Literature DB >> 32463812

An osteocalcin-deficient mouse strain without endocrine abnormalities.

Cassandra R Diegel1, Steven Hann2, Ugur M Ayturk2,3, Jennifer C W Hu2, Kyung-Eun Lim4, Casey J Droscha1, Zachary B Madaj5, Gabrielle E Foxa1, Isaac Izaguirre1, Vai Vivarium And Transgenics Core6, Noorulain Paracha7, Bohdan Pidhaynyy7, Terry L Dowd8,9, Alexander G Robling4, Matthew L Warman2, Bart O Williams1.   

Abstract

Osteocalcin (OCN), the most abundant noncollagenous protein in the bone matrix, is reported to be a bone-derived endocrine hormone with wide-ranging effects on many aspects of physiology, including glucose metabolism and male fertility. Many of these observations were made using an OCN-deficient mouse allele (Osc-) in which the 2 OCN-encoding genes in mice, Bglap and Bglap2, were deleted in ES cells by homologous recombination. Here we describe mice with a new Bglap and Bglap2 double-knockout (dko) allele (Bglap/2p.Pro25fs17Ter) that was generated by CRISPR/Cas9-mediated gene editing. Mice homozygous for this new allele do not express full-length Bglap or Bglap2 mRNA and have no immunodetectable OCN in their serum. FTIR imaging of cortical bone in these homozygous knockout animals finds alterations in the collagen maturity and carbonate to phosphate ratio in the cortical bone, compared with wild-type littermates. However, μCT and 3-point bending tests do not find differences from wild-type littermates with respect to bone mass and strength. In contrast to the previously reported OCN-deficient mice with the Osc-allele, serum glucose levels and male fertility in the OCN-deficient mice with the Bglap/2pPro25fs17Ter allele did not have significant differences from wild-type littermates. We cannot explain the absence of endocrine effects in mice with this new knockout allele. Possible explanations include the effects of each mutated allele on the transcription of neighboring genes, or differences in genetic background and environment. So that our findings can be confirmed and extended by other interested investigators, we are donating this new Bglap and Bglap2 double-knockout strain to the Jackson Laboratories for academic distribution.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32463812      PMCID: PMC7255615          DOI: 10.1371/journal.pgen.1008361

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   6.020


Introduction

Osteocalcin (OCN) is a protein almost exclusively expressed by osteoblasts [1]. Once transcribed and translated, the 95 amino acid OCN prepromolecule is cleaved to produce a biologically active 46-amino-acid, carboxyl-terminal fragment that contains three γ-carboxyglutamic acid residues (residues 62, 66, 69 in the mouse prepromolecule) which are made post-translationally via a vitamin K–dependent process [2]. The binding of Ca2+ to these γ-carboxyglutamic acid residues causes conformational changes that increase OCN binding to the bone mineral calcium hydroxyapatite [3]. Various states of undercarboxylated osteocalcin have been reported in bovine samples [4]; in humans, this results from limited vitamin K in the diet [5]. In humans, OCN is encoded by a single gene (BGLAP). In mice, OCN in encoded within a 25-kb interval on chromosome 3 that contains Bglap and Bglap2, (a.k.a., Og1 and Og2), which are highly expressed in bone, and Bglap3, (a.k.a., Org), which has minimal expression in bone. The 46-residue carboxyl-terminal domains encoded by Bglap and Bglap2 are 100% identical, and they differ by 4 amino acid residues from that encoded by Bglap3. Mice homozygous for a large genomic deletion encompassing Bglap and Bglap2 (Osc/Osc) were generated by ES-cell-mediated germline modification and described in 1996 [6]. By 6 months of age, these OCN-deficient mice had qualitatively increased cortical thickness and increased bone density relative to their control littermates. These qualitative differences were associated with significantly increased biomechanical measures of bone strength. Furthermore, OCN-deficient female mice were resistant to oophorectomy-induced bone loss. These data suggested that therapeutic reduction of OCN expression could prevent osteoporosis in humans. Subsequent studies using Osc/Oscmice broadened the biologic role for OCN by identifying wide-ranging physiologic changes when OCN is deficient. The first such report observed that Osc/Oscmice had increased visceral fat and displayed elevated blood glucose associated with decreased pancreatic beta-cell proliferation and insulin resistance [7]. Subsequent work indicated OCN can enhance male fertility by inducing testosterone production and promoting germ cell survival [8]. Other observed endocrine roles for OCN include influencing fetal brain development and adult animal behavior [9], promoting adaptation of myofibers to exercise and maintaining muscle mass with ageing [10, 11], and mediating the acute stress response [12]. Cumulatively, the reports outlined above with the Osc/Oscmice and, subsequently, a conditional knockout strain (Ocn-flox) made by the same investigative team [8] coupled with associated work [13-20], suggest that therapies which increase uncarboxylated osteocalcin levels may improve glucose intolerance, increase beta islet cell number, reduce insulin resistance, increase testosterone, improve male fertility, enhance muscle mass, and reduce declines in cognition. Given the potential importance of OCN, we created new strains of OCN-deficient mice using CRISPR/Cas9 gene editing [21]. Specifically, we created mice with mutations that disrupt either Bglap or Bglap2 individually or in combination. Here we report our observations regarding homozygous Bglap and Bglap2 double-knockout (Bglap/2dko/dko) mice, which we anticipated would recapitulate the previously reported OCN-deficient phenotypes in the Osc/Oscmice of increased bone mass and strength, elevated blood glucose, and decreased male fertility. We confirmed that we successfully knocked out Bglap and Bglap2 by performing RNA sequencing and by measuring immunoreactive OCN in mouse serum. Consistent with previous studies, homozygous offspring with this new OCN-deficient allele (Bglap/2dko/dko) were born at the expected Mendelian frequency and exhibited no overt clinical phenotype. However, inconsistent with previous studies, we did not observe significantly increased bone mass or strength, significantly elevated blood glucose, significantly decreased testosterone levels, or significantly impaired male fertility.

Results

Generation of mice with Bglap and Bglap2 double-knockout alleles and OCN deficiency

By simultaneously injecting Cas9 protein and guide RNAs that recognize sequences within Bglap and Bglap2, but not within Bglap3, we generated several founders that harbored large deletions involving Bglap and Bglap2. One founder allele, termed p.Pro25fsTer17, is a 6.8-kb deletion that joins exon 2 of Bglap to exon 4 of Bglap2 (Fig 1A). This allele is predicted to produce a chimeric Bglap/Bglap2 transcript with a reading frame shift after the 25th amino acid residue and a termination codon 17 residues further downstream. The predicted signal peptide encompasses 23 of these 25 amino acids. Because only two amino acids would remain after signal peptidase cleavage and because p.Pro25 is on the amino-terminal side of the biologically active domain of OCN, mice homozygous for this allele (Bglap/2dko/dko) should be OCN-deficient.
Fig 1

Generation and validation of a Bglap and Bglap2 double-knockout allele (Bglap/2dko) created by CRISPR/Cas9 gene editing.

(A)Top: Schematic (not to scale) showing the 25-kb interval on mouse chromosome 3 containing Bglap, Bglap2, and Bglap3. The locations of the guide RNAs used to produce founders with Bglap and Bglap2 intragenic or intergenic knockout alleles are indicated (arrows). Bottom, left: The Bglap/2 double-knockout (dko) allele (p.Pro25fs17Ter) deletes a 6.8-kb DNA fragment extending from Bglap exon 2 to Bglap2 exon 4. Bottom, right: A 5-bp insertion (5 bp ins) at the DNA ligation site creates a chimeric exon with a reading frame shift. The frame shift occurs after p.25 and terminates the protein 17 residues downstream (orange residues indicate wild-type sequence; blue indicates the first 4 frame-shifted residues). (B) Integrated Genomics Viewer screenshots of RNA sequencing data from wild-type and homozygous Bglap/Bglap2 double-knockout mice (Bglap/2dko/dko). Note the absence of sequencing reads mapping to Bglap exons 2, 3, and 4, and Bglap2 exons 1, 2, and 3 in the double-knockout mice; the mapping algorithm fails to map reads to the Bglap2 chimeric exon 2 because the chimera has a short seed length and a 5-bp insertion. (C) Serum ELISA assays for male and female 6-month-old Bglap/2dko/dko (green) and their control (black) littermates for the gamma-carboxyglutamic acid (Gla) and uncarboxylated (Glu) forms of OCN as well as osteopontin (OPN). In the box and whisker plots, each box extends from the 25th to 75th percentiles, the line represents the median, and the whiskers extend to the minimum and maximum values. The following sample sizes were used: male wild-type (n = 5), male Bglap/2dko/dko (n = 5), female wild-type (n = 7), and female Bglap/2dko/dko (n = 8).

Generation and validation of a Bglap and Bglap2 double-knockout allele (Bglap/2dko) created by CRISPR/Cas9 gene editing.

(A)Top: Schematic (not to scale) showing the 25-kb interval on mouse chromosome 3 containing Bglap, Bglap2, and Bglap3. The locations of the guide RNAs used to produce founders with Bglap and Bglap2 intragenic or intergenic knockout alleles are indicated (arrows). Bottom, left: The Bglap/2 double-knockout (dko) allele (p.Pro25fs17Ter) deletes a 6.8-kb DNA fragment extending from Bglap exon 2 to Bglap2 exon 4. Bottom, right: A 5-bp insertion (5 bp ins) at the DNA ligation site creates a chimeric exon with a reading frame shift. The frame shift occurs after p.25 and terminates the protein 17 residues downstream (orange residues indicate wild-type sequence; blue indicates the first 4 frame-shifted residues). (B) Integrated Genomics Viewer screenshots of RNA sequencing data from wild-type and homozygous Bglap/Bglap2 double-knockout mice (Bglap/2dko/dko). Note the absence of sequencing reads mapping to Bglap exons 2, 3, and 4, and Bglap2 exons 1, 2, and 3 in the double-knockout mice; the mapping algorithm fails to map reads to the Bglap2 chimeric exon 2 because the chimera has a short seed length and a 5-bp insertion. (C) Serum ELISA assays for male and female 6-month-old Bglap/2dko/dko (green) and their control (black) littermates for the gamma-carboxyglutamic acid (Gla) and uncarboxylated (Glu) forms of OCN as well as osteopontin (OPN). In the box and whisker plots, each box extends from the 25th to 75th percentiles, the line represents the median, and the whiskers extend to the minimum and maximum values. The following sample sizes were used: male wild-type (n = 5), male Bglap/2dko/dko (n = 5), female wild-type (n = 7), and female Bglap/2dko/dko (n = 8). Bglap/2dko/dko offspring were born from heterozygote crosses at the expected Mendelian frequency and appeared phenotypically indistinguishable from their wild-type and carrier littermates. We confirmed that Bglap/2dko/dko homozygous mutants produced the frame-shifted chimeric Bglap/Bglap2 mRNA transcript, as predicted, by RNA sequencing of freshly isolated mouse cortical bone mRNA (Fig 1B). We showed that homozygous mutants were OCN-deficient by measuring carboxylated and uncarboxylated OCN in serum (Fig 1C). Thus, the p.Pro25fs17 allele eliminated the production of immunodetectable OCN from Bglap and Bglap2, and, in this respect, was identical to the Oscallele [6] and the Cre-excised Ocn-floxed allele [8]. Because a recent report had found that loss of both OCN and osteopontin was synergistic in terms of effects on bone morphology and mechanical properties [22], we evaluated the serum levels of osteopontin. There were no significant differences in osteopontin between Bglap/2dko/dko mice and their littermate controls (Fig 1C).

Bglap/2dko/dko mice do not have increased bone mass or strength

Histomorphometric studies found increased bone area by 6 months of age in Osc/Oscmice [6]. Since μCT measures have superseded histomorphometric measures for assessing bone area and bone volume, we collected femurs from 6-month-old Bglap/2dko/dko mice and compared their μCT measures to those of their wild-type littermates. We saw no significant differences in cortical or trabecular bone parameters between the Bglap/2dko/dko and wild-type mice (Fig 2A and 2B and Table 1). Femur 4-point bending assays performed on Osc/Oscmice had revealed significantly increased bone strength [6]. We performed three-point-bending tests on 6-month-old Bglap/2dko/dko and wild-type littermates, but we did not find increased bone strength in these OCN-deficient animals (Fig 2C and S1 Table and S2 Table).
Fig 2

OCN deficiency does not signficantly alter bone mass or strength as assessed by μCT and biomechanical testing.

In the interleaved box and whisker plots, each box extends from the 25th to 75th percentiles, the line represents the median, and the whiskers extend to the minimum and maximum values. (A) μCT analysis of trabecular bone parameters indicated no significant differences between male or female 6-month-old Bglap/2dko/dko (green) and their control (black) littermates. Trabecular BV/TV, trabecular number, thickness, and separation are shown. Additional measurements are included in Table 1. The following sample sizes were used for both cortical and trabecular measurements: male wild-type (n = 10), male Bglap/2dko/dko (n = 12), female wild-type (n = 11), and female Bglap/2dko/dko (n = 11). (B) μCT analysis of cortical bone parameters indicated no significant differences between male or female 6-month-old Bglap/2dko/dko and their control littermates. Cortical BMD, cortical area fraction, tissue area, and cortical thickness are shown as representative measurements. Additional measurements and details are included in Table 1, and sample sizes are as in panel A. (C) Biomechanical loading assessments indicated no significant differences between male or female 6-month-old Bglap/2dko/dko and their control littermates. Ultimate force, energy to ultimate force, and stiffness are shown as representative measurements. Additional measurements and details are included in S1 Table and S2 Table. The following sample sizes were used: male wild-type (n = 12), male Bglap/2dko/dko (n = 12), female wild-type (n = 18), and female Bglap/2dko/dko (n = 14).

Table 1

μCT analysis of trabecular and cortical bone parameters for male or female 6-month-old Bglap/2dko/dko and their wild-type (Bglap2WT) littermates.

Sample sizes are shown at the top of each column.

FemaleMale
IndexBglap/2WT (n = 11)Bglap/2dko/dko (n = 12)Bglap/2WT (n = 10)Bglap/2dko/dko (n = 12)
Trab.TV (mm3)3.181 ± 0.5052.943 ± 0.4693.783 ± 0.3753.835 ± 0.602
Trab.BV (mm3)0.276 ± 0.1740.258 ± 0.1270.693 ± 0.1520.760 ± 0.249
Trab.BV/TV (%)0.085 ± 0.0480.085 ± 0.0340.183 ± 0.0360.198 ± 0.061
Trab.Conn.D. (1/mm3)32.603 ± 18.91733.891 ± 20.175118.994 ± 22.304112.240 ± 29.851
Trab.SMI2.617 ± 0.6262.542 ± 0.4411.779 ± 0.4061.603 ± 0.587
Trab.N (1/mm)2.632 ± 0.5882.773 ± 0.5574.386 ± 0.2984.350 ± 0.457
Trab.Th (mm)0.059 ± 0.0080.056 ± 0.0070.056 ± 0.0030.058 ± 0.007
Trab.Sp (mm)0.401 ± 0.1170.364 ± 0.0670.214 ± 0.0180.217 ± 0.029
Trab.BMC (μgHA/cm3)0.261 ± 0.1700.239 ± 0.1160.640 ± 0.1440.707 ± 0.240
Cort.TV (mm2)6.643 ± 0.7236.298 ± 0.6357.059 ± 0.5347.119 ± 0.741
Cort.BV (mm2)2.910 ± 0.2052.815 ± 0.1882.705 ± 0.1702.740 ± 0.178
Cort.BV/TV (%)0.441 ± 0.0290.450 ± 0.0360.384 ± 0.0200.387 ± 0.032
Cort.Th (mm)0.244 ± 0.0130.242 ± 0.0210.220 ± 0.0110.224 ± 0.016
Cort.BMC (μgHA/cm3)3.264 ± 0.2563.181 ± 0.2212.949 ± 0.1973.011 ± 0.204
Cort.BMD (μgHA/cm3)1.121 ± 0.0181.130 ± 0.0251.090 ± 0.0161.099 ± 0.019
CAF (%)0.569 ± 0.0390.570 ± 0.0500.521 ± 0.0390.515 ± 0.038
T.Ar (mm)1.870 ± 0.1931.848 ± 0.2392.123 ± 0.1952.166 ± 0.241
Cs.Th (mm)0.244 ± 0.0130.242 ± 0.0210.220 ± 0.0110.224 ± 0.016
Data represents mean ± SD

OCN deficiency does not signficantly alter bone mass or strength as assessed by μCT and biomechanical testing.

In the interleaved box and whisker plots, each box extends from the 25th to 75th percentiles, the line represents the median, and the whiskers extend to the minimum and maximum values. (A) μCT analysis of trabecular bone parameters indicated no significant differences between male or female 6-month-old Bglap/2dko/dko (green) and their control (black) littermates. Trabecular BV/TV, trabecular number, thickness, and separation are shown. Additional measurements are included in Table 1. The following sample sizes were used for both cortical and trabecular measurements: male wild-type (n = 10), male Bglap/2dko/dko (n = 12), female wild-type (n = 11), and female Bglap/2dko/dko (n = 11). (B) μCT analysis of cortical bone parameters indicated no significant differences between male or female 6-month-old Bglap/2dko/dko and their control littermates. Cortical BMD, cortical area fraction, tissue area, and cortical thickness are shown as representative measurements. Additional measurements and details are included in Table 1, and sample sizes are as in panel A. (C) Biomechanical loading assessments indicated no significant differences between male or female 6-month-old Bglap/2dko/dko and their control littermates. Ultimate force, energy to ultimate force, and stiffness are shown as representative measurements. Additional measurements and details are included in S1 Table and S2 Table. The following sample sizes were used: male wild-type (n = 12), male Bglap/2dko/dko (n = 12), female wild-type (n = 18), and female Bglap/2dko/dko (n = 14).

μCT analysis of trabecular and cortical bone parameters for male or female 6-month-old Bglap/2dko/dko and their wild-type (Bglap2WT) littermates.

Sample sizes are shown at the top of each column.

Fourier-transform infrared imaging (FTIR) reveals increased bone crystal size and mineral maturity in Bglap/2dko/dko mice

To gain additional insight into the constitution of the bone matrix in Bglap/2dko/dko animals, we evaluated data from FTIR images collected in cortical and trabecular bone sections (Fig 3 and S3 Table). There was a significant increase (p < 0.01) in collagen crosslink maturity and the carbonate-to-phosphate ratio of cortical bone in the Bglap/2dko/dko mice relative to their control littermates. Carbonate can incorporate into the hydroxyapatite lattice. No significant differences were found in trabecular bone between the two groups.
Fig 3

FTIR showed differences in carbonate/mineral ratio and collagen maturity between Bglap/2dko/dko and wild-type mice.

FTIR images of cortical bone showing the spatial distribution of the variables in wild-type (n = 3) and Bglap/2dko/dko (n = 4) female mice. Representative images show carbonate-to-mineral ratio and collagen maturity. Additional measurements and details are included in S3 Table.

FTIR showed differences in carbonate/mineral ratio and collagen maturity between Bglap/2dko/dko and wild-type mice.

FTIR images of cortical bone showing the spatial distribution of the variables in wild-type (n = 3) and Bglap/2dko/dko (n = 4) female mice. Representative images show carbonate-to-mineral ratio and collagen maturity. Additional measurements and details are included in S3 Table.

Bglap/2dko/dko mice have normal blood glucose concentration

The first reported endocrinologic role for OCN involved regulating glucose. From 1 to 6 months of age, Osc/Oscmice consistently showed higher random blood glucose levels relative to controls (p < 0.05) [7]. Fasting blood glucose also increased in 6-month-old Osc/Oscmice relative to controls (p < 0.001) [7, 20]. We observed no differences in blood glucose between 5- to 6-month-old Bglap/2dko/dko mice and their wild-type littermates when measured either after an overnight fast or at midday in animals with ad libitum access to food (Fig 4). We also observed no difference in weight between 6-month-old Bglap/2dko/dko and wild-type mice (Fig 4).
Fig 4

No significant evidence that whole body weight, random-fed glucose levels, or fasting glucose values differ between Bglap/2dko/dko and wild-type mice.

(A) Total weight for 6-month-old Bglap/2dko/dko and wild-type males and females. Sample sizes were male wild-type (n = 11), male Bglap/2dko/dko (n = 11), female wild-type (n = 11), and female Bglap/2dko/dko (n = 8). (B) Five- to six-month-old female wild-type (n = 5) and Bglap/2dko/dko (n = 5) mice were sampled for blood glucose concentration. Samples were taken on four consecutive days, 6 h into their light cycle while having ad libitum access to food. For each mouse, at least two glucose measurements were taken each day and averaged. Means and standard deviations for each genotype are shown. (C) The animals in panel 4B were then fasted for 16 h before blood glucose was again assessed. Samples were collected on two occasions approximately one week apart. At least two glucose measurements were taken on each day and averaged. The data display the means and standard deviations for each genotype. (D) After an overnight fast and at the time of euthanasia, blood glucose was measured in 6-month-old wild-type and Bglap/2dko/dko males and females. Sample sizes are male wild-type (n = 11), male Bglap/2dko/dko (n = 11), female wild-type (n = 11), and female Bglap/2dko/dko (n = 8).

No significant evidence that whole body weight, random-fed glucose levels, or fasting glucose values differ between Bglap/2dko/dko and wild-type mice.

(A) Total weight for 6-month-old Bglap/2dko/dko and wild-type males and females. Sample sizes were male wild-type (n = 11), male Bglap/2dko/dko (n = 11), female wild-type (n = 11), and female Bglap/2dko/dko (n = 8). (B) Five- to six-month-old female wild-type (n = 5) and Bglap/2dko/dko (n = 5) mice were sampled for blood glucose concentration. Samples were taken on four consecutive days, 6 h into their light cycle while having ad libitum access to food. For each mouse, at least two glucose measurements were taken each day and averaged. Means and standard deviations for each genotype are shown. (C) The animals in panel 4B were then fasted for 16 h before blood glucose was again assessed. Samples were collected on two occasions approximately one week apart. At least two glucose measurements were taken on each day and averaged. The data display the means and standard deviations for each genotype. (D) After an overnight fast and at the time of euthanasia, blood glucose was measured in 6-month-old wild-type and Bglap/2dko/dko males and females. Sample sizes are male wild-type (n = 11), male Bglap/2dko/dko (n = 11), female wild-type (n = 11), and female Bglap/2dko/dko (n = 8).

Bglap/2dko/dko male mice have normal fertility

The second reported endocrinologic role for OCN involved male fertility. Osc/Oscmale mice had smaller testes, lower testosterone levels, and produced fewer and smaller litters than control mice [8, 19]. We therefore measured testis size, resulting litter size, and blood testosterone in 6-month-old, singly housed, virgin male Bglap/2dko/dko and wild-type littermate mice. We found no significant differences in any of these measures between the two (Fig 5), although we did note an estimated, but not statistically smaller, testicular size in the mutants (Fig 5B). We carried out an independent analysis of testosterone levels in a cohort of 10- to 15-week-old male mice. For this work, virgin male mice were singly housed for 7 d prior to blood collection from the submandibular vein. Three days later, a second blood sample was collected from each singly housed mouse and sera from both samples were sent to the P30-supported University of Virginia Ligand Assay & Analysis Core of the Center for Research in Reproduction for analysis. These analyses revealed wide variation in testosterone levels, even in the same animal taken three days apart (S1 Fig). Yet, we again did not observe the reduced levels of testosterone reported in the Osc/Oscmice [8] (Fig 5E and 5F).
Fig 5

No significant evidence of fertility being affected in Bglap/2dko/dko mice.

In the interleaved box and whisker plots, each box extends from the 25th to 75th percentiles, the line represents the median, and the whiskers extend to the minimum and maximum values. (A) The number of pups per litter and the percentage of litters per plug (n = 11 for wild-type and n = 12 for Bglap/2dko/dko total matings for each genotype) resulting from crosses of Bglap/2dko/dko males or their wild-type control littermates to control C57Bl/6J females. (B) Dry testis weight expressed as mg/g total body weight for wild-type (n = 4) and Bglap/2dko/dko (n = 6) males. (C) Testis volume expressed as mm3/g of total body weight for wild-type (n = 4) and Bglap/2dko/dko (n = 6) males. (D) Blood testosterone concentration from 6-month-old, virgin wild-type (n = 9) and littermate Bglap/2dko/dko males (n = 6). (E) Blood testosterone concentration (ng/mL) from 10- to 15-week-old, virgin males. Analysis of wild-type (n = 7) and Bglap/2dko/dko (n = 8) littermates shown at two different collection times for each animal (* represents p > 0.05). (F) Values from panel E plotted to show the change in testosterone of each individual from day 0 (●) to day 3 (■).

No significant evidence of fertility being affected in Bglap/2dko/dko mice.

In the interleaved box and whisker plots, each box extends from the 25th to 75th percentiles, the line represents the median, and the whiskers extend to the minimum and maximum values. (A) The number of pups per litter and the percentage of litters per plug (n = 11 for wild-type and n = 12 for Bglap/2dko/dko total matings for each genotype) resulting from crosses of Bglap/2dko/dko males or their wild-type control littermates to control C57Bl/6J females. (B) Dry testis weight expressed as mg/g total body weight for wild-type (n = 4) and Bglap/2dko/dko (n = 6) males. (C) Testis volume expressed as mm3/g of total body weight for wild-type (n = 4) and Bglap/2dko/dko (n = 6) males. (D) Blood testosterone concentration from 6-month-old, virgin wild-type (n = 9) and littermate Bglap/2dko/dko males (n = 6). (E) Blood testosterone concentration (ng/mL) from 10- to 15-week-old, virgin males. Analysis of wild-type (n = 7) and Bglap/2dko/dko (n = 8) littermates shown at two different collection times for each animal (* represents p > 0.05). (F) Values from panel E plotted to show the change in testosterone of each individual from day 0 (●) to day 3 (■).

Few differences in cortical bone mRNA expression between Bglap/2dko/dko and control mice

RNA sequencing of cortical bone samples from Bglap/2dko/dko mice and their wild-type littermates confirmed the absence of wild-type Bglap and Bglap2 transcripts (Fig 1B). Although we sequenced a limited number of specimens from each group, we also performed a transcriptome-wide differential expression analysis, searching for large transcriptional changes in bone tissue. We generated RNA sequencing libraries from 4-month-old male mice that on average yielded 46 million reads and 82% uniquely mapping reads. After performing in silico filtering to remove contaminating blood, marrow, and muscle transcripts, we identified 14 transcripts that differed significantly between the OCN-deficient and wild-type mice (after correcting for multiple hypothesis testing) and that had an average FPKM (fragments per kilobase of transcript per million fragments greater than 3 in mice with either or both genotypes (Table 2 and S4 Table). As expected, the mean FPKM for Bglap was reduced from 2157 in wild-type mice to 158 in Bglap/2dko/dko mice. The mean FPKM for Bglap2 did not significantly differ between wild-type and Bglap/2dko/dko mice (1070 versus 1310 and S4 Table), with most reads in the mutant mice mapping to exon 4. Thus, despite the chimeric Bglap/2 mRNA containing a frame-shift and premature truncation codon, it is not subject to nonsense-mediated mRNA decay. The low level of the Bglap3 transcript (mean FPKM 10) seen in wild-type cortical bone increased 8-fold (mean FPKM 79, corrected p < 0.001) in Bglap/2dko/dko bone is less than 2.5% of the combined FPKMs for Bglap and Bglap2 in wild-type bone. It is also notable that 6 of the remaining 12 transcripts in Table 2 are encoded on chromosome 3, raising the possibility that CRISPR/Cas9 gene editing altered regulatory elements that directly affect these genes. Similar off-target mechanisms could explain the altered expression of transcripts encoded by other chromosomes. Alternatively, these gene expression changes could be the result of OCN deficiency. Although our RNA sequencing data might be underpowered to detect small changes of 2-fold or less in transcript abundance, we found no significant differences in the expression of osteoblast and osteocyte transcripts, including those of Alpl, Col1a1, Col1a2, Runx2, Opn, Sost, Dmp1, and Fgf23.
Table 2

mRNA Transcripts with statistically significant differences in transcript abundance between Bglap/2dko/dko and wild-type mice.

Mean FPKMs for each cohort are shown, as are the genomic coordinates for each gene. Note that in addition to Bglap and Bglap3, 6 of the remaining 11 genes also map to chromosome 3.

Ensembl IDGene IDp-value adjMean dko/dko FPKMMean WT FPKMChr Start and End
ENSMUSG00000067017Gm36083.22E-3011.70.71; 105455971–105458829
ENSMUSG00000074483Bglap5.38E-23158.32156.73; 88383501–88384464
ENSMUSG00000028081Rps3a12.56E-1165.2287.13; 86137940–86142702
ENSMUSG00000074340Ovgp12.42E-064.11.03; 105973711–105987423
ENSMUSG00000091383Hist1h2al5.55E-0523.90.113; 51202727–51203065
ENSMUSG00000040809Chil30.00041451.5247.73; 106147554–106167564
ENSMUSG00000074489Bglap30.00047777.59.83; 88368616–88372743
ENSMUSG000001065084933425M03Rik0.0048724.00.93; 85887691–85889234
ENSMUSG00000076564Igkv12-460.0057345.925.16; 69764523–69765022
ENSMUSG00000068855Hist2h2ac0.0096980.33.53; 96220361–96220880
ENSMUSG00000051906Cd209f0.0104123.20.88; 4102787–4105728
ENSMUSG00000028104Polr3gl0.01546850.022.53; 96577872–96594181
ENSMUSG00000017861Mybl20.0195152.04.22; 163054687–163084688

mRNA Transcripts with statistically significant differences in transcript abundance between Bglap/2dko/dko and wild-type mice.

Mean FPKMs for each cohort are shown, as are the genomic coordinates for each gene. Note that in addition to Bglap and Bglap3, 6 of the remaining 11 genes also map to chromosome 3.

Discussion

We created a double-knockout allele for Bglap and Bglap2 (Bglap/2dko) and then evaluated bone properties, glucose levels, and male fertility in homozygous mutant mice and their wild-type littermate controls. We found no significant effect of OCN deficiency on bone mass and strength (Fig 2). However, using FTIR, we did find skeletal differences between Bglap/2dko/dko and wild-type littermates. Bglap/2dko/dko mice had significantly higher collagen maturity and carbonate-to-mineral ratio, suggesting osteocalcin could be involved in mineral maturation and bone remodeling. This was previously proposed for the original osteocalcin knock-out mouse [23]. The increased carbonate to mineral ratio in cortical bone is also in agreement with recent assessments of samples from the Osc/Oscmice maintained on a purebred C57Bl/6J background [24]. In contrast to prior reports that utilized global double-knockout [6] or conditional double-knockout alleles [8], we did not observe any significant effect of OCN deficiency on blood glucose or body weight (Fig 4). Lee et al. [7] observed that OCN-deficient Osc/Oscmice had significantly increased random-fed blood glucose levels at 1, 3, and 6 months of age and significantly increased overnight-fasted blood glucose levels at 6 months of age. We powered our study to have >80% power to detect increases of a similar magnitude, but we found no difference in blood glucose between Bglap/2dko/dko mice and their wild-type littermates. It remains possible that the effect of osteocalcin deficiency on mouse glucose levels is much lower than previously reported, so that much larger cohort sizes or much more sensitive methods for measuring glucose utilization will be needed to identify any metabolic defect. The Bglap/2dko/dko mice are publicly available and can be easily obtained by an interested investigator. Oury et al. [8] observed male Osc/Oscmice had significantly lower litter frequencies and sizes, testicular weights and volumes, and serum testosterone levels. We did not find significant effects in the Bglap/2dko/dko mice for these variables (Fig 5), although we did note an estimated, but not statistically significant, smaller testicular size in Bglap/2dko/dko mice. While we found no differences in fertility, it is possible that this is associated with more subtle perturbations in testicular development and/or function that detailed follow-up studies could evaluate. We found large variation in mouse blood testosterone in mice even when individual animals were sampled 3 d apart. This variability is consistent with previous studies and is due to mouse hepatocytes producing little sex hormone–binding globulin (SHBG), the principal carrier of testosterone in the blood, in contrast to the abundant production of SHBG in human liver [25]. We do not know why Bglap/2dko/dko mice did not replicate the endocrinologic phenotypes that were attributed to other Bglap and Bglap2 double-knockout mice [7, 8, 19, 26]. Our RNA sequencing indicates we disrupted both the Bglap and Bglap2 transcripts (Fig 1B), and our serum ELISA data indicate that OCN is undetectable in Bglap/2dko/dko mice. We cannot preclude the possibility that increased Bglap3 mRNA expression compensated for the absence of Bglap and Bglap2 in the Bglap/2dko/dko mice. Although we could not detect OCN by ELISA in Bglap/2dko/dko animals, the Bglap3 protein may not be detected with this assay because it differs by 4 amino acid residues from that produced by Bglap and Bglap2. However, we think compensation by Bglap3 is unlikely, since its cortical bone transcript abundance in the Bglap/2dko/dko is less than 2.5% of the cumulative Bglap and Bglap2 transcript abundance in wild-type mice. At present we do not know whether the increase in Bglap3 mRNA expression is compensatory or an artifact of moving the Bglap promoter 6.8 kb nearer to Bglap3. The Bglap promoter appears to have been deleted along with Bglap and Bglap2 in the Osc/Oscmice [6], but not in the Ocnflox conditional knockout mice [8]. Therefore, comparing RNA sequencing data across all three strains could identify allele-specific effects on gene expression that account for phenotype differences between the Bglap/2dko/dko mice and the mice in previous publications. Other explanations for differences in phenotype could include genetic background, vivarium environment, genetic and epigenetic changes across generations, and assay design. Although we did not find the phenotypes previously ascribed to OCN deficiency in mice, our data do align with those reported for the OCN knockout rat. Rats, like humans, have only a single Bglap locus. Bglap knockout rats do not have elevated glucose levels, insulin resistance, or decreased male fertility [27]. To date, genetic studies in humans have not identified a role for OCN in these aspects of physiology either. No human Mendelian genetic disease has yet been attributed to loss-of-function mutations in BGLAP, in the Online Mendelian Inheritance in Man or MatchMaker exchange databases ([28, 29] https://omim.org and https://www.matchmakerexchange.org, each accessed on December 5, 2019), and there seems to be tolerance for heterozygous loss-of-function mutations at the population level (pLI = 0) [30] in the gnomAD database [https://gnomad.broadinstitute.org]. Two putative loss-of-function mutations (p.Gly27Ter19/rs1251034119 and p.Tyr52Ter/rs201282254) have carrier frequencies in the genome aggregation database (gnomAD) of 1-in-120 in African and about 1-in-150 in Ashkenazi Jewish participants, respectively. Also, one African participant and one Ashkenazi Jewish participant was homozygous for loss-of-function mutations in gnomAD. There is also no evidence from genome-wide association studies that common variants near BGLAP influence bone mineral density, blood glucose levels, body mass index, or risks for developing diabetes, autism, or psychiatric disease [https://www.gwascentral.org, http://pheweb.sph.umich.edu, http://www.type2diabetesgenetics.org]. Mutations in BGLAP do not appear to be enriched among children with autism or severe intellectual disability who have undergone research based sequencing [BioRvix: https://doi.org/10.1101/484113]. Because we did not find in the Bglap/2dko/dko mice the abnormalities that have been reported for the Osc/Oscmice, we chose not to perform studies interrogating the role of OCN on muscle mass, central nervous system development, behavior, or the acute stress response. Instead, are donating our mice to The Jackson Laboratory (JAX stock # 032497, allele symbol Del(3Bglap2-Bglap)1Vari). We suggest the Osc/Oscand Ocn-flox mice also be donated to a resource that facilitates public distribution, so that interested investigators can identify why different Bglap and Bglap2 double-knockout alleles produce different phenotypes.

Materials and methods

Experimental animals

Mice were maintained in accordance with institutional animal care and use guidelines, and experimental protocols were approved by the Institutional Animal Care and Use Committee of the Van Andel Institute. Mice were housed in Thoren Maxi-Miser IVC caging systems with a 12-h/12-h light/dark cycle.

Generation of Bglap/Bglap2 deletion mice using CRISPR/Cas9

Alterations in the mouse Bglap and Bglap2 alleles were created using a modified CRISPR/Cas9 protocol [31]. Briefly, two sgRNAs targeting exon 2 of OG1(AGACTCAGGGCCGCTGGGCT) and exon 4 of OG2 (GGGATCTGGGCTGGGGACTG) were designed using MIT’s guide sequence generator (crispr.mit.edu.). The guide sequence was then cloned into vector pX330-U6-Chimeric_BB-CBh-hSpCas9, which was a gift from Feng Zhang (Addgene plasmid # 42230; http://n2t.net/addgene:42230; RRID:Addgene_42230). The T7 promoter was added to the sgRNA template, and the sequence was synthetized by IDT. The PCR-amplified T7-sgRNA product was used as template for in vitro transcription using the MEGAshortscript T7 kit (Thermo Fisher Scientific). The injection mix consisted of Cas9 mRNA (Sigma Aldrich) (final concentration of 50 ng/μl) and sgRNA’s (20 ng/μl) in injection buffer (10 mM Tris, 0.1 mM EDTA, pH 7.5) injected into the pronucleus of C57BL/6;C3H zygotes. After identifying founders, we backcrossed the line to C57BL/6 twice before intercrossing to generate animals for our study.

Genotypic identification

To genotype the Bglap/2dko we used the following primers: OG1-E1-Fwd (ACACCATGAGGACCATCTTTC) and OG1-E4-Rev (AGGTCATAGAGACCACTCCAGC) to amplify a 517-bp wild-type product, and in a separate reaction we used OG1-E1-Fwd and OG1(E2)-OG2(E4)-Rev (AAGCTCACACACAGAGGCTTGG) to amplify a 238-bp knockout product. These animals are available from Jackson Laboratories (stock number 032497).

Blood chemistry analysis

Blood was harvested into an EDTA-treated tube at the time of euthanasia via intracardiac puncture, spun down at 8,000 rpm for 6 min, and plasma collected and stored at –80°C until use. Enzyme immunoassays were used to measure plasma concentrations of mouse Glu-osteocalcin (MK129;Takara), mouse Gla-osteocalcin (MK127; Takara), mouse osteopontin (MOST00; R&D Systems), and mouse testosterone (55-TESMS-E01; Alpco), according to the manufacturers’ recommendations. Statistical analysis was performed used a linear regression model to test for differences between genotypes via R. We also collected blood (see below) from 10- to 15-week-old males for testosterone measurements analyzed independently by the P30-supported University of Virginia Ligand Assay and Analysis Core Laboratory.

Collection of samples for skeletal analysis

Femurs were collected at 26 weeks of age; the right hindlimb was fixed in neutral buffered formalin for μCT analysis, and the left hindlimb was frozen in saline-saturated gauze for biomechanical testing.

μCT and mechanical testing

Formalin-fixed femora were scanned, reconstructed, and analyzed as previously described [32]. Briefly, 10 μm resolution, 50-kV peak tube potential, 151-ms integration time, and 180° projection area were used to collect scans on a Scanco μCT-35 desktop tomographer. The distal 60% of each femur was scanned, thresholded, and reconstructed to the 3rd dimension using Scanco software. Standard parameters related to cancellous and cortical bone mass, geometry, and architecture were measured [33]. For evaluation of bone mechanical properties, frozen femur samples were brought to room temperature over a 4-h period, then mounted across the lower supports (8 mm span) of a 3-point bending platen and mounted in a TestResources R100 small force testing machine. The samples were tested in monotonic bending to failure using a crosshead speed of 0.05 mm/s. Parameters related to whole bone strength were measured from force/displacement curves as previously described [34, 35].

Fourier-transform infrared imaging (FTIR) analysis

Femora from female, 6-month-old wild-type and Bglap/2dko/dko mice were cleaned of soft tissue, processed, and embedded in polymethylmethacrylate (PMMA) [36]. Longitudinal sections, 2 μm thick, were mounted on infrared windows where spectral images were collected at a 4 cm–1 spectral resolution and approximately 7 μm spatial resolution from a Spotlight 400 Imaging system (Perkin Elmer Instruments, Shelton, CT USA). Background spectra were collected under identical conditions from clear Ba2F windows and subtracted from sample data by instrumental software. IR spectra were collected from three areas (approximately 500 μm x 500 μm) of cortical bone per sample. The spectra were baseline-corrected, normalized to the PMMA peak at 1728 cm—, and the spectral contribution of PMMA embedding media was subtracted using ISYS Chemical Imaging Software (Malvern, Worcestershire, UK). Spectroscopic parameters of carbonate-to-mineral ratio, crystallinity, mineral-to-matrix ratio, collagen maturity, and acid phosphate were calculated. The carbonate-to-mineral ratio is the integrated area ratio of the carbonate peak (850–890)/ν1 ν3 PO4 band (900–1200 cm–1), while the mineral-to-(collagen)-matrix ratio is the integrated area ratio of the ν1 ν3 PO4 band (900–1200 cm–1) / amide I band (1590–1712 cm–1). The mineral crystallinity parameter corresponds to the crystallite size and perfection as determined by X-ray diffraction and is calculated from the intensity ratios of subbands at 1030 cm–1 (stoichiometric apatite) and 1020 cm–1 (nonstoichiometric apatite). The collagen maturity parameter is the ratio of nonreducible (mature) to reducible (immature) collagen cross-links, which is expressed as the intensity ratio of 1660 cm–1/1690 cm–1. The acid phosphate content in the mineral is measured from the peak height ratio of 1128/1096. The result for each parameter was reported as a histogram, describing the pixel distribution in the image. The mean value of the distribution was reported and associated color-coded images were generated at the same time by ISYS. Data for each measured parameter are expressed as mean ± standard error of the mean for each group. The data for all measured parameters were found to be normally distributed as analyzed by the Shapiro-Wilk tests did not find enough evidence to conclude any measured parameters were non-normally distributed. The average values were compared by the Student’s independent t-test for significant differences between groups. Differences for each measured parameter were considered statistically significant when p ≤ 0.05.

Baseline and random glucose measurements

Cohorts of 5- to 6-month-old female mice, wild-type (n = 5) and Bglap/2dko/dko (n = 5), were subjected to four random glucose measurements taken 6 h into their light cycle by tail nick using a glucose meter (AlphaTRAK; Zoetis) on four consecutive days. These same cohorts had glucose measurements obtained by tail nick after an overnight fast during which the animals had access to water on two occasions one week apart. Additional cohorts of mice were fasted overnight, but with access to water, prior to euthanasia by CO2 inhalation. Glucose levels were measured immediately after euthanasia. Animals were euthanized by CO2 inhalation and glucose levels were immediately measured from blood collected by tail nick using a glucose meter. Glucose data were analyzed using a linear mixed-effects model via the R package lme4 [37] to account for repeated sampling. Normality of the residuals was verified visually using a qq-plot.

Measurement of testis size and weight

Testes were removed from 6-month-old males after euthanasia and fixation. Fatty tissue was carefully removed from each testis and the sample dried prior to weighing on an analytical scale to determine dry weight. Testis weights was normalized to body weight (mg/g BW). Each testis was imaged and the length and width calculated using Nikon’s NIS-Elements documentation software. Testis volume was normalized to body weight (mm3/g BW). Statistical analysis was performed used a linear regression model to test for differences between genotypes via R.

Assessment of fertility

Male mice of mating age (7–16 weeks of age) were singly housed for 1 week before mating. Males were mated to C57BL/6J females in the evening and vaginal plugs checked the following morning. Number of pups per litter were compared between genotypes, and the percentage of vaginal plugs resulting in delivery and the number of pups per delivery were noted. Logistic mixed-effects regression with a random intercept for paternal mouse was used to determine if the rate of conception differed significantly between the two genotypes. A Poisson mixed-effects model with a random intercept for paternal mouse was used to determine if the number of pups per delivery differed significantly between the two genotypes. Both models were analyzed via the R v 3.5.2 (https://cran.r-project.org/) package lme4 [37]. Methods for testosterone measurement are provided in the previous section on blood chemistry analysis. We performed two independent testosterone measurements. One cohort was collected from 6-month-old virgin males that were singly housed for 3 d prior to sample collection. Plasma was isolated from whole blood and used to perform the mouse testosterone ELISA (ALPCO) in-house following the manufacturer’s protocol. The second cohort of 10- to 15-week-old virgin males were singly housed for 7 d prior to blood collection from the submandibular vein. Three days later, we collected a second sample from each male using the contralateral submandibular vein. The samples were collected in the morning each day and mice were sampled in the same order. Single cages were removed from the housing unit and the mouse removed for sampling. Serum was isolated from whole blood and sent to the University of Virginia Ligand Assay and Analysis Core to measure testosterone values independently. Statistical analysis was performed in R v3.6.0 using a linear mixed-effects model with random intercepts for each mouse and litter. Linear contrasts with a Benjamini-Hochberg adjustment for multiple testing were used to test specific hypotheses.

Cortical bone RNA sequencing and data analysis

Tibial cortical bone was recovered from 4-month-old male wild-type (n = 3) and Bglap/2dko/dko (n = 5) mice immediately following euthanasia by CO2 inhalation as previously described [38]. Samples were frozen in liquid nitrogen, pulverized, and suspended in TRIZol. Total RNA was recovered using the PureLink™ RNA Mini Kit (Invitrogen) according to the manufacturer’s instructions, including on-column DNAse digestion (PureLink™ DNase Set, Invitrogen). RNA quality was assessed using a Bioanalyzer (2100 Bioanalyzer, Agilent). RNA abundance was quantified based on the height of the 28S ribosomal peak since co-purifying contaminants confounded RNA abundance determinations based on RINs. Twenty-five ng of total RNA was used to construct an RNA-seq library for each sample. RNA was converted to cDNA using the SMART-Seq v4 Ultra Low Input RNA kit. The cDNA was fragmented using a sonication device (Covaris, E200). Library construction was completed using the ThruPLEX DNA-seq Kit (Rubicon Genomics). Size selection was performed with AMPure XP Beads (Beckmann Coulter) as per the manufacturer’s directions. Quality and mean fragment size of library samples were assessed with the Bioanalyzer prior to sequencing. Libraries were sequenced on a NextSeq 550 deep sequencing unit (150 cycles, paired-end, Illumina) at the Biopolymers Facility at Harvard Medical School, Boston, MA. Reads were mapped using STAR aligner to the Mus musculus genome (mm10, Ensembl release 89) [39]. Sequencing and alignment quality was analyzed with FastQC [40], RSeQC [41], and Picard (broadinstitute.github.io/picard). Read counts were calculated using the Subread package. Because blood, bone marrow, and muscle could not be completely removed from the tibial cortical bone prior to RNA extraction, we computationally removed reads representing 894 transcripts which we had previously shown to comprise about 10% of all cortical bone mRNA and come from these contaminating tissues [35]. We then used EdgeR [42] to measure transcript abundance by calculating fragments per kilobase of transcript per million fragments mapped (FPKM). We quantified -fold changes in expression between Bglap/2dko/dko and wild-type transcripts using the DESeq2 package [43]. Reported in Table 2 are those transcripts having a mean FPKM greater than 3 in wild-type, Bglap/2, or in both mice, and those that changed significantly (adjusted p values < 0.05) after correcting for multiple hypothesis testing using the Benjamini-Hochberg method. S4 Table includes adjusted p values for all transcripts regardless of FPKM.

Mean blood testosterone difference between day 0 and day 3 of 10- to 15-week-old, virgin males.

The mean difference of the change in testosterone is displayed using a +/- 95% confidence interval (CI). The difference in testosterone was calculated by subtracting the day 0 value from the day 3 value (* represents p > 0.05). (TIF) Click here for additional data file.

Biomechanical testing on male Bglap/2dko/dko and age-matched wild-type animals.

Individual measurements for each mouse are shown for ultimate force, stiffness, and energy to FU. Bglap/2dko/dko (KO/KO, n = 12) and wild-type (WT, n = 12) are noted, and the average and standard deviation are presented for each variable. (DOCX) Click here for additional data file.

Biomechanical testing on female Bglap/2dko/dko and age-matched wild-type animals.

Individual measurements for each mouse are shown for ultimate force, stiffness, and energy to FU. Bglap/2dko/dko (KO/KO, n = 14) and wild-type (WT, n = 18) are noted, and the average and standard deviation are presented for each variable. (DOCX) Click here for additional data file.

FTIR imaging quantitation for cortical and trabecular bone.

Quantitation of variables for Bglap/2dko/dko (KO/KO, n = 4 or 3) and wild-type (n = 3) female mice are shown. (DOCX) Click here for additional data file.

Differential expression calculated using the DESeq2 package of cortical bone mRNA transcripts between male Bglap/2dko/dko and male wild-type littermate mice.

This table includes adjusted p values (controlling for multiple hypothesis testing) for all transcripts regardless of FPKM. (XLS) Click here for additional data file. 1 Oct 2019 * Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. * Dear Dr Williams, Thank you very much for submitting your Research Article entitled 'An Osteocalcin-deficient mouse strain without endocrine abnormalities' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. As you will see, all three reviewers are supportive of the importance of the question and the central findings that the new mouse model of osteocalcin deficiency challenges early findings on another osteocalcin mouse model. Overall, we agree that the work has the potential to provide new information important for bone and mineral metabolism research. At the same time, there are some significant issues that were raised by the reviewers, as well as a number of minor points. The first relates to the statistical significance of some of the results and question of whether or not the numbers of animals that were used are sufficient to support the validity of the claims. Given the importance of the findings in re-interpreting earlier data in the field, it is particularly important that the findings are robust and supported by adequate numbers of experimental mice. The second major recommendation is that in addition to fasting glucose levels, provocative testing such as glucose tolerance should be carried out to further evaluate the claim that osteocalcin deficiency does not lead to endocrine abnormalities. We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer. In addition we ask that you: 1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. 2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images. We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please let us know if you have any questions while making these revisions. Yours sincerely, John F Bateman Associate Editor PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: During the last twenty three years, the bone and mineral metabolism research community (and the NIH institutes and numerous other national and international funding agencies that support it) have devoted a great deal of intellectual energy and resources on some very provocative, albeit controversial, ideas about osteocalcin (OCN) – a 46 amino-acid protein that is made in bone and binds avidly to the hydroxyapatite mineral. OCN is produced and secreted almost exclusively by osteoblasts, terminally differentiated cells responsible for the synthesis and mineralization of the bone matrix during the development of the skeleton and its periodic regeneration throughout life. Osteoblasts are short-lived cells originating from mesenchymal progenitors that are replaced depending on the demand for bone formation in a particular location and time. OCN secreted by osteoblasts contains three γ-carboxyglutamic acid residues that are removed by the acidic pH created during the resorption of bone by osteoclasts. According to ideas originated and propagated by Gerard Karsenty and co-workers, osteoblasts comprise an endocrine organ and decarboxylated OCN is a hormone. The circulating levels of this “new hormone” are, therefore, dependent on the rate of bone turnover, a.k.a. remodeling. Specifically, Karsenty and collaborators have claimed in a series of high profile publications over a period of several years that OCN acts on multiple organs and tissues including bone, pancreas, liver, adipose, muscles, testicles, and the brain to regulates functions ranging from bone mass accumulation, to body weight, adipocity, glucose metabolism, energy utilization, male fertility, mentation, and behavior. Notably, all these claims have been based on the results of studies of a single mouse model with genetic deletion of OCN, generated in the Karsenty laboratory over 23 years ago, but never made available to other investigators seeking to reproduce the results. However, unlike hormones produced and released by dedicated cells in response to external stimuli, the number of osteoblasts and thereby the circulating levels of osteocalcin inexorably change throughout life as a result of physiologic or pathologic changes of bone itself that can be acute or chronic, systemic or localized, and reversible or irreversible. Examples are skeletal development, growth, adaptation of the skeleton to mechanical forces, fracture healing, changing calcium needs, stress, menstrual cycle, pregnancy, lactation, menopause, aging, hyper- or hypo-parathyroidism, hyperthyroidism, hypercortisolemia, Paget’s disease, bone tumors, etc. Furthermore, medications – approved after extensive trials with thousands of subjects and used by millions for the treatment of osteoporosis – decrease or increase serum osteocalcin levels without any effect on glucose homeostasis, testosterone production, muscles, or behavior. The glaring shortcomings and incongruence of the Karsenty ideas with physiology, pathophysiology, clinical medicine, and pharmacology notwithstanding, the concerns with the hypothesis that bone and osteocalcin regulate many other tissues have progressively intensified over the years by the fact that other groups have failed to reproduce the observations of Karsenty and colleagues in different mice or in a rat model with OCN deletion. Still major journal review articles and prestigious teaching textbooks have continued until now to publish the Karsenty claims as proven biologic facts. In the study of Diegel et al, the authors have generated their own mouse model of loss of OCN function using CRISWPR/Cas9-mediated gene editing. Homozygous mice with deletion of the two alleles that encode OCN have undetectable mRNA for either allele in bone and no circulating OCN. Additionally, RNA sequencing of cortical bone samples from the OCN deficient mice show minimal differences from the wild type control mice. Unlike the Karsenty model, these mice have normal bone mass and strength, as well as normal blood glucose and male fertility. They do, however, exhibit increased bone crystal size and maturation of hydroxyapatite, consistent with earlier evidence and the general consensus that OCN plays a role in mineralization. The authors conclude that their OCN-deficient mouse has no endocrine abnormalities. The methods of analysis of the phenotype are state of the art, the results are solid and totally convincing, and the manuscript is concisely and clearly written. Minor point Page 3 of the Introduction, second line form the bottom: Spell out FPKM. Reviewer #2: The authors used Crispr-CAS technology to generate a mouse in which a large portion of both of the osteocalcin genes in mice were deleted. They showed that the mRNA generated from the deleted genome encodes a truncated protein likely to be non-functional and showed that antisera detected no immunoreactive osteocalcin in KO mouse blood. MicroCT showed no difference in bone mass between KO and WT and bone strength, measured by 4-point bending assays was normal in the KO. They noted tha the KO had an increased crystallinity and decrease in acid phosphate in the KO. Fasting blood glucose was normal in 6-month-old KO, as was weight. Fasting and random blood sugar levels were similar in KO and WT mice. Fertility, testis size and testosterone levels were normal in KO males. Thus, the knockout mouse failed to reproduce the reported abnormalities in the bone. 1. While the Karsenty group did see changes in fasting blood glucose between WT and KO mice, they showed much more dramatic differences when mice were challenged with a glucose tolerance test. I think it’s important for the current investigators to challenge their mice with a glucose tolerance test to see if that brings out a difference in glucose metabolism missed by the studies that they performed. 2. Testis weight and volume measurements involved only four WT mice. The weights and volumes of the KOs were lower, but apparently not statistically so. Particularly given the wide variation in the WT testis weight (20-30%), the authors need to do a power calculation to determine how many mice need to be studied to avoid missing a real difference, and repeat this study with adequate power. Testosterone levels vary substantially in male mice, depending on whether they are being housed with females or not. No mention was made of precautions to minimize variation among the mice. Was testosterone measurement made at the same time of day to minimize variation due to diurnal variation? When the findings are that the mice are not different, then substantial efforts should be made to avoid missing real differences. 3. The nature of the deletion in the KO mouse appears to allow the possible expression of a peptide fragment of osteocalcin. How do the authors know that this isn’t sufficient to rescue the pancreatic and muscle effects of osteocalcin? This seems unlikely to me, but needs to be discussed more fully by the authors. Has there been any structure-function analysis of these proposed actions of osteocalcin? Reviewer #3: This is a concise, well-constructed, and articulate study of novel Bglap1/2 KO mice, designed to characterise the physiological role of osteocalcin, which has been the subject of much research since the original publication of a KO mouse describing an endocrine phenotype for the bone protein KO mouse. Herein these studies confirm a role for osteocalcin in bone matrix, though not bone mass and strength. Crucially, there are no changes in plasma glucose or male fertility, which is at odds with a significant body of previous work. As such, this work represents a valuable addition to the literature, and I commend it. I have no specific comments regarding the studies performed; suffice to say that they are generally appropriate, well executed, and clearly presented. I have a few minor comments that the authors might wish to consider: 1. Please clarify more clearly the statistical analyses performed; it is not clear from the figure legends or methods for all of the experimental studies. 2. Related to (1), given the magnitude of the previously observed effects with Blglap KO mice (from the lab of Karsenty e.g. change in fasting plasma glucose), please confirm that the ‘n’ numbers used for the studies herein are sufficiently powered to detect such effects, given the variability in any given dataset? Also, are the values (e.g. fasting plasma glucose, bone density) for the WT mice in this study in line with previous work? 3. Please clarify in more detail the background of the mice, and specifically any differences between this new transgenic and the previous (for example, what is reported with respect to Bglap3 for previous mice lines?). 4. At times in the Results, it is not clear whether the authors are referring to their own data, or that of previous studies (quoting stats from previous papers makes this more confusing still). Please just check the syntax in places. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Stavros Manolagas, MD, PhD Reviewer #2: No Reviewer #3: No 20 Feb 2020 Submitted filename: PLOS Genetics Reply 022020.docx Click here for additional data file. 2 Mar 2020 Dear Dr Williams, We are pleased to inform you that your manuscript entitled "An Osteocalcin-deficient mouse strain without endocrine abnormalities" has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, John F Bateman Associate Editor PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-19-01327R1 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 29 Apr 2020 PGENETICS-D-19-01327R1 An Osteocalcin-deficient mouse strain without endocrine abnormalities Dear Dr Williams, We are pleased to inform you that your manuscript entitled "An Osteocalcin-deficient mouse strain without endocrine abnormalities" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, J&J Graphics PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  43 in total

1.  RSeQC: quality control of RNA-seq experiments.

Authors:  Liguo Wang; Shengqin Wang; Wei Li
Journal:  Bioinformatics       Date:  2012-06-27       Impact factor: 6.937

2.  The Matchmaker Exchange: a platform for rare disease gene discovery.

Authors:  Anthony A Philippakis; Danielle R Azzariti; Sergi Beltran; Anthony J Brookes; Catherine A Brownstein; Michael Brudno; Han G Brunner; Orion J Buske; Knox Carey; Cassie Doll; Sergiu Dumitriu; Stephanie O M Dyke; Johan T den Dunnen; Helen V Firth; Richard A Gibbs; Marta Girdea; Michael Gonzalez; Melissa A Haendel; Ada Hamosh; Ingrid A Holm; Lijia Huang; Matthew E Hurles; Ben Hutton; Joel B Krier; Andriy Misyura; Christopher J Mungall; Justin Paschall; Benedict Paten; Peter N Robinson; François Schiettecatte; Nara L Sobreira; Ganesh J Swaminathan; Peter E Taschner; Sharon F Terry; Nicole L Washington; Stephan Züchner; Kym M Boycott; Heidi L Rehm
Journal:  Hum Mutat       Date:  2015-10       Impact factor: 4.878

3.  Evaluating significance in linear mixed-effects models in R.

Authors:  Steven G Luke
Journal:  Behav Res Methods       Date:  2017-08

4.  Osteocalcin affects bone mineral and mechanical properties in female mice.

Authors:  O Berezovska; G Yildirim; W C Budell; S Yagerman; B Pidhaynyy; C Bastien; M C H van der Meulen; T L Dowd
Journal:  Bone       Date:  2019-08-08       Impact factor: 4.398

5.  Intermittent injections of osteocalcin improve glucose metabolism and prevent type 2 diabetes in mice.

Authors:  Mathieu Ferron; Marc D McKee; Robert L Levine; Patricia Ducy; Gérard Karsenty
Journal:  Bone       Date:  2011-04-29       Impact factor: 4.398

Review 6.  New insights into the biology of osteocalcin.

Authors:  Meredith L Zoch; Thomas L Clemens; Ryan C Riddle
Journal:  Bone       Date:  2015-06-06       Impact factor: 4.398

Review 7.  CRISPR/CAS9 Technologies.

Authors:  Bart O Williams; Matthew L Warman
Journal:  J Bone Miner Res       Date:  2017-02-23       Impact factor: 6.741

8.  Direct demonstration that the vitamin K-dependent bone Gla protein is incompletely gamma-carboxylated in humans.

Authors:  J R Cairns; P A Price
Journal:  J Bone Miner Res       Date:  1994-12       Impact factor: 6.741

9.  Fourier transform-infrared microspectroscopy and microscopic imaging.

Authors:  Samuel Gourion-Arsiquaud; Paul A West; Adele L Boskey
Journal:  Methods Mol Biol       Date:  2008

10.  Bone recognition mechanism of porcine osteocalcin from crystal structure.

Authors:  Quyen Q Hoang; Frank Sicheri; Andrew J Howard; Daniel S C Yang
Journal:  Nature       Date:  2003-10-30       Impact factor: 49.962

View more
  30 in total

Review 1.  Role of Vitamin K in Bone and Muscle Metabolism.

Authors:  N Alonso; A Meinitzer; E Fritz-Petrin; D Enko; M Herrmann
Journal:  Calcif Tissue Int       Date:  2022-02-12       Impact factor: 4.333

2.  Nmp4, a Regulator of Induced Osteoanabolism, Also Influences Insulin Secretion and Sensitivity.

Authors:  Joseph Bidwell; Sarah A Tersey; Michele Adaway; Robert N Bone; Amy Creecy; Angela Klunk; Emily G Atkinson; Ronald C Wek; Alexander G Robling; Joseph M Wallace; Carmella Evans-Molina
Journal:  Calcif Tissue Int       Date:  2021-08-21       Impact factor: 4.000

3.  RS 2247911 polymorphism of GPRC6A gene and serum undercarboxylated-osteocalcin are associated with testis function.

Authors:  K Jawich; M Santa Rocca; S Al Fahoum; M Alhalabi; A Di Nisio; C Foresta; A Ferlin; L De Toni
Journal:  J Endocrinol Invest       Date:  2022-04-28       Impact factor: 5.467

4.  Zoledronic acid does not affect insulin resistance in men receiving androgen deprivation therapy: a prespecified secondary analysis of a randomised controlled trial.

Authors:  Ada S Cheung; Rudolf Hoermann; Jasmine Zhu; Daryl Lim Joon; Jeffrey D Zajac; Mathis Grossmann
Journal:  Ther Adv Endocrinol Metab       Date:  2021-05-05       Impact factor: 3.565

Review 5.  Skeletal endocrinology: where evolutionary advantage meets disease.

Authors:  Nikolai Jaschke; Wolfgang Sipos; Lorenz C Hofbauer; Tilman D Rachner; Martina Rauner
Journal:  Bone Res       Date:  2021-05-28       Impact factor: 13.567

6.  Spatial survey of non-collagenous proteins in mineralizing and non-mineralizing vertebrate tissues ex vivo.

Authors:  Putu Ustriyana; Fabian Schulte; Farai Gombedza; Ana Gil-Bona; Sailaja Paruchuri; Felicitas B Bidlack; Markus Hardt; William J Landis; Nita Sahai
Journal:  Bone Rep       Date:  2021-02-10

7.  Testosterone Therapy Effects on Bone Mass and Turnover in Hypogonadal Men with Type 2 Diabetes.

Authors:  Georgia Colleluori; Lina Aguirre; Nicola Napoli; Clifford Qualls; Dennis T Villareal; Reina Armamento-Villareal
Journal:  J Clin Endocrinol Metab       Date:  2021-07-13       Impact factor: 6.134

8.  Lack of reproducibility in osteocalcin-deficient mice.

Authors:  Takeshi Moriishi; Toshihisa Komori
Journal:  PLoS Genet       Date:  2020-06-26       Impact factor: 5.917

9.  Independent validation of experimental results requires timely and unrestricted access to animal models and reagents.

Authors:  Cassandra R Diegel; Steven Hann; Ugur M Ayturk; Jennifer C W Hu; Kyung-Eun Lim; Casey J Droscha; Zachary B Madaj; Gabrielle E Foxa; Isaac Izaguirre; Alexander G Robling; Matthew L Warman; Bart O Williams
Journal:  PLoS Genet       Date:  2020-06-26       Impact factor: 5.917

Review 10.  Roles of bone-derived hormones in type 2 diabetes and cardiovascular pathophysiology.

Authors:  Xuzhu Lin; Danise-Ann Onda; Chieh-Hsin Yang; Joshua R Lewis; Itamar Levinger; Kim Loh
Journal:  Mol Metab       Date:  2020-06-13       Impact factor: 7.422

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.