Literature DB >> 32463361

TUBB4A mutations result in both glial and neuronal degeneration in an H-ABC leukodystrophy mouse model.

Sunetra Sase1, Akshata A Almad1, C Alexander Boecker2, Pedro Guedes-Dias2, Jian J Li3, Asako Takanohashi1, Akshilkumar Patel1, Tara McCaffrey1, Heta Patel1, Divya Sirdeshpande1, Julian Curiel1, Judy Shih-Hwa Liu4, Quasar Padiath5, Erika Lf Holzbaur2, Steven S Scherer3, Adeline Vanderver1,3.   

Abstract

Mutations in TUBB4A result in a spectrum of leukodystrophy including Hypomyelination with Atrophy of Basal Ganglia and Cerebellum (H-ABC), a rare hypomyelinating leukodystrophy, often associated with a recurring variant p.Asp249Asn (D249N). We have developed a novel knock-in mouse model harboring heterozygous (Tubb4aD249N/+) and the homozygous (Tubb4aD249N/D249N) mutation that recapitulate the progressive motor dysfunction with tremor, dystonia and ataxia seen in H-ABC. Tubb4aD249N/D249N mice have myelination deficits along with dramatic decrease in mature oligodendrocytes and their progenitor cells. Additionally, a significant loss occurs in the cerebellar granular neurons and striatal neurons in Tubb4aD249N/D249N mice. In vitro studies show decreased survival and dysfunction in microtubule dynamics in neurons from Tubb4aD249N/D249N mice. Thus Tubb4aD249N/D249N mice demonstrate the complex cellular physiology of H-ABC, likely due to independent effects on oligodendrocytes, striatal neurons, and cerebellar granule cells in the context of altered microtubule dynamics, with profound neurodevelopmental deficits.
© 2020, Sase et al.

Entities:  

Keywords:  TUBB4A; hypomyelination; leukodystrophy; microtubule; mouse; neurodegeneration; neuroscience

Mesh:

Substances:

Year:  2020        PMID: 32463361      PMCID: PMC7255805          DOI: 10.7554/eLife.52986

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

Hypomyelination with Atrophy of Basal Ganglia and Cerebellum (H-ABC) is a leukodystrophy caused by sporadic, typically de novo, heterozygous mutations in the TUBB4A gene (Simons et al., 2013). This gene encodes the tubulin beta 4A protein, which heterodimerizes with α−tubulin to form subunits that assemble into microtubules. Monoallelic mutations in TUBB4A result in a spectrum of neurologic disorders ranging from an early onset leukoencephalopathy to adult-onset Dystonia type 4 (DYT4; Whispering Dysphonia). H-ABC falls within this spectrum, presenting in the toddler years, typically with dystonia (Hersheson et al., 2013), progressive gait impairment, speech and cognitive deficits, as well as characteristic neuroimaging features - hypomyelination and atrophy of the caudate and putamen along with cerebellar atrophy (van der Knaap et al., 2007). On human pathological specimens, dorsal striatal areas and the granular layer of the cerebellum exhibit neuronal loss with axonal swelling and diffuse paucity of myelin (Curiel et al., 2017; Simons et al., 2013). About 65% of published cases with TUBB4A mutations have H-ABC; the heterozygous mutation p.Asp249Asn (TUBB4A) is the most common mutation (24.1% of overall mutations in a cohort of 166 individuals- personal communication B. Charsar) amongst all forms of TUBB4A associated leukodystrophy, and is particularly represented in individuals with a H-ABC phenotype (Blumkin et al., 2014; Ferreira et al., 2014; Miyatake et al., 2014; Pizzino et al., 2014; Purnell et al., 2014). H-ABC is currently considered an intermediary phenotype, between severely affected early infantile variants and juvenile-adult mild variants (Nahhas N et al., 2016). Although the expression pattern and associated disease phenotypes implicate a functional role of tubulin beta 4A protein in both neurons and oligodendrocytes, little is known about the pathologic mechanisms of TUBB4A mutations. TUBB4A is highly expressed in the central nervous system (CNS), particularly in the cerebellum and white matter tracts of the brain, with more moderate expression in the striatum (Hersheson et al., 2013), reflecting disease involvement in H-ABC. At a cellular level, TUBB4A is primarily localized to neurons and oligodendrocytes (OLs), with highest expression in mature myelinating OLs (Zhang et al., 2014). Our group has reported the effects of expressing a range of TUBB4A mutations using an OL cell line as well as mouse cerebellar neurons (Curiel et al., 2017). Over-expression of the TUBB4A mutation in an OL cell line resulted in decreased myelin gene expression and fewer processes compared to expression of wild type TUBB4A (TUBB4A) (Curiel et al., 2017). Similarly, in cerebellar neurons, TUBB4A over-expression resulted in shorter axons, fewer dendrites, and decreased dendritic branching compared to TUBB4A (Curiel et al., 2017). Other TUBB4A mutations highlighted phenotypic abnormalities specifically only in neurons and/or OL cell lines, suggesting mutation-specific effects, corresponding to variable clinical phenotypes (Curiel et al., 2017). This work highlights the importance of using models with mutations naturally occurring in humans. A spontaneously occurring rat model, the taiep rat, with a homozygous p.Ala302Thr Tubb4a mutation, has been reported with only a hypomyelinating phenotype in the brain, optic nerves and certain tracts of the spinal cord but no neuronal pathology (Duncan et al., 2017). The taiep specific mutation has not been reported in humans but is consistent with our cellular data showing variable cellular phenotypes for different mutations. An interesting feature observed in the taiep was accumulation of microtubules, particularly in the OLs, with subsequent demyelination (Duncan et al., 2017). Currently, there are no published animal models for the TUBB4A mutation specifically associated with H-ABC; which is key for understanding the pathogenesis and developing therapeutic options for individuals who harbor this mutation. Thus, we have developed a knock-in Tubb4a mouse as a model of H-ABC, recapitulating features of the human disease including dystonia, loss of motor function, and gait abnormalities. The histopathological features of the mouse model include both loss of neurons in striatum and cerebellum and hypomyelination in the brain and spinal cord, as observed in patients (Curiel et al., 2017). We have also explored the functional consequence of mutant tubulin on microtubule polymerization and the cell-autonomous role of Tubb4a mutation in neurons and OLs of the Tubb4a mice.

Results

Generation of a Tubb4a CRISPR knock-in mice

Heterozygous mutation p.Asp249Asn (Tubb4a mice were generated using CRISPR-Cas-9 technology by substituting p.Asp249Asn (c.745G > A) mutation in exon 4 of the Tubb4a gene. Known off-target effects include one synonymous mutation in cis at p.Lys244Lys (c.732C > A) with the pathogenic variant at p.Asp249Asn (variant at c.745G > A). Tubb4a mice were bred to obtain a homozygous Tubb4a mouse colony (Figure 1A). Homozygous mice were studied in parallel with Tubb4a mice, because in a rat model of Tubb4a mutation (Li et al., 2003), the homozygous animals develop phenotypic manifestations earlier than heterozygous animals. In WT mice, Tubb4a gene expression is highest in the cerebellum, spinal cord and striatum (compared to other CNS areas), which are also typically affected brain regions in H-ABC individuals. However, Tubb4a gene expression in WT, Tubb4aand Tubb4a mice are similar in these brain areas (Figure 1B), indicating there is no transcriptional change in the face of the mutation.
Figure 1.

Tubb4a mice show decreased survival, gait abnormalities, and progressive motor dysfunction.

(A) Schematic diagram showing mouse Tubb4a gene and sequencing chart of WT, Tubb4a, and Tubb4a mice. Red arrow indicates the position of 745 nucleotide in exon 4; WT shows one peak of ‘G’, Tubb4a mice show one peak each of ‘G’ and ‘A’, and Tubb4a mice shows two peaks for ‘A’. (B) Heat map of Tubb4a expression in brain;1- WT, 2- Tubb4a and 3- Tubb4a mice at end-stage (~P35-P40) (n = 3). (C) Schematic diagram displaying the time course of behavioral tests. (D) Graph for weight measurements of Tubb4a, Tubb4a, and WTs from P7, n = 10. (E) Illustration of crawling and walking: For ambulation measurement, crawling and walking was scored (see Table 1); throughout crawling; the whole hind paw touches the ground as designated by (#), walking; when the toes of the hind paw touch the ground and the heel is elevated, designated by [##]. (F) Ambulatory deficits of Tubb4a mice at P7, P10, and P14. Statistical analysis by two-way ANOVA, Tukey post-hoc analysis, n = 10. (G) Representative images of ambulatory angles at P14, P21, and P35 of Tubb4a and Tubb4a. (H) Ambulatory angle measurements of Tubb4a as compared to WT littermates at P7, P14, P21, P28, and P35. Statistical test by two-way ANOVA, post-hoc Tukey test, n = 14. (I) Pictorial presentation of hanging grip strength. (J) Grip strength measured by inverted fall angle in Tubb4a and Tubb4a mice. Statistical test by one-way ANOVA, Tukey post-hoc analysis, n = 10. (K) Rotarod testing demonstrating latency to fall (in seconds) in Tubb4a and Tubb4a mice at P21, P28, and P35, n = 14. (L) Righting reflex changes of Tubb4a, Tubb4a, and WT mice, n = 14. (M) Representative image of the end-stage Tubb4a mouse (~P35-P40) with severe dystonia and ataxia relative to WT. (N) Kaplan-Meier survival curve of Tubb4a and Tubb4a mice (Gehan-Breslow-Wilcoxon test, n = 28). Statistical tests performed by repeated measures two-way ANOVA, Tukey post-hoc analysis. Data presented as mean and SEM. *p<0.05, **p<0.01, ***p<0.001.

(A) Kaplan-Meier survival curve of Tubb4a mice as compared to WTs (Gehan-Breslow-Wilcoxon test, n = 10). (B) Rotarod test performance at the age of 9 months and 1 year of Tubb4a mice relative to WTs, n = 7–8. Statistical test performed by one-way ANOVA, followed by Tukey post-hoc test. (C–D) Representative images (C) and quantification (D) of PLP immunostaining (green) in corpus callosum of WT and Tubb4a at 1 year. Scale bar = 250 µm.

Tubb4a mice show decreased survival, gait abnormalities, and progressive motor dysfunction.

(A) Schematic diagram showing mouse Tubb4a gene and sequencing chart of WT, Tubb4a, and Tubb4a mice. Red arrow indicates the position of 745 nucleotide in exon 4; WT shows one peak of ‘G’, Tubb4a mice show one peak each of ‘G’ and ‘A’, and Tubb4a mice shows two peaks for ‘A’. (B) Heat map of Tubb4a expression in brain;1- WT, 2- Tubb4a and 3- Tubb4a mice at end-stage (~P35-P40) (n = 3). (C) Schematic diagram displaying the time course of behavioral tests. (D) Graph for weight measurements of Tubb4a, Tubb4a, and WTs from P7, n = 10. (E) Illustration of crawling and walking: For ambulation measurement, crawling and walking was scored (see Table 1); throughout crawling; the whole hind paw touches the ground as designated by (#), walking; when the toes of the hind paw touch the ground and the heel is elevated, designated by [##]. (F) Ambulatory deficits of Tubb4a mice at P7, P10, and P14. Statistical analysis by two-way ANOVA, Tukey post-hoc analysis, n = 10. (G) Representative images of ambulatory angles at P14, P21, and P35 of Tubb4a and Tubb4a. (H) Ambulatory angle measurements of Tubb4a as compared to WT littermates at P7, P14, P21, P28, and P35. Statistical test by two-way ANOVA, post-hoc Tukey test, n = 14. (I) Pictorial presentation of hanging grip strength. (J) Grip strength measured by inverted fall angle in Tubb4a and Tubb4a mice. Statistical test by one-way ANOVA, Tukey post-hoc analysis, n = 10. (K) Rotarod testing demonstrating latency to fall (in seconds) in Tubb4a and Tubb4a mice at P21, P28, and P35, n = 14. (L) Righting reflex changes of Tubb4a, Tubb4a, and WT mice, n = 14. (M) Representative image of the end-stage Tubb4a mouse (~P35-P40) with severe dystonia and ataxia relative to WT. (N) Kaplan-Meier survival curve of Tubb4a and Tubb4a mice (Gehan-Breslow-Wilcoxon test, n = 28). Statistical tests performed by repeated measures two-way ANOVA, Tukey post-hoc analysis. Data presented as mean and SEM. *p<0.05, **p<0.01, ***p<0.001.
Table 1.

Ambulation scores.

Mice were scored using a single trial on crawling, gait symmetry, and limb-paw movement during a straight walk. Ambulation scores were given as mentioned in table.

Ambulatory skillsScore
No response0
Asymmetric crawling1
Symmetric crawling2
Walking3

Normal survival, motor performance, and late-onset hypomyelination in Tubb4a mice.

(A) Kaplan-Meier survival curve of Tubb4a mice as compared to WTs (Gehan-Breslow-Wilcoxon test, n = 10). (B) Rotarod test performance at the age of 9 months and 1 year of Tubb4a mice relative to WTs, n = 7–8. Statistical test performed by one-way ANOVA, followed by Tukey post-hoc test. (C–D) Representative images (C) and quantification (D) of PLP immunostaining (green) in corpus callosum of WT and Tubb4a at 1 year. Scale bar = 250 µm.

Tubb4a mice recapitulate an H-ABC behavioral phenotype

The homozygous Tubb4a mutant mice appear normal compared to WT and heterozygous Tubb4a littermates until ~post natal (P) day P8. However, by ~P9, Tubb4a mice display tremor (Figure 1—videos 1 and 2), which progressively worsens with age (Figure 1—videos 3 and 4) until mice become severely ataxic and dystonic (~P21). Additionally, Tubb4a mice show gradual weight reduction from P35-37 compared to Tubb4a and WT mice (p<0.001, Figure 1D).
Figure 1—video 1.

Top view of representative WT mouse pup at P9.

Figure 1—video 2.

Top view of representative Tubb4aD249N/D249N mouse pup at P9 to demonstrate the onset of tremors.

Figure 1—video 3.

Progressive increase in tremors in representative Tubb4aD249N/D249N mouse at P21.

Figure 1—video 4.

End-stage to Tubb4aD249N/D249N mouse with severe dystonia and ataxia.

Motor skills were assessed by measuring ambulation, hanging grip strength, rotarod testing and righting reflexes over time. Tubb4a mice exhibit developmental delay with persistent asymmetric limb movement and crawling gait at P10 relative to ambulation in WT controls (p<0.05, see Table 1, Figure 1E–F). While Tubb4a mice achieve walking by P14, they display tremor, ataxia and abnormal gait. Ambulatory angle is consistently wider in Tubb4a mice from P14 to P35 (p<0.001, Figure 1G–H) suggesting gait instability. Additionally, Tubb4a mice demonstrate early deficits in hanging grip strength test, where compared to WT mice, they fall at a lesser angle (p<0.001, Figure 1I–J). Rotarod performance further shows a shorter latency to fall in Tubb4a mice on an accelerating rotarod, with worsening over time (p<0.001, Figure 1K, Figure 1—video 5). By ~P35-P40, Tubb4a mice are unable to feed themselves, with a decreased righting reflex (p<0.001, Figure 1L). At this time, mice reach a compassionate end-point (survival curve, p<0.001, Figure 1M–N) and are considered ‘end-stage’.
Figure 1—video 5.

The severe motor function as depicted by rotarod performance of Tubb4aD249N/D249N mouse compared to WT at P35.

Ambulation scores.

Mice were scored using a single trial on crawling, gait symmetry, and limb-paw movement during a straight walk. Ambulation scores were given as mentioned in table. Heterozygous Tubb4a mice transition well from crawling to ambulation and walk with a normal gait reminiscent of WT mice. Rotarod on Tubb4a mice at 9 months and 1 year of age demonstrates no motor or gait abnormalities even at later timepoints (Figure 1—figure supplement 1A). Further, Tubb4a mice display similar survival compared to their WT littermates and die because of advanced age (Kaplan-Meier survival curve, Figure 1—figure supplement 1B).
Figure 1—figure supplement 1.

Normal survival, motor performance, and late-onset hypomyelination in Tubb4a mice.

(A) Kaplan-Meier survival curve of Tubb4a mice as compared to WTs (Gehan-Breslow-Wilcoxon test, n = 10). (B) Rotarod test performance at the age of 9 months and 1 year of Tubb4a mice relative to WTs, n = 7–8. Statistical test performed by one-way ANOVA, followed by Tukey post-hoc test. (C–D) Representative images (C) and quantification (D) of PLP immunostaining (green) in corpus callosum of WT and Tubb4a at 1 year. Scale bar = 250 µm.

Tubb4a mice exhibit developmental delay in myelination and both Tubb4a and Tubb4a mice ultimately show demyelination

Myelination in mice starts at birth in the brainstem and spinal cord and has a nearly adult pattern by P21 (Baumann and Pham-Dinh, 2001). Profound myelination deficits are observed in Tubb4a mice, relative to their WT littermates, in both corpus callosum and cerebellum at P14 and P21 (Eri-C staining in Figure 2D and F and Figure 2—figure supplement 1 and Figure 2—figure supplement 2) with further loss of myelination by end-stage (~P35-P40) (p<0.001, Figure 2C–F). Based on Eri-C staining, myelination also decreases in Tubb4a mice at 1 year of age relative to WT littermates (p<0.001, Figure 2G–H).
Figure 2.

Tubb4a mice have severely delayed myelination.

(A–B) Immunohistochemical assays were performed according to a time course (A) in the Corpus callosum (CC) and Cerebellum (Cb) with the analyzed area in grey. (B) For each assay, the CC and Cb were imaged and quantified in WT, Tubb4a, and Tubb4a mice at P14, P21, and at end-stage (ES;~P35-P40), except for Eriochrome cyanine (Eri-C), PLP and MBP which was also assessed at one year in WT and Tubb4a mice only in CC. (C–D) The CC shows significantly decreased Eriochrome cyanine (Eri-C) staining (blue) in Tubb4a mice, which worsens over time. (E–F) Tubb4a mice show significant and worsening decreased of Eri-C staining in the Cb. (G–J) Loss of Eri-C staining (G–H) as well as MBP immunostaining (red) (I–J) in CC seen in 1-year-old Tubb4a mice. (K–N) PLP immunostaining (green) of CC (K–L) and decreased protein levels by western blot in the forebrain from P21 and ES mice (M–N) demonstrate a defect in the normal expression of myelin proteins. (O–R) A similar effect is seen in PLP immunostaining (O–P) and western blot (Q–R) in Cb. (S–Z) MBP protein staining in CC (S–T) and western blot (U–V) in the forebrain, as well as the Cb (W–Z) also showed a significant and progressive decrease in Tubb4a mice. Statistical tests performed by two-way ANOVA, Tukey post-hoc test or Unpaired t-test. n = 4 mice/group for P14 (except n = 3 for Tubb4a mice) and P21, n = 3 mice/group for ES and 1 year. Data presented as mean and SEM. *p<0.05 and ***p<0.001. Scale bar = 1 mm (C, E, G) or 250 µm (I, K, O, S, W). Western blots, lanes; 1, 2, and 3 represent WT, Tubb4a, and Tubb4a mice, respectively.

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B–D) Representative images of Eriochrome cyanine (Eri-C) staining for myelin (B; blue color) and immunostaining for PLP (C; green) or MBP (D; red) of corpus callosum in WT, Tubb4a, and Tubb4a mice. (E–G) Representative images of Eri-C staining of myelin (E; blue) and immunostaining for PLP (F; green) and MBP (G; red) of cerebellum in WT, Tubb4a, and Tubb4a mice. Data are quantified in Figure 2. Scale bar = 1 mm (B, E) or 250 µm (C, D, F, G).

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B–D) Representative images of Eriochrome cyanine (Eri-C) staining for myelin (B; blue color) and immunostaining for PLP (C; green) or MBP (D; red) of corpus callosum in WT, Tubb4a, and Tubb4a mice. (E–G) Representative images of Eri-C staining of myelin (E; blue) and immunostaining for PLP (F; green) and MBP (G; red) of cerebellum in WT, Tubb4a, and Tubb4a mice. Data are quantified in Figure 2. Scale bar = 1 mm (B, E) or 250 µm (C, D, F, G).

Figure 2—figure supplement 1.

Tubb4a mice show hypomyelination at P14.

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B–D) Representative images of Eriochrome cyanine (Eri-C) staining for myelin (B; blue color) and immunostaining for PLP (C; green) or MBP (D; red) of corpus callosum in WT, Tubb4a, and Tubb4a mice. (E–G) Representative images of Eri-C staining of myelin (E; blue) and immunostaining for PLP (F; green) and MBP (G; red) of cerebellum in WT, Tubb4a, and Tubb4a mice. Data are quantified in Figure 2. Scale bar = 1 mm (B, E) or 250 µm (C, D, F, G).

Figure 2—figure supplement 2.

Tubb4a mice show hypomyelination at P21.

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B–D) Representative images of Eriochrome cyanine (Eri-C) staining for myelin (B; blue color) and immunostaining for PLP (C; green) or MBP (D; red) of corpus callosum in WT, Tubb4a, and Tubb4a mice. (E–G) Representative images of Eri-C staining of myelin (E; blue) and immunostaining for PLP (F; green) and MBP (G; red) of cerebellum in WT, Tubb4a, and Tubb4a mice. Data are quantified in Figure 2. Scale bar = 1 mm (B, E) or 250 µm (C, D, F, G).

Tubb4a mice have severely delayed myelination.

(A–B) Immunohistochemical assays were performed according to a time course (A) in the Corpus callosum (CC) and Cerebellum (Cb) with the analyzed area in grey. (B) For each assay, the CC and Cb were imaged and quantified in WT, Tubb4a, and Tubb4a mice at P14, P21, and at end-stage (ES;~P35-P40), except for Eriochrome cyanine (Eri-C), PLP and MBP which was also assessed at one year in WT and Tubb4a mice only in CC. (C–D) The CC shows significantly decreased Eriochrome cyanine (Eri-C) staining (blue) in Tubb4a mice, which worsens over time. (E–F) Tubb4a mice show significant and worsening decreased of Eri-C staining in the Cb. (G–J) Loss of Eri-C staining (G–H) as well as MBP immunostaining (red) (I–J) in CC seen in 1-year-old Tubb4a mice. (K–N) PLP immunostaining (green) of CC (K–L) and decreased protein levels by western blot in the forebrain from P21 and ES mice (M–N) demonstrate a defect in the normal expression of myelin proteins. (O–R) A similar effect is seen in PLP immunostaining (O–P) and western blot (Q–R) in Cb. (S–Z) MBP protein staining in CC (S–T) and western blot (U–V) in the forebrain, as well as the Cb (W–Z) also showed a significant and progressive decrease in Tubb4a mice. Statistical tests performed by two-way ANOVA, Tukey post-hoc test or Unpaired t-test. n = 4 mice/group for P14 (except n = 3 for Tubb4a mice) and P21, n = 3 mice/group for ES and 1 year. Data presented as mean and SEM. *p<0.05 and ***p<0.001. Scale bar = 1 mm (C, E, G) or 250 µm (I, K, O, S, W). Western blots, lanes; 1, 2, and 3 represent WT, Tubb4a, and Tubb4a mice, respectively.

Tubb4a mice show hypomyelination at P14.

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B–D) Representative images of Eriochrome cyanine (Eri-C) staining for myelin (B; blue color) and immunostaining for PLP (C; green) or MBP (D; red) of corpus callosum in WT, Tubb4a, and Tubb4a mice. (E–G) Representative images of Eri-C staining of myelin (E; blue) and immunostaining for PLP (F; green) and MBP (G; red) of cerebellum in WT, Tubb4a, and Tubb4a mice. Data are quantified in Figure 2. Scale bar = 1 mm (B, E) or 250 µm (C, D, F, G).

Tubb4a mice show hypomyelination at P21.

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B–D) Representative images of Eriochrome cyanine (Eri-C) staining for myelin (B; blue color) and immunostaining for PLP (C; green) or MBP (D; red) of corpus callosum in WT, Tubb4a, and Tubb4a mice. (E–G) Representative images of Eri-C staining of myelin (E; blue) and immunostaining for PLP (F; green) and MBP (G; red) of cerebellum in WT, Tubb4a, and Tubb4a mice. Data are quantified in Figure 2. Scale bar = 1 mm (B, E) or 250 µm (C, D, F, G). The myelin proteins, PLP and MBP, measured by immunostaining, are also decreased in Tubb4a mice relative to Tubb4a and WT mice (Figure 2W and Figure 2—figure supplement 2, p<0.001), with a significant difference at P21 and end-stage (Figure 2L, P, T and X). This decrease in PLP and MBP protein is further confirmed with immunoblotting in forebrain (Figure 2M–N and U–V) and cerebellum (Figure 2Q–R and Y–Z) of Tubb4a mice at P21 (p<0.05) and end-stage (p<0.001). Tubb4a mice have comparable MBP and PLP immunoreactivity as WT mice at P14, P21 (Figure 2—figure supplements 1 and 2), and ~P35-P40 (Figure 2). However, by 1 year, their myelin protein levels significantly diminish in the corpus callosum compared to WT mice (p<0.05, PLP: Figure 1—figure supplement 1C–D; p<0.05, Figure 2I–J).

Tubb4a mice show apoptotic oligodendrocyte precursor cells (OPCs) and a dramatic decrease in oligodendrocyte numbers

To understand the developmental and degenerative abnormalities of myelin formation in Tubb4a and Tubb4a mice, oligodendrocytes (OLs) were assessed using ASPA stain in the corpus callosum at P14, P21 and end-stage (Figure 3C). A dramatic decline occurs in the number of OLs in the Tubb4a mice relative to their WT and Tubb4a littermates at all timepoints (p<0.001, Figure 3D, Figure 3—figure supplement 1A–B). However, upon examining the cells double-labeled with CC1 (mature OL marker) and cleaved caspase 3 (cell death marker); no cell death is detected at end-stage (Figure 3—figure supplement 2A), potentially ruling out apoptosis mediated OL death. To test, if OL numbers are in fact altered due to an effect on the progenitor pool, the total number of NG2 cells as well as NG2+ Cleaved Caspase 3+ cells were studied for cell death. While the total number of NG2 cells are unchanged (Figure 3E–F), a significant number of NG2 cells undergo apoptosis in Tubb4a mice compared to WT and Tubb4a mice at P14, P21 and end-stage (p<0.01, p<0.001, Figure 3G–H and Figure 3—figure supplement 2B–C).
Figure 3.

Tubb4a mice display reduced number of oligodendrocytes (OLs) and apoptotic Oligodendrocytes progenitor cells (OPC).

(A) Schematic diagram displaying the time course of immunohistochemical assay. (B) Schematic diagram showing area of corpus callosum used to perform counts (blue region). (C) Representative images of ASPA-positive OLs in WT, Tubb4a, and Tubb4a mice at the end-stage (ES;~P35-P40). (D) Quantification of ASPA-positive cells/mm2 at P14, P21, and ~P35-P40 in WT, Tubb4a, and ES Tubb4a mice. (E) Representative images of double-positive NG2+ Olig2+ cells in WT, Tubb4a, and Tubb4a mice at ES. (F) Quantification of double-positive NG2+ Olig2+ cells/mm2 at P14, P21, and ~P35-P40 in WT, Tubb4a, and ES Tubb4a mice. (G) Representative images of double-positive NG2+ caspase cells in WT, Tubb4a, and Tubb4a mice at ES. (H) Quantification of double-positive NG2+ caspase cells/mm2 at P14, P21, and ~P35-P40 of WT, Tubb4a, and ES Tubb4a mice. (I) Representative images of double-positive NG2+ Ki-67 cells in WT, Tubb4a, and Tubb4a mice at ES. (J) Quantification of double-positive NG2+ Ki-67 cells/mm2 at P14, P21, and ~P35-P40 of WT, Tubb4a, and ES Tubb4a mice. Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Representative data of two independent experiments with n = 3–4 mice/group for P14 and P21 and n = 3 mice/group for ES. Data is presented as mean and SEM. *p<0.05 and ***p<0.001. Scale bars = 50 µm and 25 µm.

(A–B) Representative images of ASPA-positive OLs in sections of the corpus callosum from WT, Tubb4a, and Tubb4a mice at the P14 (A) and P21 (B). (C–D) Representative images of double-positive NG2+ Olig2+ cells in WT, Tubb4a, and Tubb4a mice at the P14 (C) and P21 (D). (E) Quantification of counts of Olig2+ cells at P14, P21, and ES of WT, Tubb4a, and Tubb4a mice. Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Data is presented as mean and SEM. Scale bars = 50 µm and 25 µm.

(A) Representative images of double positive CC1 (OL marker) + Caspase+ in WT, Tubb4a, and Tubb4a mice at end-stage (P35–P40) of Tubb4a mice. (B–C) Representative images of double positive NG2+ Caspase in WT, Tubb4a, and Tubb4a mice at P14 (B) and P21 (C). (D–E) Representative images of double positive NG2+ Ki-67+ in WT, Tubb4a, and Tubb4a mice at P14 (D) and P21 (E). Scale bars = 50 µm and 25 µm.

Figure 3—figure supplement 1.

Tubb4a mice show reduced number of oligodendrocytes at P14 and P21.

(A–B) Representative images of ASPA-positive OLs in sections of the corpus callosum from WT, Tubb4a, and Tubb4a mice at the P14 (A) and P21 (B). (C–D) Representative images of double-positive NG2+ Olig2+ cells in WT, Tubb4a, and Tubb4a mice at the P14 (C) and P21 (D). (E) Quantification of counts of Olig2+ cells at P14, P21, and ES of WT, Tubb4a, and Tubb4a mice. Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Data is presented as mean and SEM. Scale bars = 50 µm and 25 µm.

Figure 3—figure supplement 2.

Tubb4a mice show Oligodendrocyte progenitor cell (OPC) death and proliferation at P14 and P21.

(A) Representative images of double positive CC1 (OL marker) + Caspase+ in WT, Tubb4a, and Tubb4a mice at end-stage (P35–P40) of Tubb4a mice. (B–C) Representative images of double positive NG2+ Caspase in WT, Tubb4a, and Tubb4a mice at P14 (B) and P21 (C). (D–E) Representative images of double positive NG2+ Ki-67+ in WT, Tubb4a, and Tubb4a mice at P14 (D) and P21 (E). Scale bars = 50 µm and 25 µm.

Tubb4a mice display reduced number of oligodendrocytes (OLs) and apoptotic Oligodendrocytes progenitor cells (OPC).

(A) Schematic diagram displaying the time course of immunohistochemical assay. (B) Schematic diagram showing area of corpus callosum used to perform counts (blue region). (C) Representative images of ASPA-positive OLs in WT, Tubb4a, and Tubb4a mice at the end-stage (ES;~P35-P40). (D) Quantification of ASPA-positive cells/mm2 at P14, P21, and ~P35-P40 in WT, Tubb4a, and ES Tubb4a mice. (E) Representative images of double-positive NG2+ Olig2+ cells in WT, Tubb4a, and Tubb4a mice at ES. (F) Quantification of double-positive NG2+ Olig2+ cells/mm2 at P14, P21, and ~P35-P40 in WT, Tubb4a, and ES Tubb4a mice. (G) Representative images of double-positive NG2+ caspase cells in WT, Tubb4a, and Tubb4a mice at ES. (H) Quantification of double-positive NG2+ caspase cells/mm2 at P14, P21, and ~P35-P40 of WT, Tubb4a, and ES Tubb4a mice. (I) Representative images of double-positive NG2+ Ki-67 cells in WT, Tubb4a, and Tubb4a mice at ES. (J) Quantification of double-positive NG2+ Ki-67 cells/mm2 at P14, P21, and ~P35-P40 of WT, Tubb4a, and ES Tubb4a mice. Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Representative data of two independent experiments with n = 3–4 mice/group for P14 and P21 and n = 3 mice/group for ES. Data is presented as mean and SEM. *p<0.05 and ***p<0.001. Scale bars = 50 µm and 25 µm.

Tubb4a mice show reduced number of oligodendrocytes at P14 and P21.

(A–B) Representative images of ASPA-positive OLs in sections of the corpus callosum from WT, Tubb4a, and Tubb4a mice at the P14 (A) and P21 (B). (C–D) Representative images of double-positive NG2+ Olig2+ cells in WT, Tubb4a, and Tubb4a mice at the P14 (C) and P21 (D). (E) Quantification of counts of Olig2+ cells at P14, P21, and ES of WT, Tubb4a, and Tubb4a mice. Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Data is presented as mean and SEM. Scale bars = 50 µm and 25 µm.

Tubb4a mice show Oligodendrocyte progenitor cell (OPC) death and proliferation at P14 and P21.

(A) Representative images of double positive CC1 (OL marker) + Caspase+ in WT, Tubb4a, and Tubb4a mice at end-stage (P35–P40) of Tubb4a mice. (B–C) Representative images of double positive NG2+ Caspase in WT, Tubb4a, and Tubb4a mice at P14 (B) and P21 (C). (D–E) Representative images of double positive NG2+ Ki-67+ in WT, Tubb4a, and Tubb4a mice at P14 (D) and P21 (E). Scale bars = 50 µm and 25 µm. Interestingly, in spite of the ongoing loss, the total number of NG2 and Olig2 populations are stable (Figure 3—figure supplement 1C–E). Loss or damage to OPCs can result in a proliferative response (Hughes et al., 2013), hence the number of dividing NG2 cells was next assessed at P14, P21 and end-stage timepoints. A significant increase is detected in NG2+ cells co-labeled with Ki-67 (proliferation marker) in Tubb4a mice at all timepoints compared to Tubb4a and WT mice (p<0.05, p<0.01; Figure 3I–J, Figure 3—figure supplement 2D–E), possibly contributing to the steady number of NG2+ and Olig2+ cells. In summary, OPCs undergo cell death and are being replaced in the Tubb4a mice, though possible defects in OPC differentiation results in fewer mature OLs.

Ultrastructural analysis corroborates myelination deficits in Tubb4a and Tubb4a mice

Loss of myelination was examined in epoxy sections of optic nerves from Tubb4a mice compared to WT and Tubb4a mice, at P21 (Figure 4—figure supplement 1) and end-stage (data not shown). Electron microscopy further confirms that end-stage Tubb4a optic nerves (n = 3) contain mostly unmyelinated axons and/or axons with myelin sheaths that are inappropriately thin for their axonal caliber (Figure 4A–C and A’-C’). In Tubb4a spinal cords, myelin sheaths are also noticeably thinner than in WT littermates as seen in the epoxy (Figure 4K–O) and EM sections (Figure 4—figure supplement 2).
Figure 4—figure supplement 1.

Hypomyelination and axon loss in Tubb4a optic nerve at P21.

Representative light microscopic image of optic nerve from WT, Tubb4a, and Tubb4a mice at P21. Empty areas designated as ‘v’ represents vacuole suggesting dying axons in Tubb4a mice.

Figure 4.

Ultrastructural myelin abnormalities in optic nerves and spinal cord of Tubb4a and Tubb4a mice.

(A–C) Representative electron microscopic (EM) images of optic nerves from WT, Tubb4a, and Tubb4a mice at end-stage (~P35) as indicated. Scale bar = 800 nm. The regions bounded by the rectangles are shown at higher magnification in (A’–C’), and illustrate the myelin sheath thickness. Red asterisks = unmyelinated axons, black asterisk = thinly myelinated axon. Scale bar = 400 nm. (D) Microglial cell/macrophage (M) containing phagocytosed material (blue asterisks) in Tubb4a. The region bounded by rectangle is shown at higher magnification in D’. Scale bar = 2 µm. (E) This electron microscopic image shows an apoptic nucleus, presumably an oligodendrocyte (OL). Scale bar = 1 μm. (F) This EM image shows unmyelinated axons that appose (a) or are surrounded by (a’) processes of an oligodendrocyte (OL). (G) A degenerating axon (d) with an incomplete axolemma, in a vacuole (v). The asterisk marks an axon containing vesicles. (H) g-ratios in optic axons from WT, Tubb4a, and Tubb4a mice. (H) g-ratio plotted against axon diameter for WT, Tubb4a, and Tubb4a mice. (I) Optic axon diameters (mean and SEM) for WT, Tubb4a, and Tubb4a mice; 50 axons per animals. (K) % myelination in the optic nerve of end stage mice (L–N) Representative semi-thin sections of spinal cord from WT, Tubb4a, and Tubb4a mice at end-stage (~P35) as indicated. Scale bar = 10 µm. (O) g-ratios in ventral funiculus of spinal cord from WT, Tubb4a, and Tubb4a mice. (P) g-ratio plotted against axon diameter in ventral funiculus of spinal cord from WT, Tubb4a, and Tubb4a mice. (n = 3 animals per group). One-way ANOVA was performed on the data set followed by Tukey post-hoc test. Data is presented as mean and SEM. *p<0.05, **p<0.001, ***p<0.001.

Representative light microscopic image of optic nerve from WT, Tubb4a, and Tubb4a mice at P21. Empty areas designated as ‘v’ represents vacuole suggesting dying axons in Tubb4a mice.

(A–C) Representative electron microscopic (EM) images of ventral spinal cord from WT, Tubb4a, and Tubb4a mice at end-stage. Scale bar = 1 μm (A’–C’) Higher magnification images showing thinner myelin sheaths surrounding large axons in Tubb4a and Tubb4a mice compared to WT. A microglial cell/macrophage (M) contain lipid droplets is illustrated in the Tubb4a images. Scale bar = 1 µm.

Figure 4—figure supplement 2.

Hypomyelination in Tubb4a and Tubb4a spinal cords at end-stage (~P35-P40).

(A–C) Representative electron microscopic (EM) images of ventral spinal cord from WT, Tubb4a, and Tubb4a mice at end-stage. Scale bar = 1 μm (A’–C’) Higher magnification images showing thinner myelin sheaths surrounding large axons in Tubb4a and Tubb4a mice compared to WT. A microglial cell/macrophage (M) contain lipid droplets is illustrated in the Tubb4a images. Scale bar = 1 µm.

Ultrastructural myelin abnormalities in optic nerves and spinal cord of Tubb4a and Tubb4a mice.

(A–C) Representative electron microscopic (EM) images of optic nerves from WT, Tubb4a, and Tubb4a mice at end-stage (~P35) as indicated. Scale bar = 800 nm. The regions bounded by the rectangles are shown at higher magnification in (A’–C’), and illustrate the myelin sheath thickness. Red asterisks = unmyelinated axons, black asterisk = thinly myelinated axon. Scale bar = 400 nm. (D) Microglial cell/macrophage (M) containing phagocytosed material (blue asterisks) in Tubb4a. The region bounded by rectangle is shown at higher magnification in D’. Scale bar = 2 µm. (E) This electron microscopic image shows an apoptic nucleus, presumably an oligodendrocyte (OL). Scale bar = 1 μm. (F) This EM image shows unmyelinated axons that appose (a) or are surrounded by (a’) processes of an oligodendrocyte (OL). (G) A degenerating axon (d) with an incomplete axolemma, in a vacuole (v). The asterisk marks an axon containing vesicles. (H) g-ratios in optic axons from WT, Tubb4a, and Tubb4a mice. (H) g-ratio plotted against axon diameter for WT, Tubb4a, and Tubb4a mice. (I) Optic axon diameters (mean and SEM) for WT, Tubb4a, and Tubb4a mice; 50 axons per animals. (K) % myelination in the optic nerve of end stage mice (L–N) Representative semi-thin sections of spinal cord from WT, Tubb4a, and Tubb4a mice at end-stage (~P35) as indicated. Scale bar = 10 µm. (O) g-ratios in ventral funiculus of spinal cord from WT, Tubb4a, and Tubb4a mice. (P) g-ratio plotted against axon diameter in ventral funiculus of spinal cord from WT, Tubb4a, and Tubb4a mice. (n = 3 animals per group). One-way ANOVA was performed on the data set followed by Tukey post-hoc test. Data is presented as mean and SEM. *p<0.05, **p<0.001, ***p<0.001.

Hypomyelination and axon loss in Tubb4a optic nerve at P21.

Representative light microscopic image of optic nerve from WT, Tubb4a, and Tubb4a mice at P21. Empty areas designated as ‘v’ represents vacuole suggesting dying axons in Tubb4a mice.

Hypomyelination in Tubb4a and Tubb4a spinal cords at end-stage (~P35-P40).

(A–C) Representative electron microscopic (EM) images of ventral spinal cord from WT, Tubb4a, and Tubb4a mice at end-stage. Scale bar = 1 μm (A’–C’) Higher magnification images showing thinner myelin sheaths surrounding large axons in Tubb4a and Tubb4a mice compared to WT. A microglial cell/macrophage (M) contain lipid droplets is illustrated in the Tubb4a images. Scale bar = 1 µm. Along with dramatically reduced numbers of normally myelinated axons, Tubb4a optic nerves exhibit microglia and/or macrophages containing myelin debris and lipid droplets (Figure 4D–D’), dying OLs (Figure 4E) as well as vacuoles (Figure 4G). As seen in taiep rats, we find enlarged astrocytic processes (‘astrogliosis’), axons with abnormal accumulations of lysosomes, degenerating unmyelinated and/or myelinated axons, but not bundles of microtubules in OLs (Duncan et al., 2017; Duncan et al., 1992; O'Connor et al., 2000; Roncagliolo et al., 2006; Wilkins et al., 2010). Many OLs are partially surrounded by unmyelinated axons, some of which are variably surrounded by cytoplasmic invaginations, reminiscent of non-myelinating Schwann cells in peripheral nerves (Figure 4F). Tubb4a optic nerves, in contrast, look similar to WT optic nerves except for more conspicuous astrocytic processes (Figure 4—figure supplement 1). These findings are even more striking in Tubb4a spinal cord at end-stage, where most large axons of the ventral funiculus are unmyelinated with conspicuous vacuoles, along with microglia and/or macrophages comprising of myelin debris, lipid droplets, and other unidentified material (Figure 4—figure supplement 2). Compared to WT mice, the g-ratio, a measure of myelin thickness, is significantly higher in optic nerves of Tubb4a and Tubb4a mice (Figure 4H, p<0.001). The axon caliber in optic nerves is significantly decreased in Tubb4a mice versus WT mice at end-stage (Figure 4I, p<0.05). Further, plotting g-ratio as a function of axon diameter (Figure 4J) demonstrates that intact axons of all calibers in optic nerves have relatively thinner myelin sheaths in Tubb4a and Tubb4a mice. The analysis of the percentage of myelination in the optic nerve reveals that ~65% of the axons are unmyelinated (Figure 4K, p<0.001) and ~30% of axons are thinly dysmyelinated axons in the Tubb4a (Figure 4K, p<0.01) compared to ~3% unmyelinated and 13% thinly dysmyelinated axons in WT mice. While about ~56% of axons are normally myelinated in the Tubb4a mice (Figure 4K, p<0.001),~5% of axons are unmyelinated and about ~39% thinly myelinated axons (Figure 4K, p<0.001). Similar to optic nerves, compared to WT mice, the g-ratio in spinal cords of Tubb4a and in Tubb4a mice are also significantly different (Figure 4L–N and O, p<0.001). Further, plotting g-ratio as a function of axon diameter demonstrates that all axons in spinal cord have relatively thinner myelin sheaths in Tubb4a and Tubb4a mice (Figure 4P).

Tubb4a mice demonstrate progressive neuronal loss in cerebellum and striatum

The survival of neurons was examined in the cerebellum and striatum of WT, Tubb4a and Tubb4a mice with NeuN and Nissl’s stain across developmental time points (Figure 5A). Nissl’s stain on cerebellar sections of Tubb4a mice reveals a severe progressive loss of the granular neuron layer from P21 to end-stage and a remarkable decrease in cerebellar volume (Figure 5B–C). Tubb4a mice display comparable number of granular neurons at P14 compared to WT mice (Figure 5E and Figure 5—figure supplement 1A), however, a dramatic and progressive granular neuron loss is observed at P21 and end-stage (p<0.001, Figure 5D–E). In addition, a significant increase in the number of Cleaved Caspase 3 positive cells co-localized with NeuN is observed at P21 and end-stage, indicating cellular apoptosis (p<0.001, Figure 5F–G). The loss of other neuronal populations in the cerebellum, such as Purkinje neurons stained with calbindin, do not display any change in the different groups of mice (Figure 5—figure supplement 1D–E).
Figure 5.

Tubb4a mice show severe cerebellar granular neuronal loss and significant striatal neuronal loss.

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B) Schematic diagram showing the whole brain mounts of WT, Tubb4a, and Tubb4a mice at P40. (C) Nissl stain images of cerebellum at P21 and P40 of WT and Tubb4a mice. (D) Representative images of NeuN (green) showing cerebellar granular neurons at P21 and End-stage (ES;~P35-P40) of WT and Tubb4a mice. (E) Quantification of cerebellar granular neuron (NeuN; green) counts/mm2 at P14, P21, and ES. (F) Representative images of double immuno-positive cerebellar granule neurons stained by NeuN+ (green) and cleaved caspase 3+ (red) (as shown by white arrow) at P21 and ES of WT and Tubb4a mice. (G) Quantification of double-positive NeuN+ (cerebellar granule neurons) and caspase+ (red) counts/mm2 at P14, P21, and ES. (H) Schematic diagram of striatum showing area used for quantifying neuronal counts (by dashed box). (I) Representative images of striatal neurons stained by NeuN (green) at ES of WT, Tubb4a, and Tubb4a mice. (J) Quantification of striatal neuronal counts/mm2 at P14, P21, and ES in WT, Tubb4a, and Tubb4a mice. Statistical test was performed by two-way ANOVA, followed by Tukey post-hoc test. Representative data of two independent experiments with n = 4 mice/group for P14 and P21 (except n = 3 for Tubb4a for P14 time point) and n = 3 mice/group for ES. Scale bar = 1 mm (C, D, H) or 25 µm (F) or 250 µm (I). Data is presented as mean and SEM. *p<0.05 and ***p<0.001.

(A) Representative images of cerebellar granule neurons and caspase staining at P14 of WT, Tubb4a and Tubb4a mice. (B) Representative images of striatal neurons at P14 and P21 of WT, Tubb4a and Tubb4a mice. Data are quantified in Figure 5 (C) Nissl staining at P14 of WT and Tubb4a mice. (D) Representative images of Purkinje neurons stained by calbindin at P21 and end-stage of WT, Tubb4a and Tubb4a mice. (E) Quantification of Purkinje neuronal counts/mm2 at P21 and end-stage of WT, Tubb4a and Tubb4a mice. Scale bar = 1 mm (‘A’ Upper panel and C) or Scale bar = 50 µm (‘A’ lower panel) or Scale bar = 100 µm (B, D) Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Data is presented as mean and SEM.

Figure 5—figure supplement 1.

Tubb4a mice show comparable Purkinje neuronal counts.

(A) Representative images of cerebellar granule neurons and caspase staining at P14 of WT, Tubb4a and Tubb4a mice. (B) Representative images of striatal neurons at P14 and P21 of WT, Tubb4a and Tubb4a mice. Data are quantified in Figure 5 (C) Nissl staining at P14 of WT and Tubb4a mice. (D) Representative images of Purkinje neurons stained by calbindin at P21 and end-stage of WT, Tubb4a and Tubb4a mice. (E) Quantification of Purkinje neuronal counts/mm2 at P21 and end-stage of WT, Tubb4a and Tubb4a mice. Scale bar = 1 mm (‘A’ Upper panel and C) or Scale bar = 50 µm (‘A’ lower panel) or Scale bar = 100 µm (B, D) Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Data is presented as mean and SEM.

Tubb4a mice show severe cerebellar granular neuronal loss and significant striatal neuronal loss.

(A) Schematic diagram displaying the time course of immunohistochemical assays. (B) Schematic diagram showing the whole brain mounts of WT, Tubb4a, and Tubb4a mice at P40. (C) Nissl stain images of cerebellum at P21 and P40 of WT and Tubb4a mice. (D) Representative images of NeuN (green) showing cerebellar granular neurons at P21 and End-stage (ES;~P35-P40) of WT and Tubb4a mice. (E) Quantification of cerebellar granular neuron (NeuN; green) counts/mm2 at P14, P21, and ES. (F) Representative images of double immuno-positive cerebellar granule neurons stained by NeuN+ (green) and cleaved caspase 3+ (red) (as shown by white arrow) at P21 and ES of WT and Tubb4a mice. (G) Quantification of double-positive NeuN+ (cerebellar granule neurons) and caspase+ (red) counts/mm2 at P14, P21, and ES. (H) Schematic diagram of striatum showing area used for quantifying neuronal counts (by dashed box). (I) Representative images of striatal neurons stained by NeuN (green) at ES of WT, Tubb4a, and Tubb4a mice. (J) Quantification of striatal neuronal counts/mm2 at P14, P21, and ES in WT, Tubb4a, and Tubb4a mice. Statistical test was performed by two-way ANOVA, followed by Tukey post-hoc test. Representative data of two independent experiments with n = 4 mice/group for P14 and P21 (except n = 3 for Tubb4a for P14 time point) and n = 3 mice/group for ES. Scale bar = 1 mm (C, D, H) or 25 µm (F) or 250 µm (I). Data is presented as mean and SEM. *p<0.05 and ***p<0.001.

Tubb4a mice show comparable Purkinje neuronal counts.

(A) Representative images of cerebellar granule neurons and caspase staining at P14 of WT, Tubb4a and Tubb4a mice. (B) Representative images of striatal neurons at P14 and P21 of WT, Tubb4a and Tubb4a mice. Data are quantified in Figure 5 (C) Nissl staining at P14 of WT and Tubb4a mice. (D) Representative images of Purkinje neurons stained by calbindin at P21 and end-stage of WT, Tubb4a and Tubb4a mice. (E) Quantification of Purkinje neuronal counts/mm2 at P21 and end-stage of WT, Tubb4a and Tubb4a mice. Scale bar = 1 mm (‘A’ Upper panel and C) or Scale bar = 50 µm (‘A’ lower panel) or Scale bar = 100 µm (B, D) Statistical test is performed by two-way ANOVA, followed by Tukey post-hoc test. Data is presented as mean and SEM. In the striatum, NeuN counts for Tubb4a and Tubb4a are comparable to WT mice at P14 and P21 time points (Figure 5J and Figure 5—figure supplement 1B). But at end-stage, Tubb4a mice demonstrate a significant loss of striatal neurons compared to WT mice (p<0.01, Figure 5I–J).

Tubb4a mutation affects oligodendrocyte and neuronal survival in a cell-autonomous manner

In order to explore the effect of Tubb4a mutations in OLs and neurons, independent of their in-situ environment, we studied in vitro cultures derived from WT, Tubb4a, and Tubb4a mice. OPCs were examined using A2B5 stain and a significant decrease is observed in the number of A2B5+ cells isolated from Tubb4a and Tubb4a mice compared to control WT mice (Figure 6—figure supplement 1A–D; p<0.01). Next, to assess if the decrease in OPCs is due to proliferation or cell death, A2B5 cells were co-labeled with Ki-67 or Caspase3 respectively. A significant decrease was noted in the number of A2B5+ Ki-67+ proliferating OPCs in Tubb4a (p<0.05) and Tubb4a (p<0.01) group compared to the WT mice (Figure 6—figure supplement 1A–C, Figure 6—figure supplement 1E). No changes were observed in the number of A2B5+ Caspase3+ cells between the three groups (Figure 6—figure supplement 1F). The OPCs were then differentiated towards an OL fate and were examined for PLP, a mature OL marker co-localized with Olig2, a pan OL lineage marker. A significant decrease in the number of PLP+ OLs is observed (Figure 6A–C) in Tubb4a mice (p<0.05) and Tubb4a mice (p<0.01) compared to mature OLs derived from WT mice (Figure 6E). However, the total number of Olig2+ cells are similar in all the groups (Figure 6D), resulting in a significant reduction in the proportion of mature OLs from the total cells committed to the OL lineage (PLP+/Olig2 cells, Figure 6F) in Tubb4a (p<0.01) and Tubb4a mice (p<0.01) compared to WT mice. These results overall reflect similar changes in OL development as seen in vivo in the mouse tissues and support a cell-autonomous contribution of Tubb4a mutation in the development of OL lineage cells.
Figure 6—figure supplement 1.

Tubb4a mice show decreased proliferation and no change in OPC death in vitro.

(A) Representative images of double positive A2B5 (OPC marker) and Ki-67 cells in WT, Tubb4a, and Tubb4a mice (D) Total number of A2B5+ OPCs (E) Number of proliferating OPCs (F) Number of dying OPCs labeled with A2B5+ Caspase+ cells. Scale bar = 50 µm. n = 1–3 pups/genotype with technical replicate of n = 3/ pup.

Figure 6.

Oligodendrocytes and neurons from Tubb4a and Tubb4a mice display reduced branching and processes.

(A–C) Representative images of PLP labeled oligodendrocytes (OL) isolated from WT, Tubb4a, and Tubb4a mice. Scale bar = 50 μm. (D) The number of Olig2 labeled cells were counted in coverslips from WT, Tubb4a/+, and Tubb4a mice and plotted as percentage of Olig2+ cells in WT animals. (E) Total number of PLP+ cells quantified from WT, Tubb4a/+, and Tubb4a mice were plotted as a percentage of PLP+ cells in WT animals. (F) Number of mature PLP+ cells from the total Olig2+ cells were plotted as a percent of WT animals. The experiments were repeated at least three independent times (n = 3). (G) Representative images of cortical neurons from WT mice stained with Tuj1 (axonal marker) and MAP2 (dendritic marker). (H) Representative images of cortical neurons from Tubb4a mice stained with Tuj1 and MAP2. Scale bar = 75 μm. (I) Number of surviving neurons at 1 week post-plating were quantified and plotted as percent of WT neurons. (J) Axon length was measured using Neurite tracer plugin and plotted for all groups. (K) Dendritic length was measured using Neurite tracer plugin and plotted for all groups. All experiments were conducted at least three independent times, with n = 1–3 pups/genotype and technical replicate of n = 3/ pup. Data is presented as mean and SEM. One-way ANOVA was performed on the data set followed by Tukey post-hoc test. *p<0.05, ***p<0.001.

(A) Representative images of double positive A2B5 (OPC marker) and Ki-67 cells in WT, Tubb4a, and Tubb4a mice (D) Total number of A2B5+ OPCs (E) Number of proliferating OPCs (F) Number of dying OPCs labeled with A2B5+ Caspase+ cells. Scale bar = 50 µm. n = 1–3 pups/genotype with technical replicate of n = 3/ pup.

Oligodendrocytes and neurons from Tubb4a and Tubb4a mice display reduced branching and processes.

(A–C) Representative images of PLP labeled oligodendrocytes (OL) isolated from WT, Tubb4a, and Tubb4a mice. Scale bar = 50 μm. (D) The number of Olig2 labeled cells were counted in coverslips from WT, Tubb4a/+, and Tubb4a mice and plotted as percentage of Olig2+ cells in WT animals. (E) Total number of PLP+ cells quantified from WT, Tubb4a/+, and Tubb4a mice were plotted as a percentage of PLP+ cells in WT animals. (F) Number of mature PLP+ cells from the total Olig2+ cells were plotted as a percent of WT animals. The experiments were repeated at least three independent times (n = 3). (G) Representative images of cortical neurons from WT mice stained with Tuj1 (axonal marker) and MAP2 (dendritic marker). (H) Representative images of cortical neurons from Tubb4a mice stained with Tuj1 and MAP2. Scale bar = 75 μm. (I) Number of surviving neurons at 1 week post-plating were quantified and plotted as percent of WT neurons. (J) Axon length was measured using Neurite tracer plugin and plotted for all groups. (K) Dendritic length was measured using Neurite tracer plugin and plotted for all groups. All experiments were conducted at least three independent times, with n = 1–3 pups/genotype and technical replicate of n = 3/ pup. Data is presented as mean and SEM. One-way ANOVA was performed on the data set followed by Tukey post-hoc test. *p<0.05, ***p<0.001.

Tubb4a mice show decreased proliferation and no change in OPC death in vitro.

(A) Representative images of double positive A2B5 (OPC marker) and Ki-67 cells in WT, Tubb4a, and Tubb4a mice (D) Total number of A2B5+ OPCs (E) Number of proliferating OPCs (F) Number of dying OPCs labeled with A2B5+ Caspase+ cells. Scale bar = 50 µm. n = 1–3 pups/genotype with technical replicate of n = 3/ pup. We also examined cortical neurons using in vitro cultures derived from WT, Tubb4a and Tubb4a mice. We analyzed survival based on the number of neurons labeled with Tuj1 and MAP2 stains at one-week post-plating. Tubb4a neurons display a significant decrease in survival relative to WT neurons (Figure 6G–I, p<0.01) and Tubb4a neurons. We also assessed whether Tubb4a affects neuronal morphology, by measuring axonal outgrowth and total dendritic length. Axon length is shorter in Tubb4a neurons (Figure 6J) and significantly shorter in Tubb4a neurons than WT neurite length (p<0.05). Total dendritic length is not significantly altered across genotypes (Figure 6K), although Tubb4a neurons shows a trend for shorter dendritic arbors. Overall, H-ABC associated Tubba mutation affects neuronal development, particularly axonal elongation.

Tubb4a and Tubb4a mutation alters microtubule dynamics in axons

We next investigated whether Tubb4a mutation affects microtubules dynamics in the distal axons of cortical neurons expressing mCherry-tagged EB3, a protein that forms comet-like structures at the growing plus-ends of microtubules from WT, Tubb4a and Tubb4a mice (Figure 7A; Stepanova et al., 2003). The average number of EB3 comets is not significantly different in neurons from WT, Tubb4a, or Tubb4a mice (Figure 7B). However, we noted that the Tubb4a data shows a greater variance (Browne-Forsythe test for equality of variances revealed a significant difference among the conditions, p<0.05) compared to WT and Tubb4a neurons. Histogram analysis reveals two distinct populations within the Tubb4a dataset, with some neurons displaying a lower density of EB3-comets and others a higher density of comets than seen in neurons from either the WT or heterozygous mice (Figure 7C). EB3 comet run-time (Figure 7D) in Tubb4a neurons is significantly shorter (p<0.001) compared to WT neurons and Tubb4a neurons. Similarly, EB3 comet run-length in Tubb4a and Tubb4a neurons is significantly shorter than in WT neurons (p<0.001, Figure 7E). In contrast, EB3 comet velocity is similar across all genotypes (Figure 7—figure supplement 1), indicating that microtubule growth rates were not affected.
Figure 7.

Microtubule polymerization is affected in Tubb4a/+ and Tubb4a mice.

(A) Example kymographs generated based on EB3 tracking from WT, Tubb4a, and Tubb4a cortical neurons. EB3 comet frequency was not significantly different (B) but a histogram depicting EB3 comet run-time relative frequency (C) suggests two different populations of EB3 comets. (D) Run-length and (E) Run-time of EB3 comets plotted for WT, Tubb4a, and Tubb4a were significantly shorter in Tubb4a and Tubb4a mice. All experiments were conducted at least three independent times, with n = 1–3 pups/genotype and technical replicate of n = 3/pup. Data is presented as mean and SEM. One-way ANOVA was performed on the data set followed by Tukey post-hoc test. *p<0.05, **p<0.001, ***p<0.001.

Velocity plotted for WT, Tubb4a, and Tubb4a microtubule polymerization based on EB3 trafficking. n = 1–3 pups/genotype with technical replicate of for n = 3/ pup and all experiments were at least three independent times. Data is presented as mean and SEM. One-way ANOVA was performed on the data set followed by Tukey post-hoc test. ***p<0.001.

Figure 7—figure supplement 1.

and .

Velocity plotted for WT, Tubb4a, and Tubb4a microtubule polymerization based on EB3 trafficking. n = 1–3 pups/genotype with technical replicate of for n = 3/ pup and all experiments were at least three independent times. Data is presented as mean and SEM. One-way ANOVA was performed on the data set followed by Tukey post-hoc test. ***p<0.001.

Microtubule polymerization is affected in Tubb4a/+ and Tubb4a mice.

(A) Example kymographs generated based on EB3 tracking from WT, Tubb4a, and Tubb4a cortical neurons. EB3 comet frequency was not significantly different (B) but a histogram depicting EB3 comet run-time relative frequency (C) suggests two different populations of EB3 comets. (D) Run-length and (E) Run-time of EB3 comets plotted for WT, Tubb4a, and Tubb4a were significantly shorter in Tubb4a and Tubb4a mice. All experiments were conducted at least three independent times, with n = 1–3 pups/genotype and technical replicate of n = 3/pup. Data is presented as mean and SEM. One-way ANOVA was performed on the data set followed by Tukey post-hoc test. *p<0.05, **p<0.001, ***p<0.001.

and .

Velocity plotted for WT, Tubb4a, and Tubb4a microtubule polymerization based on EB3 trafficking. n = 1–3 pups/genotype with technical replicate of for n = 3/ pup and all experiments were at least three independent times. Data is presented as mean and SEM. One-way ANOVA was performed on the data set followed by Tukey post-hoc test. ***p<0.001.

Discussion

TUBB4A mutations were identified in H-ABC affected individuals in 2013 (Simons et al., 2013), and additional mutations were later associated with a spectrum of hypomyelinating conditions (Hamilton et al., 2014; Nahhas N et al., 2016). The p.Asp249Asn (D249N) variant has been closely tied to the classic features of H-ABC, including the characteristic triad of hypomyelination with striatal and cerebellar atrophy. Although the naturally occurring taeip rat model harbors a Tubb4a mutation, the p.Ala302Thr mutation has not previously been seen in affected human individuals; the model lacks cerebellar and striatal atrophy (Duncan et al., 2017; Li et al., 2003) and is more consistent with those individuals manifesting isolated hypomyelination (Pizzino et al., 2014). In this study, we sought to fully explore H-ABC in a novel CRISPR-Cas9 transgenic model of the classic p.Asp249Asn (D249N) mutation, hoping to provide greater understanding of the diverse cellular phenotypes affected in the human disease. Tubb4a mutations in our model results in a severe myelin pathology, consistent with hypomyelination and progressive demyelination over time. Profound hypomyelination may contribute to early onset tremor in Tubb4a mice, similar to what is seen in Shiverer (Biddle et al., 1973), Shi (Readhead and Hood, 1990) and Jimpy mice (Nave et al., 1986). Tubb4a is highly expressed in mature OLs (Zhang et al., 2014), which may contribute to the significant glia phenotype in this mouse. The number of OPCs appears to be preserved in vivo in Tubb4a mice, although co-staining of NG2 (OPC marker) with caspase indicates increased cell death in early OL lineage cells of Tubb4a mice. A preserved overall number of NG2 and Olig2+ cells suggests that the death of OPCs may result in increased proliferation in vivo, supported by co-staining of NG2 with Ki-67. It has previously been shown that OPCs are dynamic cells and maintain their homeostatic behavior since NG2 cells abolished by differentiation or death are quickly restored through proliferation of the nearest OPCs (Hughes et al., 2013). OPCs isolated from Tubb4a and Tubb4a mice showed no changes in cell death markers but displayed defects in proliferation with fewer A2B5+ Ki-67+ cells compared to control WT control mice. Thus in vitro changes reflect a cell-autonomous effect resulting in decreased proliferation with no change in cell death. Conversely, in vivo dynamics of OPCs is complex as the increase in OPC proliferation occurs in the context of cell death, which could possibly be due to cross-talk with other cells such as neurons (Nagy et al., 2017) and influence of the milieu, as has been seen in other neurodegenerative disorders (Fernandez-Castaneda and Gaultier, 2016; Kang et al., 2013; Lee et al., 2019; McTigue and Tripathi, 2008; Tripathi and McTigue, 2007). Ultimately, both in vitro and in vivo studies show significant decrease in the number of mature OLs in Tubb4a mice as opposed to WT control mice. Since OLs express a greater degree of Tubb4a, it is possible a proportion of mature OLs die, not captured by the apoptotic marker caspase in vivo or die by a non-apoptotic mechanism. Thus, both cell death and inefficient differentiation may account for severe deficits seen in formation of mature OLs in Tubb4a mice. Pathology does not appear to be restricted to the OL lineage in H-ABC, however. Tubb4a mice show evidence of severe loss of cerebellar granular neurons at P21 and more limited striatal neuron degeneration after ~P37. The milder defects seen in striatal neurons may be related to the variable expression of Tubb4a, that is relatively higher in cerebellum than striatum (Figure 1B; Hersheson et al., 2013). We also studied cortical neurons in culture from Tubb4a and Tubb4a mice, demonstrating decreased survival and stunted axonal and dendritic length, although no obvious cortical defect is identified in vivo. Neuronal loss in the striatum and cerebellar granule layer is consistent with reported neuropathology in individuals affected by H-ABC (Pizzino et al., 2014; van der Knaap et al., 2002) and may underlie the progressive gait abnormalities, ataxia, and motor dysfunction seen in both this mouse model and affected individuals. MTs are integral to neuronal and OL development, contributing to their structure, including arborization, polarity, growth cone dynamics; as well as function such as axonal transport and intracellular transport of key myelin proteins through efficient MT polymerization (Clark et al., 2016). A number of mutations in α-tubulin and β-tubulin are attributed to neurological disorders such as Parkinson’s disease (Cartelli et al., 2010) and Amyotrophic Lateral Sclerosis (Fanara et al., 2007) due to altered MT dynamics resulting in impaired axonal transport crucial for active cargo transport. Previous in vitro reports (Curiel et al., 2017; Vulinovic et al., 2018) suggest that TUBB4A causes alterations in tubulin dynamics. In current studies, while there is no change in microtubule assembly rates in functional studies in Tubb4a and Tubb4a neurons, a potential increase occurs in the frequency of pausing at the growing microtubule ends. Our data also suggests that there may be alterations in microtubule organization in axons, given the increased variance in EB3-comet density along the axons of Tubb4a neurons. Alterations in MT dynamics or organization in Tubb4a neurons may hamper the transport of cargo required for axon elongation and dendritic branching. Additionally, given the complexity of OL processes and myelin sheath development, it can be foreseen that inefficient delivery of cargo along MTs also contributes to the decreased maturation and complexity of Tubb4a OLs. Notably, the taeip rat displays an accumulation of microtubules in OLs, unmyelinated axons, and astrogliosis along with perinuclear localization of RNA for PLP, MAG and MBP myelin genes, which was attributed to altered activity of the motor protein dynein for MBP trafficking in mutated OLs (Duncan et al., 2017; O'Connor et al., 2000; Song et al., 2003; Wilkins et al., 2010). Our EM studies in Tubb4a mice show unmyelinated or abnormally thin myelinated axons, astrogliosis, axons with abnormal accumulation of lysosomes, microglia, and/or macrophages containing myelin debris, and lipid droplets reminiscent of deficits seen in taiep rats. However, the remarkable microtubule accumulation demonstrated in the taiep rat (Duncan et al., 2017) is not seen in our Tubb4a mice. Despite no microtubule accumulation, it is noteworthy that the Tubb4a mutation appears to significantly affect microtubule dynamics in our model. This may be the basis for the cell-autonomous effects of Tubb4a mutations, leading to decreased OL maturation, impaired axonal growth and reduced neuronal survival. The exact mechanism by which Tubb4a mutation impacts microtubule function, myelination, and neuronal function remains unknown and needs to be further explored. An important limitation of this study is the use of mice with both heterozygous and homozygous mutations, when in humans the inheritance pattern of H-ABC is sporadic with heterozygous mutations causing disease. While both Tubb4a and heterozygous Tubb4a mice demonstrate severe hypomyelination followed by additional myelin loss; only the homozygous Tubb4a mice show early deficits in gait and motor skills, consistent with ataxia and tremor seen in H-ABC affected individuals. One potential explanation for this species-specific difference is dosage sensitivity, resulting in a dissimilar penetrance of phenotypes. This has been reported for the taiep rat model (Li et al., 2003); in addition, there are several other reported genes such as GATA3 (Lim et al., 2000), TBX1 (Jerome and Papaioannou, 2001), GLI3 (Böse et al., 2002) where, heterozygous mutations are present in humans but homozygous mice have similar phenotypic expression to the human disease. The presence of disease in both heterozygous and homozygous animals could be due to mutations causing either loss or gain of function. However, our previous in vitro work and a study in human SH-SY5Y cells overexpressing mutant TUBB4A (Curiel et al., 2017; Vulinovic et al., 2018) suggests a mechanism for toxic gain of function. This is further supported by existing Tubb4a knock out (KO) mouse models. Tubb4a KO mice with LacZ expression (Skarnes et al., 2011) are available at the knock-out mouse project repository (http://www.mousephenotype.org/data/genes/MGI:107848#section-associations). Homozygous Tubb4a KO mice show normal embryonic development and growth relative to WT mice. Phenotypic lac Z expression data shows that the nervous system appears normal with no discernible cerebellar neuron loss. Together this body of evidence suggests a mechanism of dominant toxic gain of function and while presence of WT Tubb4a might not be essential for brain development and function, mutations may later result in neuronal and oligodendrocyte deficits. As various TUBB4A mutations have been reported (Lu et al., 2017; Pizzino et al., 2014; Tonduti et al., 2016), it is becoming recognized that mutation specific cellular effects, with independent involvement of the striatum, myelinating cells, and cerebellum, may be responsible for the wide phenotypic variability seen in this condition (Curiel et al., 2017; Pizzino et al., 2014). Tubb4a mice are the first model to demonstrate both neuronal and oligodendroglial defects, and replicate the behavioral and neurodegenerative features of classical H-ABC disease. These data support a pathogenic pathway in which altered microtubules are critical drivers of disease pathogenesis across diverse cellular populations. Tubb4a mice provide a key tool to explore the molecular mechanisms of this complex disease and test the efficacy of therapeutic strategies.

Materials and methods

Generation of mouse model

Heterozygous Tubb4a mice were generated using CRISPR-Cas9 technology by inserting the c.745G > A (p.Asp249Asn) mutation in exon 4 of the mouse Tubb4a gene. Methodologies are available in Appendix 1 and gRNA sequences is listed in the key resources table. Sequencing of other areas with high homology to the target sequence was performed to assess that only variants in the Tubb4a gene were retained in the final mouse line. Control (WT) mice were generated from breeding pairs of heterozygous Tubb4a mice to further provide reassurance of limited of target effects in other homologous genes. We established one founder line of Tubb4a mice, which were bred to produce wild type (WT), Tubb4a, and Tubb4a mice. The animals were genotyped at all experimental steps and were maintained under a 12 hr (h) light:12 hr dark cycle in a clean facility and given free access to food and water. The methods and study protocols were approved in full by the Institutional Animal Care and Use Committee of the Children’s hospital of Philadelphia and conformed with the revised National Institutes of Health Office of Laboratory Animal Welfare Policy.

Behavioral analysis

Ambulatory angle, ambulation, hanging grip strength, righting reflex (Feather-Schussler and Ferguson, 2016), and rotarod (Shiotsuki et al., 2010) were assessed at defined developmental intervals (Figure 1C). Detailed methods are provided in SI Methods. A cohort of at least 10 animals per genotype were included for the behavioral tests.

RNA extraction, cDNA synthesis and qPCR

To determine the relative expression of Tubb4a in brain, fresh brain areas as cerebellum, cortex, hippocampus, hypothalamus, pre-frontal cortex, striatum and spinal cord were dissected at end-stage (~P35-P40) and snap frozen. RNA extraction, C-DNA and qPCR details are provided in Appendix 1.

Tissue processing

Mice were anesthetized based on weight with ketamine and xylazine and transcardially perfused with 4% paraformaldehyde (PFA) after an initial flush with 1X PBS. Brains were collected and post-fixed with 4% PFA in 1X PBS overnight, infiltrated in 30% sucrose in 1X PBS, embedded in optimal cutting temperature compound and sectioned either as coronal or sagittal (50 μm) sections on a cryostat microtome (CM 3050 s, Leica biosystems, USA).

Immunohistochemistry and image acquisition

Myelin quantification was performed by Eriochrome Cynanine (Eri-C) stain, PLP and MBP in the densely myelinated region- corpus callosum (Baxi et al., 2017) and cerebellum. Eriochrome Cynanine (Eri-C) and neurofilament staining was according to previously published protocols (Sahinkaya et al., 2014) (Appendix 1). For Nissl staining, frozen sections were stained with 0.1% cresyl violet for 15 min, rinsed with PBS, dehydrated with graded alcohols (from 70–100%), followed by xylene, and mounted with Permount. For immunofluorescence staining, free floating sections were blocked with 2% bovine serum albumin and 0.1% Triton X-100 for 1 hr at room temperature and then sequentially incubated with primary antibodies overnight at 4°C and the fluorescent secondary antibodies for 1 hr at room temperature. Primary antibodies are listed in the Key Resource Table above. AlexaFluor-488 or AlexaFluor-647 conjugated secondary antibodies against rabbit, mouse, or rat (1:1000; Invitrogen) were used, and nuclei were counterstained with DAPI. Image acquisition and image quantification details are provided in the SI.

Immunoblotting

To determine the relative levels of key myelin proteins in the affected regions of our mouse model and corresponding to areas of disease in H-ABC, immunoblotting was performed on cerebellum and forebrain at post-natal (P)14, P21, and end-stage (~P35-P40). The details of immunoblotting are explained in SI.

Electron microscopy (EM)

A separate cohort of mice were perfused transcardially with 0.9% saline followed by 2% PFA and 2% glutaraldehyde in 0.1M phosphate buffer (PB; pH 7.4) at end-stage (~day 35) (n = 3/group) (Lancaster et al., 2018). The optic nerve and cervical spinal cord were examined as they are highly myelinated and routinely used for studying myelin ultrastructure (Lancaster et al., 2018). The optic nerve and cervical spinal cord were dissected, post-fixed for 24 hr, rinsed in 0.1M PB, transferred to 2% OsO4 in 0.1M PB for 1 hr, then processed for embedding in Epon (Lancaster et al., 2018). Semi-thin sections were cut, stained with alkaline toluidine blue, and visualized using a light microscope (Lecia DMR) interactive software (Leica Application Suite). Ultra-thin sections (70 nm) were cut, stained with lead citrate and uranyl acetate, and imaged using Jeol-1010 transmission electron microscope. The images for EM sections were assessed using Image J software and the inner and outer axonal area was measured for g-ratio analysis and quantified in 50 axons per animal with n = 3 per group as previously published (Lancaster et al., 2018). The axons were classified as normally myelinated, unmyelinated axons (no myelin detected) or thinly myelinated (compared to normal WT tissue) in WT, Tubb4a and Tubb4a optic nerves (n = 3/group). The percentage of these three groups were plotted and the data was analyzed.

Oligodendrocyte cultures

Primary oligodendrocyte precursor cells (OPCs) were isolated from cerebral cortices of WT, Tubb4a and Tubb4a mice between postnatal day P4-P7 using the Miltenyl anti-O4 microbeads (Flores-Obando et al., 2018) (Appendix 1). O4+ cells were plated at the density of 20,000 OPCs per well of a 24 well plate, allowed to proliferate for 5–7 days, following which they were differentiated in the media without platelet-derived growth factor and basic fibroblast growth factor and with thyroxine T4 (20 μg/ml) for another 5 days. The cells were then fixed with 4% PFA, washed twice with 1X PBS, permeabilized with 0.2% Triton X-100, blocked in 10% normal goat serum solution for 1 hr, and incubated overnight at 4°C with primary antibodies – rabbit anti-Olig2 (1:800; EMD Millipore, Cat: AB9610), rat anti-PLP (1:1), mouse anti-A2B5 (1:1), rabbit anti-Caspase3 (1:200) and rat anti-MBP (1:1) (IDDRC hybridoma, courtesy Dr. Judith Grinspan). The cells were washed the next day in PBS, and incubated with the appropriate secondary fluorescent antibodies (1:500; anti-rat IgG Alexa Fluor 488, anti-rabbit IgG Alexa Fluor 647; 1:500; anti-mouse IgM Alexa Fluor 488), mounted in Prolong gold antifade reagent (Thermo Fisher Scientific), and imaged using a Nikon microscope with 20 × or 40 × objectives for analysis of cellular counts. Each experiment was repeated at least three separate times and based on the litters, 1–3 pups of the same genotype were used with technical replicate of n = 3/ pup for each experiment.

Cortical neuron cultures

Primary cortical neurons were isolated from E15.5 embryos of WT, Tubb4a, and Tubb4a mice as described previously (Guedes-Dias et al., 2019). In brief, the cortex was dissected from each embryo and washed with Hanks' Balanced Salt Solution (HBSS), then 2.5% trypsin was added to each sample and incubated at 37°C for seven mins. The trypsin was removed and washed four times with fresh warm HBSS and then resuspended in attachment medium (described in SI). The cells were dissociated and plated on poly-L-lysine (PLL) coated MatTek dishes at a density of 150,000 cells/plate for imaging and 100,000 cells/well of a 24 well plate. The medium was changed after 4 hr to pre-equilibrated maintenance media (described in SI). After 3 days, 20–30% of the medium was replaced with fresh medium supplemented with the mitotic inhibitor 1 μM Cytosine arabinoside. The neurons were plated at equal densities for all genotypes in 24-well plate were assessed for cell survival, axonal and dendritic length at 1 week post-plating. Neurons were immunostained with anti-microtubule associated protein (MAP2; 1:200; Sigma, Cat: 1406) and anti- Neuron-specific Class III β-tubulin (TuJ1; 1:200; Abcam, Cat: ab18207), labelled by appropriate secondary fluorescent antibodies (1:500; anti-rat IgG Alexa Fluor 488, anti-rabbit IgG Alexa Fluor 647), and imaged using a Nikon microscope with at 20 × or 40 × objective for cellular counts and measuring axonal and dendritic length using the Neurite tracer plugin in FiJi software. Each experiment was repeated at least three separate times and based on the litters, 1–3 pups of the same genotype were used with technical replicate of n = 3/ pup for each experiment.

Live-Imaging of EB3 dynamics

On day in vitro (DIV) 6, cortical neurons were transfected with end-binding protein 3 (EB3) -mCherry using Lipofectamine 2000 (Invitrogen). 20–24 hr after transfection, maintenance medium was exchanged to low fluorescence Hibernate E imaging medium (BrainBits) supplemented with 2% B27 and 2 mM GlutaMAX. The neurons were imaged in an environmental chamber at 37°C on a PerkinElmer UltraView Vox Spinning Disk Confocal system with a Nikon Eclipse Ti inverted microscope using a Plan Apochromat 60 × 1.40 NA oil immersion objective. Axons were identified by established morphological criteria and images were acquired with a Hamamatsu EMCCD C9100-50 camera driven by Volocity software (PerkinElmer) at a rate of 2 s per frame for 600 s. Quantification of EB3 dynamics was performed as previously described (Guedes-Dias et al., 2019). The ImageJ macro toolset KymoClear was used to generate kymographs (Mangeol et al., 2016). The KymoClear toolset passes a Fourier filter on the original kymograph allowing for automated discrimination of anterograde, retrograde or static components and improves the signal-to-noise ratio of EB3 comets without affecting quantitative analysis of the data. The tracks of individual EB3 comets were manually traced using a custom MATLAB GUI (Kymograph Suite) and used to determine run-length, run-time, and velocity of each comet. The investigator was blinded for the neuronal genotype during both image acquisition and kymograph analysis. Each experiment was repeated at least three separate times and based on the litters, 1–3 pups of the same genotype were used with technical replicate of n = 3/ pup for each experiment.

Statistical analysis

All graph data are presented as the mean ± standard error mean (SEM). For mouse studies, ‘n’ represents the number of animals used per experiment unless indicated otherwise. Gait abnormalities, righting reflex, rotarod, and weight assessments were analyzed by two-way ANOVA with repeated measures followed by the post-hoc Tukey test. For grip strength and ambulation, one-way ANOVA with post-hoc Tukey test was performed. Survival was analyzed by the Kaplan-Meier method, and the differences between groups were estimated by the Gehan-Breslow-Wilcoxon test. Comparisons in myelin quantification, NeuN, ASPA, NG2, Olig2, Ki-67 and cleaved caspase three counts and fluorescent intensity were analyzed by ordinary two-way ANOVA with multiple comparisons post-hoc Tukey tests. EM analysis for G-ratio and axon diameter was conducted using one-way ANOVA with the post-hoc Tukey test and the % myelin analysis was conducted with two-way ANOVA followed by post-hoc Tukey test. Neuronal survival, axon and dendritic length, and assessment of OL markers examined in vitro were compared using one-way ANOVA with the post-hoc Tukey test. EB3 dynamics in neurons were analyzed using Kruskal-Wallis test and Dunn’s multiple comparisons test. All statistical analyses were performed using Prism 7.0 (GraphPad Software) with p<0.05 considered statistically significant. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Acceptance summary: This work describes the generation and characterization of a novel knock-mouse model for H-ABC leukodystrophy. Of note, this mouse model carries the most common human TUBB4A mutation. This model demonstrates that defects in oligodendrocyte, loss of oligodendrocytes and neurons in specific brain regions, and oligodendrocyte dysfunction in microtubule dynamics underlie H-ABC pathogenesis. This mouse model represents a seminal resource that will lead to increased understanding of this rare leukodystrophy. Decision letter after peer review: Thank you for submitting your manuscript "TUBB4A mutations result in both glial and neuronal degeneration in an H-ABC leukodystrophy mouse model" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Huda Zoghbi as Senior Editor. The reviewers and the Reviewing Editor drafted this decision letter to help you prepare a revised submission. Summary The results presented describe the generation and characterization of a novel knock-mouse model for H-ABC leukodystrophy. Importantly, the mouse model harbors the most common human TUBB4A mutation. This model demonstrates that oligodendrocyte maturation defects, loss of oligodendrocytes and neurons in specific brain regions, and dysfunction in microtubule dynamics underlie H-ABC pathogenesis. Overall, the model is well characterized and will provide significant benefit to future studies of pathogenic mechanisms of H-ABC eukodystrophy. Thus, this mouse model represents a significant resource and should lead to increased understanding of this rare leukodystrophy and a platform for discovery of potential therapeutics. Essential revisions: 1) Provide details of guide RNA and donor selection and sequence. There also should be discussion or data on potential CRISPR off-targets, especially with a single founder animal. 2) Better synchrony, or at least messaging of rationale, for some of the analyses would help significantly. For OLs in particular it's not clear why OL counts are in one region, EM in another, cell death markers in another, and then in vitro OPC isolation in another. 3) The rationale and conclusions of the in vitro studies need clarified. For neurons, the use of fetal cortical neurons seems disconnected from disease pathology. Additionally, it's not clear if the modest difference in mutant neurons numbers originate from differences in neuron initial numbers, plating survival, or actual survival during the assay period. If cell number/density differences exist between genotypes that could impact the other measurements. For in vitro OL studies, because a single time point was used the claim of a defect in differentiation efficiency (vs. early cell death with proliferation remaining OPCs) needs more support. Essential revisions: 1) Provide details of guide RNA and donor selection and sequence. There also should be discussion or data on potential CRISPR off-targets, especially with a single founder animal. The gRNA, donor selection and sequence are now provided in the Key resources table. Additional information is also provided in Materials and methods. Known off-target effects include one synonymous mutation in cis with the pathogenic variant at p.Asp249Asn (variant at c.745G>A). This variant is at c.732C>A (GGC>GGA which both encode lysine) and is now discussed in the Materials and methods section. Specifically, the following text has been added in Materials and methods and Results sections: “Heterozygous Tubb4aD249N mice were generated using CRISPR – Cas-9 technology by inserting the p.Asp249Asn (c.745G>A) mutation in exon 4 of the Tubb4a gene. Cas9 mRNA, gRNA and oligonucleotides (with targeting sequence, flanked by 120bp homologous combined on both sides) were co-injected into zygotes of C57BL/6 mouse. Following is the gRNA sequence used- gRNA1 (matches forward strand of gene): CAATGCAGATCTACGCAAGCTGG gRNA2 (matches reverse strand of gene): TGCGTAGATCTGCATTGAGCTGG The resulting CRISPR knock-in mouse model had the heterozygous point mutation of c.745G>A in one allele of the Tubb4a gene (Tubb4aD249N). Known off-target effects include one synonymous mutation in cis at p.Lys244Lys (c.732C>A) with the pathogenic variant at p.Asp249Asn (variant at c.745G>A).” “Sequencing of other areas with high homology to the target sequence was performed and only the above sequence variants were retained in the final mouse line. Additionally, the control WT line was generated by breeding heterozygous mice and these are phenotypically normal, adding greater confidence in the specificity of the final mouse line.” 2) Better synchrony, or at least messaging of rationale, for some of the analyses would help significantly. For OLs in particular it's not clear why OL counts are in one region, EM in another, cell death markers in another, and then in vitro OPC isolation in another. The approaches used are standardized to specific regions. For example, analysis of the corpus callosum is generally used to assess histologic parameters of myelination. Similarly, EM was conducted in myelin rich regions such as the optic nerve or spinal cord as these are routinely examined for studying myelin ultrastructure. OPC isolation was performed as a secondary validation of OL lineage studies, which is typically performed with cerebral cortices. We have now been added previously published references for these established methodologies for clarity. Specifically, details have been added in the Materials and methods sections in the main text under EM, immunohistochemistry and oligodendrocyte culture sections to clarify our approaches. Finally, in some circumstances we used other structures for validation (e.g. the cerebellum) because these regions are known to be affected in H-ABC. 3) The rationale and conclusions of the in vitro studies need clarified. For neurons, the use of fetal cortical neurons seems disconnected from disease pathology. Additionally, it's not clear if the modest difference in mutant neurons numbers originate from differences in neuron initial numbers, plating survival, or actual survival during the assay period. If cell number/density differences exist between genotypes that could impact the other measurements. For in vitro OL studies, because a single time point was used the claim of a defect in differentiation efficiency (vs. early cell death with proliferation remaining OPCs) needs more support. We agree with the reviewers and have provided additional clarification around these points. We have added references around the use of fetal neurons to generate in vitro models, which is an accepted protocol in the field. We have additionally clarified that neurons were counted prior to plating (at similar densities) and that data that is shown represents actual survival as an endpoint of the assay, and documents 1-week survival across all cohorts. Specifically, the following text has been added in the Materials and methods section: “The neurons were plated at equal densities for all genotypes in 24-well plate were assessed for cell survival, axonal and dendritic length at 1-week post-plating.” Regarding the OL studies, we have conducted additional experiments to address the question about OPC proliferation and death, in addition to OL maturation and the data are shown in Figure 6—figure supplement 1. We have added the results under the section addressing cell autonomous effects of OPC in vitro studies. We report a significant decrease in proliferation of OPCs isolated from Tubb4aD249N and Tubb4aD249N/D249N mice compared to WT mice, however no significant cell death was observed in the different groups. We further explain in the Discussion, that while the in vitro cell-autonomous effect results in decreased proliferation with no change in cell death; in vivo effects showing increase in proliferation in the context of cell death could be due to cross-talk with other cells such as neurons and influence of the milieu. This has previously been shown in other disorders and a reference is provided.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Mus musculus) Background: C57BL/6JTubb4a Accession number: NM_009451.3Mouse model designed at CyagenMouse Tubb4a Knockin Project (CRISPR/Cas9) with p.Asn249Asn (D249N) mutationTarget region of mouse Tubb4a locus modified and D249N mutation was introduced (Tubb4aD249N/+)
Sequence-based reagentgRNA sequence 1 (Matches forward strand of Tubb4a gene)Cyagen designedCAATGCAGATCTACGCAAGCTGG
Sequence-based reagentgRNA sequence 2 (Matches reverse strand of Tubb4a gene)Cyagen designedCAATGCAGATCTACGCAAGCTGG
Mouse genotyping And Sequence based reagentsTo identify the genotype of Tubb4aD249N/+ mouseTaq-TakaraPCR forward and reverse primers and Sequencing5’CCGAGAGGAGTTTCCAGACAGACAGGATC35’GCTCTGCACACTTAACATCTGCTCG 3’
Antibodyanti- PLP (Rat monoclonal)IDDRC hybridoma, courtesy Dr. Judith GrinspanRRID:AB_2827948Dilution Used for IF: 1:1 Dilution Used for Western blot: 1:1000
Antibodyanti-MBP (Rabbit polyclonal)AbcamCat#: ab40389 RRID:AB_1141521Dilution Used for IF: 1:250 Dilution Used for Western blot: 1:1000
Antibodyanti-NG2 (Rabbit polyclonal)US biologicalCat#: C5067-70D RRID:AB_2827946Dilution Used for IF: 1:250
Antibodyanti-NG2 (Mouse monoclonal)Thermo Fisher ScientificCat#: #37–2700 RRID:AB_2533307Dilution Used for IF: 1:100
Antibodyanti-Olig2 (Rabbit polyclonal)MilliporeCat#: MABN50 RRID:AB_10807410Dilution Used for IF: 1:100
Antibodyanti-NeuN (Mouse monoclonal)MilliporeCat#: MAB377 RRID:AB_2298772Dilution Used for IF: 1:100
Antibodyanti-cleaved Caspase 3 (Rabbit polyclonal)Cell signalingCat#: #9579 RRID:AB_10897512Dilution Used for IF: 1:100
Antibodyanti- Ki-67 (Rabbit polyclonal)Thermo Fisher ScientificCat#: #RM9106S0 RRID:AB_2341197Dilution Used for IF: 1:100
Antibodyanti-calbindin (Rabbit polyclonal)SwantCat#: CB38 RRID:AB_2721225Dilution Used for IF: 1:250
Antibodyanti-A2B5 (Mouse monoclonal)IDDRC hybridoma, courtesy Dr. Judith GrinspanRRID:AB_2827951Dilution Used for IF: 1:1
Antibodyanti-MAP2 (Mouse monoclonal)SigmaCat#: 1406 RRID:AB_477171Dilution Used for IF: 1:200
Antibodyanti-Tuj1 (Mouse monoclonal)AbcamCat#: ab18207 RRID:AB_444319Dilution Used for IF: 1:200
Transfected construct (Mouse)end-binding protein 3 (EB3) -mCherryObtained by Dr. Erika Holzbaur(Guedes-Dias et al., 2019)
qRT-PCR primerTubb4a PrimersIntegrated DNA TechnologiesCustom DesignedTubb4a primer: Probe: 5’-/5FAM/ATGACCTCC/ZEN/CAGAACTTGGCCC/3IABkFQ /- 3’ Primer 1: 5’GACACCCGTCCATCAGCA3Primer 2: 5’GTCGATGCCGTGCTCAT-3’
qRT-PCR primersfrs9 PrimersIntegrated DNA TechnologiesCustom DesignedProbe: 5’-/5HEX/CAGACATCC/ZEN/CCAGCTTCTCGCAT/3IABkFQ /- 3’ Primer 1: 5’TTCAACCATCCCCATTCCG-3’ Primer 2: 5’CCTCCTACAACAAGACGGTCAGAT-3’
SoftwareGraphpad PrismGraphpad PrismGraphpad Prism 9 RRID:SCR_002798
OtherDAPI stainInvitrogenCat#: P369311 µg/mL
  49 in total

1.  Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).

Authors:  G E Truett; P Heeger; R L Mynatt; A A Truett; J A Walker; M L Warman
Journal:  Biotechniques       Date:  2000-07       Impact factor: 1.993

2.  Visualization of microtubule growth in cultured neurons via the use of EB3-GFP (end-binding protein 3-green fluorescent protein).

Authors:  Tatiana Stepanova; Jenny Slemmer; Casper C Hoogenraad; Gideon Lansbergen; Bjorn Dortland; Chris I De Zeeuw; Frank Grosveld; Gert van Cappellen; Anna Akhmanova; Niels Galjart
Journal:  J Neurosci       Date:  2003-04-01       Impact factor: 6.167

3.  DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1.

Authors:  L A Jerome; V E Papaioannou
Journal:  Nat Genet       Date:  2001-03       Impact factor: 38.330

4.  An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.

Authors:  Ye Zhang; Kenian Chen; Steven A Sloan; Mariko L Bennett; Anja R Scholze; Sean O'Keeffe; Hemali P Phatnani; Paolo Guarnieri; Christine Caneda; Nadine Ruderisch; Shuyun Deng; Shane A Liddelow; Chaolin Zhang; Richard Daneman; Tom Maniatis; Ben A Barres; Jian Qian Wu
Journal:  J Neurosci       Date:  2014-09-03       Impact factor: 6.167

5.  Prominent oligodendrocyte genesis along the border of spinal contusion lesions.

Authors:  Richa Tripathi; Dana M McTigue
Journal:  Glia       Date:  2007-05       Impact factor: 7.452

6.  Expansion of the spectrum of TUBB4A-related disorders: a new phenotype associated with a novel mutation in the TUBB4A gene.

Authors:  Lubov Blumkin; Ayelet Halevy; Dominique Ben-Ami-Raichman; Dvir Dahari; Ami Haviv; Cohen Sarit; Dorit Lev; Marjo S van der Knaap; Tally Lerman-Sagie; Esther Leshinsky-Silver
Journal:  Neurogenetics       Date:  2014-02-14       Impact factor: 2.660

7.  TUBB4A de novo mutations cause isolated hypomyelination.

Authors:  Amy Pizzino; Tyler Mark Pierson; Yiran Guo; Guy Helman; Sebastian Fortini; Kether Guerrero; Sulagna Saitta; Jennifer Louise Patrick Murphy; Quasar Padiath; Yi Xie; Hakon Hakonarson; Xun Xu; Tara Funari; Michelle Fox; Ryan J Taft; Marjo S van der Knaap; Geneviève Bernard; Raphael Schiffmann; Cas Simons; Adeline Vanderver
Journal:  Neurology       Date:  2014-08-01       Impact factor: 9.910

8.  TUBB4A mutations result in specific neuronal and oligodendrocytic defects that closely match clinically distinct phenotypes.

Authors:  Julian Curiel; Guillermo Rodríguez Bey; Asako Takanohashi; Marianna Bugiani; Xiaoqin Fu; Nicole I Wolf; Bruce Nmezi; Raphael Schiffmann; Mona Bugaighis; Tyler Pierson; Guy Helman; Cas Simons; Marjo S van der Knaap; Judy Liu; Quasar Padiath; Adeline Vanderver
Journal:  Hum Mol Genet       Date:  2017-11-15       Impact factor: 6.150

9.  Mutations in the autoregulatory domain of β-tubulin 4a cause hereditary dystonia.

Authors:  Joshua Hersheson; Niccolo E Mencacci; Mary Davis; Nicola MacDonald; Daniah Trabzuni; Mina Ryten; Alan Pittman; Reema Paudel; Eleanna Kara; Katherine Fawcett; Vincent Plagnol; Kailash P Bhatia; Alan J Medlar; Horia C Stanescu; John Hardy; Robert Kleta; Nicholas W Wood; Henry Houlden
Journal:  Ann Neurol       Date:  2013-02-19       Impact factor: 10.422

10.  Constitutional mislocalization of Pten drives precocious maturation in oligodendrocytes and aberrant myelination in model of autism spectrum disorder.

Authors:  Hyunpil Lee; Stetson Thacker; Nicholas Sarn; Ranjan Dutta; Charis Eng
Journal:  Transl Psychiatry       Date:  2019-01-17       Impact factor: 6.222

View more
  7 in total

1.  Secreted Amyloid Precursor Protein Alpha, a Neuroprotective Protein in the Brain Has Widespread Effects on the Transcriptome and Proteome of Human Inducible Pluripotent Stem Cell-Derived Glutamatergic Neurons Related to Memory Mechanisms.

Authors:  Katie Peppercorn; Torsten Kleffmann; Owen Jones; Stephanie Hughes; Warren Tate
Journal:  Front Neurosci       Date:  2022-05-26       Impact factor: 5.152

Review 2.  Hypomyelinating leukodystrophies - unravelling myelin biology.

Authors:  Nicole I Wolf; Charles Ffrench-Constant; Marjo S van der Knaap
Journal:  Nat Rev Neurol       Date:  2020-12-15       Impact factor: 42.937

3.  A dominant tubulin mutation causes cerebellar neurodegeneration in a genetic model of tubulinopathy.

Authors:  Sofia Fertuzinhos; Emilie Legué; Davis Li; Karel F Liem
Journal:  Sci Adv       Date:  2022-02-16       Impact factor: 14.136

4.  H-ABC tubulinopathy revealed by label-free second harmonic generation microscopy.

Authors:  Milvia Alata; Valeria Piazza; Carla Jaramillo-Restrepo; Jose R Eguibar; Carmen Cortes; Victor H Hernandez
Journal:  Sci Rep       Date:  2022-08-24       Impact factor: 4.996

Review 5.  Emerging cellular themes in leukodystrophies.

Authors:  Joseph C Nowacki; Ashley M Fields; Meng Meng Fu
Journal:  Front Cell Dev Biol       Date:  2022-08-08

Review 6.  Microtubule Dysfunction: A Common Feature of Neurodegenerative Diseases.

Authors:  Antonella Sferra; Francesco Nicita; Enrico Bertini
Journal:  Int J Mol Sci       Date:  2020-10-05       Impact factor: 5.923

7.  H-ABC- and dystonia-causing TUBB4A mutations show distinct pathogenic effects.

Authors:  Victor Krajka; Franca Vulinovic; Mariya Genova; Kerstin Tanzer; A S Jijumon; Satish Bodakuntla; Stephanie Tennstedt; Helge Mueller-Fielitz; Britta Meier; Carsten Janke; Christine Klein; Aleksandar Rakovic
Journal:  Sci Adv       Date:  2022-03-11       Impact factor: 14.136

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.