPDH (1:2,000; cat. no. 5174). Membranes were washed six times with TBST and then incubated with goat anti-rabbit (cat. no. A0208) and goat anti-mouse (cat. no. A0216) secondary antibodies labeled with horseradish peroxidase (1:1,000; Beyotime Institute of Biotechnology) for 2 h at room temperature. Following 5 min of development with Immobilon Western Chemiluminescent substrate (cat. no. WBKLS0100; EMD Millipore), the protein bands were visualized using an ECL imaging system (cat. no. Tanon-5200; Tanon Science and Technology Co., Ltd.). Protein levels were calculated and analyzed by ImageJ software (version 1.47v; National Institutes of Health) with GAPDH as the loading control.

Cell apoptosis assay

HT29, LOVO and SW620 cells were collected and stained using an Annexin V-FITC detection kit (cat. no. C1063; Beyotime Institute of Biotechnology) and propidium iodide (PI). Apoptotic cells were evaluated via flow cytometry. Briefly, 5×105−1×106 cells were resuspended in 195 µl of Annexin V-FITC binding buffer and then incubated at 4°C for 15 min in the dark with 5 µl of Annexin V-FITC, followed by incubation with 5 µl of PI at 4°C for 5 min. A tube without treatment of Annexin V-FITC and PI served as a control. Apoptotic cells were analyzed via flow cytometry using BD Accuri™ C6 software (version 1.0.264.21; BD Biosciences).

Detection of glucose consumption and lactate production

HT29, LOVO and SW620 cells were treated according to the experimental grouping, and then 100 µM of 2-NBDG (cat. no. K682-50; BioVision, Inc.) was added. Following 1 h of incubation at room temperature, the cells were washed twice with PBS, then trypsinized and resuspended in RPMI-1640 medium containing 10% FBS. Subsequently, the cells were stained with 5 µg/ml of PI for 5 min at 4°C in the dark. The proportion of PI-negative and 2-NBDG-positive cells was calculated by flow cytometry to determine glucose consumption. The production of lactate was evaluated using a lactic acid kit (Nanjing Jiancheng Bioengineering Institute Co., Ltd.) according to the instructions of the manufacturer. The optical density of lactate was measured at 530 nm using a spectrophotometer.

Immunohistochemical (IHC) detection

Colorectal cancer tissue were fixed with 10% formalin for 48 h at 4°C, embedded in paraffin, and then cut into 4-µm thick sections, and incubated at 65°C in an oven for 30 min. Slides were rehydrated for 15 min in xylene I and II at room temperature (Sinopharm Chemical Reagent Co., Ltd.) and then sequentially soaked for 5 min in 100, 95, 85 and 75% ethanol solutions, followed by rinsing with tap water for 10 min. After 15 min of antigen retrieval in 0.01 M sodium citrate buffer (pH 6.0), deparaffinized slides were incubated with 3% H2O2 (cat. no. 10011218; Sinopharm Chemical Reagent Co., Ltd.) in a wet-box for 10 min at room temperature and then incubated with a rabbit anti-Fam46c antibody (1:100; cat. no. ab222808; Abcam) for 1 h at room temperature. Subsequently, slides were incubated with a horseradish peroxidase-labeled secondary antibody (1:1,000; cat. no. D-3004; Shanghai Long Island Biotech Co., Ltd.) for 30 min at room temperature. Thereafter, tissue slides were subjected to DAB staining (cat. no. FL-6001; Shanghai Long Island Biotech Co., Ltd.) for 1 min at room temperature, 3 min of hematoxylin staining at room temperature (cat. no. 714094; Baso Diagnostics, Inc.) and alcohol differentiation with 1% hydrochloric acid, followed by rinsing with tap water for 10 min. Finally, tissue slides were imaged using an Eclipse Ni light microscope (magnification, ×200; Nikon Corporation). Expression of Fam46c in tissues was analyzed using an IMS image analysis system (version 4.50; VistarImage; Vishent).

Statistical analysis

Statistical analysis was conducted on GraphPad Prism software (version 7.0; GraphPad Software, Inc.). All graphs were presented as the mean ± SD based on 3 repeated experiments. The difference between two groups was analyzed by paired Student's t-test, while difference among multiple groups was determined by one-way ANOVA with Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Fam46c expression is downregulated in colorectal cancer tissues and cells

Following tumor and paracancer tissue collection from patients with colorectal cancer, Fam46c expression was detected by IHC. As shown in Fig. 1A, the expression of Fam46c was significantly reduced in colorectal cancer tissues compared with paracancer tissues. Likewise, in various colorectal cancer cell lines, Fam46c mRNA and protein expression levels were significantly lower compared with normal colorectal mucosa FHC cells. Compared with other cell lines, Fam46c displayed relatively low expression in HT29 and LOVO, and comparatively higher expression in SW620 (Fig. 1B). These data suggested that Fam46c may function as a tumor suppressor in colorectal cancer. Based on the expression pattern of Fam46c in these cells, HT29, LOVO and SW620 were used for follow-up experiments.

Figure 1.

Fam46c expression is significantly reduced in colorectal cancer tissues and cells. (A) Expression of Fam46c in paired tumor and paracancer tissues of patients with colorectal cancer was detected by immunohistochemistry. *P<0.05 vs. Paracancer. (B) Fam46c mRNA expression and protein levels were detected by reverse transcription-quantitative PCR and western blotting, respectively. ***P<0.001 vs. FHC. Fam46c, Family-with-sequence-similarity-46c.

Overexpression or knockdown of Fam46c in colorectal cancer cells by lentiviral infection

Colorectal cancer cells HT29 and LOVO were infected in vitro with Fam46c overexpression or control vector lentivirus, while SW620 cells were infected with shFam46c or control shNC lentivirus. Data in Fig. 2 demonstrated that both mRNA and protein expression of Fam46c in HT29 (Fig. 2A) and LOVO (Fig. 2B) cells were upregulated by the Fam46c lentivirus, whereas all three shFam46c lentiviruses caused downregulation of Fam46c protein expression in SW620 (Fig. 2C) cells, validating the efficacy of the lentiviruses used. Knockdown efficiency was higher for shFam46c-2 compared with shFam46c-1 and shFam46c-3; thus, shFam46c-2 was used for further study.

Figure 2.

Overexpression or knockdown of Fam46c in colorectal cancer cells by lentivirus infection. Colorectal cancer cells (HT29, LOVO and SW620) were infected with lentiviruses to overexpress Fam46c (Fam46c/vector) or knockdown Fam46c (shFam46c/shNC). Fam46c overexpression efficiency in (A) HT29 and (B) LOVO cells was determined by reverse transcription-quantitative PCR and western blotting. ***P<0.001 vs. vector. (C) Fam46c knockdown efficiency in SW620 cells was similarly determined. ***P<0.001 vs. shNC. Fam46c, Family-with-sequence-similarity-46c; sh, short hairpin RNA lentivirus; NC, negative control.

Treatment with NCTD induces apoptosis and inhibits glycolysis in colorectal cancer cells

As indicated by flow cytometry analysis, NCTD treatment (5 and 10 µg/ml) in HT29 and LOVO cells notably enhanced apoptosis (Fig. 3A). Moreover, NCTD treatment in these cells inhibited lactate production (Fig. 3B) and glucose consumption (Fig. 3C). Of note, Fam46c expression was found to increase in response to NCTD treatment (Fig. 3D). Furthermore, NCTD treatment resulted in elevated expression of cleaved caspase 3 protein, and downregulation of PKM2, as well as the ratio of p-ERK1/2/ERK1/2, without significant changes in total ERK1/2 expression (Fig. 3E-F). Caspase 3 is one of the major apoptosis-executing enzymes (41), while PKM2 is a key glycolytic enzyme proven to regulate the final rate-limiting step of glycolysis (42). On the one hand, cytoplasmic PKM2 promotes the accumulation of glycolysis intermediates, which is beneficial to tumor cells. On the other hand, PKM2 affects multiple transcription factors through C-terminal nuclear localization signals and regulates several signaling pathways contributing to tumor development. All together, these results revealed that NCTD treatment induced apoptosis and inhibited glycolysis in colorectal cancer cells.

Figure 3.

Treatment with NCTD significantly enhances apoptosis and inhibits glycolysis in colorectal cancer cells. HT29 or LOVO cells were treated with 5 and 10 µg/ml NCTD. (A) Percentage of apoptotic cells in HT29 and LOVO cells was detected by flow cytometric analysis. Evaluation of (B) lactate production and (C) glucose consumption. (D) Fam46c mRNA expression was detected by reverse transcription-quantitative PCR. (E and F) Fam46c, PKM2, cleaved caspase 3, p-ERK1/2 and ERK1/2 protein levels in HT29 (E) and LOVO cells (F) were analyzed via western blotting. **P<0.01, ***P<0.001 vs. vehicle. NCTD, norcantharidin; Fam46c, Family-with-sequence-similarity-46c; PKM2, pyruvate kinase M2; p-ERK1/2, phosphorylated ERK1/2; PI, propidium iodide.

Overexpression of Fam46c in colorectal cancer cells induces apoptosis and inhibits glycolysis

HT29 and LOVO cells were infected with Fam46c or vector lentivirus. As presented in Fig. 4, Fam46c overexpression markedly increased apoptosis in HT29 and LOVO cells (Fig. 4A). By contrast, lactate production (Fig. 4B) and glucose consumption (Fig. 4C) were significantly decreased upon Fam46c overexpression. In addition, Fam46c and cleaved caspase 3 levels were increased, while PKM2 and p-ERK1/2 levels were decreased without significant changes in ERK1/2 expression (Fig. 4D-F). These data demonstrated that overexpression of Fam46c in colorectal cancer induced apoptosis and inhibited glycolysis, which may suppress colorectal cancer progression.

Figure 4.

Overexpression of Fam46c in colorectal cancer cells induces apoptosis and inhibits glycolysis. HT29 or LOVO cells were infected with either Fam46c or vector lentivirus. (A) Percentage of apoptotic cells was detected by flow cytometric analysis. Evaluation of (B) lactate production and (C) glucose consumption. (D) Fam46c mRNA expression was examined by reverse transcription-quantitative PCR. (E and F) Fam46c, PKM2, cleaved caspase 3, p-ERK1/2 and ERK1/2 protein levels in (E) HT29 and (F) LOVO cells were determined by western blotting. ***P<0.001 vs. vector. Fam46c, Family-with-sequence-similarity-46c; PKM2, pyruvate kinase M2; p-ERK1/2, phosphorylated ERK1/2; PI, propidium iodide.

Knockdown of Fam46c potently attenuates the induction of NCTD in colorectal cancer cells

To investigate the response of Fam46c to NCTD treatment, SW620 cells were treated with shFam46c lentivirus and 10 µg/ml of NCTD. As demonstrated in Fig. 5, knockdown of Fam46c in colorectal cancer cells significantly suppressed apoptosis (Fig. 5A), and increased lactate production (Fig. 5B) and glucose consumption (Fig. 5C). These changes were accompanied with elevated levels of PKM2 and p-ERK1/2, and reduced expression of cleaved caspase 3 (Fig. 5D). Notably, NCTD treatment displayed opposite effects to those observed for Fam46c knockdown. It was revealed that treatment of colorectal cancer cells with NCTD was potently counteracted by Fam46c knockdown. These results suggested that apoptosis in colorectal cancer cells is associated with Fam46c expression. Therefore, Fam46c may be a potential target of NCTD treatment in colorectal cancer.

Figure 5.

Knockdown of Fam46c strongly attenuates the effects of NCTD on colorectal cancer cells. SW620 cells were divided and treated as follows: Vehicle + shNC, vehicle + shFam46c, 10 µg/ml NCTD + shNC and 10 µg/ml NCTD + shFam46c. (A) Percentage of apoptotic cells was detected by flow cytometric analysis. Evaluation of (B) lactate production and (C) glucose consumption. (D) Fam46c, PKM2, cleaved caspase 3, p-ERK1/2 and ERK1/2 protein levels were determined by western blotting. **P<0.01, ***P<0.001 vs. vehicle + shNC; #P<0.05, ##P<0.01, ###P<0.001 vs. 10 µg/ml NCTD + shNC. Fam46c, Family-with-sequence-similarity-46c; shNC, short hairpin negative control lentivirus; NCTD, norcantharidin; PKM2, pyruvate kinase M2; p-ERK1/2, phosphorylated ERK1/2; PI, propidium iodide.

ERK1/2 signaling may be involved in the treatment of NCTD in colorectal cancer cells

To further understand the role of ERK1/2 signaling in the treatment of NCTD in colorectal cancer cells, HT29 cells were given combinatorial treatments of NCTD and EGF, the latter acting as an agonist of ERK1/2. As shown in Fig. 6, treatment with EGF significantly increased lactate production (Fig. 6A) and glucose consumption (Fig. 6B), and concomitantly increased the protein levels of PKM2 and p-ERK1/2 without affecting ERK1/2 protein expression (Fig. 6C). Moreover, the effects of NCTD on glycolysis were potently attenuated by EGF treatment. Collectively, these results suggested that ERK1/2 signaling may be involved in the treatment of colorectal cancer cells with NCTD.

Figure 6.

ERK1/2 signaling may affect NCTD treatment in colorectal cancer cells. HT29 cells were divided and treated as follows: Vehicle + vehicle, vehicle + 10 µg/ml NCTD, 10 µg/ml EGF + vehicle and 10 µg/ml EGF + 10 µg/ml NCTD. Evaluation of (A) lactate production and (B) glucose consumption. (C) PKM2, p-ERK1/2 and ERK1/2 protein levels were determined. ***P<0.001 vs. vehicle + vehicle; ##P<0.01, ###P<0.001 vs. vehicle + 10 µg/ml NCTD. NCTD, norcantharidin; PKM2, pyruvate kinase M2; p-ERK1/2, phosphorylated ERK1/2; EGF, epidermal growth factor.

Discussion

Previous studies have found that Fam46 proteins serve critical roles in various types of human cancer, including colorectal cancer and hepatic carcinoma. For example, Fam46a may contribute to the acquired drug resistance of gastric cancer and non-small cell lung cancer cells (43,44). However, Fam46b is able to suppress prostate cancer cell proliferation and cell cycle progression via β-catenin ubiquitination (45). Moreover, loss of Fam46c may increase cell survival in myeloma and act as a predictor of hepatic recurrence in patients with resectable gastric cancer (32,46). The present study revealed that Fam46c expression was significantly reduced in colorectal cancer tissues and cells, though elevated in response to NCTD treatment. These findings indicated that Fam46c may function as a tumor suppressor of colorectal cancer and, hence, a potential therapeutic target of NDTC in colorectal cancer.

Various studies have revealed that NCTD is involved in several biological functions, including induction of apoptosis, inhibition of proliferation and suppression of cancer metastasis (24,47,48). In the present study, it was found that NCTD treatment significantly increased apoptosis and suppressed glycolysis in colorectal cancer cells, indicating that NCTD inhibited the proliferation of colorectal cancer cells. Interestingly, the expression of Fam46c was found to increase in response to NCTD treatment, suggesting that Fam46c may be an important regulator of NCTD treatment. Studies have found that Fam46c may be implicated in mediating the proapoptotic, antiproliferative and antimetastatic effects of NCTD treatment in hepatocellular carcinoma cells (34,35). In accordance with these study results, it was found that the effects of Fam46c overexpression in colorectal cancer cells were similar to those of NCTD treatment, whereas Fam46c knockdown potently attenuated the effects of NCTD treatment. These results provided further evidence for the important role of Fam46c in the treatment of colorectal cancer cells with NCTD. Moreover, decreased p-ERK1/2 levels were observed in NCTD-treated or Fam46c-overexpressing colorectal cancer cells, and treatment of EGF, an ERK1/2 agonist, attenuated the effects of NCTD. Importantly, it has been found that NCTD induces anoikis in colorectal cancer cells by activating JNK (21). Moreover, NCTD suppresses EMT of colorectal cancer cells through inhibition of the αvβ6-ERK-Ets 1 pathway (27). Taken together, these findings suggested that NCTD induced apoptosis and suppressed glycolysis by potentially inhibiting ERK1/2 signaling. Nevertheless, the mechanism linking Fam46c and ERK1/2 signaling remains unclear. It is hypothesized that Fam46c promotes apoptosis and decreases glycolysis in colorectal cancer cells through ERK1/2 inactivation via modulation of PKM2. Supporting this evidence, previous studies have reported that nuclear PKM2 functions as an important transcription factor that promotes ERK1/2 phosphorylation (49,50). In addition, previous studies have shown that Fam46a and Fam46b serve a role in cancer biology (45,51). Thus, their evaluation would be useful in relevant future studies.

In conclusion, the present study demonstrated the inhibitory effects of NCTD against colorectal cancer cell proliferation and glycolysis, which potentially occur by modulating Fam46c expression and antagonizing ERK1/2 signaling. Thus, Fam46c may serve as a therapeutic target in the treatment of colorectal cancer with NCTD, providing a novel option in the treatment of colorectal cancer.