| Literature DB >> 32457795 |
Faiza Hina1, Gulbar Yisilam1, Shenyi Wang2, Pan Li1, Chengxin Fu1.
Abstract
The moonseed genus Menispermum L. (Menispermaceae) is disjunctly distributed in East Asia and eastern North America. Although Menispermum has important medicinal value, genetic and genomic information is scarce, with very few available molecular markers. In the current study, we used Illumina transcriptome sequencing and de novo assembly of the two Menispermum species to obtain in-depth genetic knowledge. From de novo assembly, 53,712 and 78,921 unigenes were generated for M. canadense and M. dauricum, with 37,527 (69.87%) and 55,211 (69.96%) showing significant similarities against the six functional databases, respectively. Moreover, 521 polymorphic EST-SSRs were identified. Of them, 23 polymorphic EST-SSR markers were selected to investigate the population genetic diversity within the genus. The newly developed EST-SSR markers also revealed high transferability among the three examined Menispermaceae species. Overall, we provide the very first transcriptomic analyses of this important medicinal genus. In addition, the novel microsatellite markers developed here will aid future studies on the population genetics and phylogeographic patterns of Menispermum at the intercontinental geographical scale.Entities:
Keywords: Illumina high-seq transcriptome; Menispermum; Menispermum canadense; Menispermum dauricum; de novo assembly EST-SSR; population genetic diversity
Year: 2020 PMID: 32457795 PMCID: PMC7227793 DOI: 10.3389/fgene.2020.00380
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Summary of de novo transcriptome assembly of Menispermum canadense and M. dauricum.
| Raw reads | Total raw reads (M) | 57.15 | 53.79 |
| Total clean reads (M) | 44.60 | 45.22 | |
| Total Clean bases (Gb) | 6.69 | 6.78 | |
| Clean reads Q20 (%) | 97.09 | 98.09 | |
| Clean reads Q30 (%) | 92.15 | 94.83 | |
| Transcripts | Total number of transcripts | 86,883 | 104,064 |
| Total length of transcripts (bp) | 69,428,938 | 98,356,172 | |
| Mean length of transcripts (bp) | 799 | 945 | |
| N50 value of transcripts | 1,431 | 1,528 | |
| GC (%) | 42.59 | 46.36 | |
| Unigenes | Total number of unigenes | 53,712 | 78,921 |
| Total length of unigenes (bp) | 49,461,581 | 77,153,863 | |
| Mean length unigenes (bp) | 920 | 978 | |
| N50 value of unigenes | 1,519 | 1,583 | |
| GC (%) | 42.50 | 45.18 |
FIGURE 1Length distribution of all unigenes in Menispermum canadense (MC) and M. dauricum (MD). The x-axis represents the lengths of all the unigenes, and the y-axis represents the numbers of unigenes with certain length.
Unigenes functional annotation summary of Menispermum canadense and M. dauricum, against 6 functional databases.
| Number | 53,712 | 35,842 | 24,302 | 23,262 | 26,198 | 27,264 | 17,110 | 37,527 |
| Percentage | 100 | 66.73 | 45.25 | 43.31 | 48.77 | 50.76 | 31.86 | 69.87 |
| Number | 78,921 | 52,180 | 40,554 | 37,988 | 33,065 | 24,402 | 33,051 | 55,211 |
| Percentage | 100 | 66.12 | 51.38 | 48.13 | 41.90 | 30.92 | 41.88 | 69.96 |
FIGURE 2Characteristics of homology analysis in Menispermum unigenes against the non-redundant protein database with an E-value of 10–5. (A) Species based distribution of the top BLASTx hits for 548 each assembled unigenes in M. canadense. (B) Species based distribution of the top BLASTx hits for each assembled unigenes in M. dauricum.
FIGURE 3COG analysis of the unigene sequences of Menispermum. (A) COG analysis of the unigene sequences of M. canadense. (B) COG analysis of the unigene sequences of M. dauricum. The x-axis indicates the function class while y-axis indicates the number of unigenes in specific functional group.
FIGURE 4Gene Ontology (GO classification of assembled unigenes of Menispermum. (A) A summary of GO analysis of the M. canadense. (B) Summary of GO analysis of the M. dauricum. The y-axis indicates genes in the specific categories of the three main categories while x-axis indicates the number of genes in the category.
FIGURE 5KEGG metabolic pathways of Menispermum. (A) Metabolic pathways of assembled unigenes of M. canadense. (B) Metabolic pathways of assembled unigenes of M. dauricum. The y-axis is the name of metabolic pathway, and the x-axis is the ratio of the number of the genes.
FIGURE 6Frequency and distribution of candidate polymorphic EST-SSR from the transcriptome of Menispermum canadense and M. dauricum.
Characteristics of 23 newly developed polymorphic microsatellite loci in Menispermum.
| CPSSR_1 | F: GGTTCTTGAAACGGGCTTGT | (AAAAG)5 | FAM | 159–208 | 57 | 3 | 0.157 | 0.514 | 0.424 | MK153148 |
| CPSSR_30 | F: GCGAGAACCACCTCCCTAAC | (AAG)7 | HEX | 119–161 | 55 | 6 | 0.542 | 0.689 | 0.641 | MK153146 |
| CPSSR_91 | F: CTCGCACTTGTCCTGACCTT | (AGACGA)5 | ROX | 118–178 | 57 | 4 | 0.319 | 0.635 | 0.568 | MK153147 |
| CPSSR_95 | F: TCGGTTAGTCCTCCTACGTG | (AGC)7 | TAMRA | 129–165 | 56 | 7 | 0.922 | 0.6 | 0.524 | MK153142 |
| CPSSR_157 | F: CGCTTTCCGTCACCAGTAGT | (CAA)6 | HEX | 141–183 | 57 | 2 | 0.383 | 0.493 | 0.371 | MK153138 |
| CPSSR_167 | F: AACCACTTCACCACTGCCAT | (CAG)5 | ROX | 164–194 | 55 | 3 | 0.369 | 0.593 | 0.502 | MK153145 |
| CPSSR_172 | F: CCACTCCGGTGAAGGAAGAG | (CAGCT)5 | TAMRA | 129–177 | 55 | 8 | 0.947 | 0.729 | 0.69 | MK153140 |
| CPSSR_175 | F: TGGCATGGTGTGGAAGGATC | (CAT)6 | FAM | 138–174 | 57 | 5 | 0.957 | 0.62 | 0.553 | MK153155 |
| CPSSR_177 | F: AAGACGGGCCTCATCAATCG | (CAT)8 | HEX | 128–176 | 57 | 6 | 0.283 | 0.685 | 0.624* | MK153158 |
| CPSSR_183 | F: CGTTTGATGACGCCGTTTGT | (CCA)5 | ROX | 105–135 | 57 | 5 | 0.226 | 0.516 | 0.474* | MK153150 |
| CPSSR_194 | F: AGAACTTGCTCTCGCTGGTC | (CCG)7 | TAMRA | 111–153 | 57 | 5 | 0.217 | 0.595 | 0.507 | MK153149 |
| CPSSR_201 | F: CATCCCTTGTCTGCTTCCGT | (CGC)7 | FAM | 133–175 | 55 | 8 | 0.567 | 0.634 | 0.597 | MK153139 |
| CPSSR_231 | F: GGCCATTGCTGCAGTGTTAC | (CTA)6 | FAM | 156–192 | 57 | 4 | 0.242 | 0.659 | 0.582* | MK153143 |
| CPSSR_261 | F: GGAGAAGCTCTATCCTCTCCCT | (CTTCT)7 | TAMRA | 94–165 | 57 | 4 | 0.25 | 0.635 | 0.56* | MK153157 |
| CPSSR_314 | F: GTTCCAAATTGGGCCTCTGC | (GAT)6 | FAM | 133–169 | 57 | 7 | 0.123 | 0.645 | 0.584* | MK153144 |
| CPSSR_365 | F: ACGAAGAGAAAACCGTCGCT | (GTG)5 | ROX | 113–144 | 56 | 3 | 0.368 | 0.314 | 0.266 | MK153152 |
| CPSSR_396 | F: CGACGATCTCTGCCTCGAAT | (TAC)6 | FAM | 154–190 | 57 | 5 | 0.195 | 0.591 | 0.503* | MK153137 |
| CPSSR_459 | F: ACAGGGATTTCACGGCTGAG | (TCG)6 | HEX | 109–145 | 56 | 4 | 0.179 | 0.195 | 0.181 | MK153154 |
| CPSSR_475 | F: TCCATCACTCGTCTCCTCCT | (TCT)6 | ROX | 131–167 | 57 | 4 | 0.265 | 0.598 | 0.514 | MK153159 |
| CPSSR_502 | F: TCGGTGCTGTCTCTTCTTCC | (TTA)6 | TAMRA | 162–198 | 57 | 3 | 0.059 | 0.559 | 0.469* | MK153151 |
| CPSSR_517 | F: GAGACGAAAGGGCAGAGTCC | (TTC)7 | FAM | 126–168 | 56 | 6 | 0.383 | 0.71 | 0.659* | MK153153 |
Genetic parameters of the 23 microsatellite loci within six populations of Menispermum.a
| United States – | |||||
| AR (20) | 58 | 2.62 | 0.513 | 0.377 | −0.243 |
| IA (20) | 61 | 2.82 | 0.492 | 0.388 | −0.130 |
| WI (20) | 50 | 2.29 | 0.513 | 0.444 | −0.338 |
| Regional mean | 56.33 | 2.58 | 0.506 | 0.403 | −0.237 |
| China – | |||||
| BJ (20) | 75 | 3.41 | 0.288 | 0.450 | 0.381* |
| AH (20) | 40 | 1.80 | 0.208 | 0.165 | −0.239 |
| ZJ (20) | 43 | 1.99 | 0.245 | 0.227 | −0.052 |
| Regional mean | 52.67 | 2.40 | 0.247 | 0.281 | −0.146 |
| Total mean | 54.50 | 2.49 | 0.377 | 0.342 | −0.198 |