Literature DB >> 32457617

BRD4 Inhibition Protects Against Acute Pancreatitis Through Restoring Impaired Autophagic Flux.

Shuangjun Shen1,2, Bin Li1,2, Juanjuan Dai1,2, Zengkai Wu1,2, Yan He1,2, Li Wen1,2, Xingpeng Wang1,2, Guoyong Hu1,2.   

Abstract

Impaired autophagy has been shown to play a critical role in experimental and human acute pancreatitis (AP). However, the mechanism for transcriptional regulation of autophagy remains largely unknown. In this study, we aim to explore the role of BRD4 (bromodomain-containing protein 4), a transcriptional repressor of autophagy, during AP. Changes in pancreatic BRD4 expression and the effect of BRD4 inhibition were measured in mice with AP (induced by caerulein and ethanol and palmitoleic acid) and in isolated pancreatic acinar cells stimulated with cholecystokinin (CCK). Pancreatitis severity was evaluated by serum amylase and pancreatic histopathology. The autophagic flux, the fusion of autophagosome and lysosome, and lysosomal degradation were evaluated. Sirtuin 1 (SIRT1) expression and the effect of SIRT1 inhibition were assessed. We found that pancreatic BRD4 expression was upregulated during various models of AP. BRD4 inhibition reduced CCK-stimulated pancreatic acinar cell injury and pro-inflammatory expression in vitro and protected against two models of experimental AP. Mechanistically, BRD4 inhibition restored impaired autophagic flux via promoting autophagosome-lysosome fusion and lysosomal degradation. BRD4 inhibition also upregulated SIRT1 and inhibition of SIRT1 reversed the effects of BRD4 inhibition on autophagic flux. Our data suggest that BRD4 is a potential therapeutic target for treating AP.
Copyright © 2020 Shen, Li, Dai, Wu, He, Wen, Wang and Hu.

Entities:  

Keywords:  BRD4; SIRT1; acute pancreatitis; autophagic flux; lysosomal degradation

Year:  2020        PMID: 32457617      PMCID: PMC7227015          DOI: 10.3389/fphar.2020.00618

Source DB:  PubMed          Journal:  Front Pharmacol        ISSN: 1663-9812            Impact factor:   5.810


Introduction

Acute pancreatitis (AP) is an inflammatory disease of the exocrine pancreas, which is closely related to high morbidity and mortality, and has an increasing incidence in recent years worldwide (Pandol et al., 2007; Habtezion et al., 2019). Currently, there is no effective treatment that can change the pathological process of the disease (Vege et al., 2018). Autophagy is an essential cellular process which can degrade defective cellular proteins and recycle useful components (Parzych and Klionsky, 2014). In experimental pancreatitis, impaired autophagy is due to the disability of lysosomes to degrade cargo and a consequent increase in the formation of autophagosomes (Gukovskaya et al., 2017; Habtezion et al., 2019). Studies focusing on autophagy related genes knockout mice models revealed the mechanistic role of autophagy in maintaining the homeostasis of pancreas and the pathogenesis of AP. Autophagy genes (Atg) 5 and Atg7 knockout mice developed pancreatitis and extensive fibrosis (Antonucci et al., 2015; Diakopoulos et al., 2015). In addition, the impaired lysosomal function, for example in lysosomal-associated membrane protein 2 (LAMP2) deficient mice, leading to pancreatic inflammation and acinar cell degeneration. Furthermore, LAMP2 deficiency also increased the severity of experimental pancreatitis (Mareninova et al., 2015). All these findings showed the essential role of impaired autophagy in the development of AP, suggesting pharmacologic approaches to enhance autophagy efficiency may be of great importance to treat AP. Bromodomain-containing protein 4 (BRD4) is a member of the Bromo- and Extra-Terminal domain (BET) family proteins with two N-terminal bromodomains and an extra-terminal domain (Shi and Vakoc, 2014; Hogg et al., 2017). BRD4 plays a crucial role in regulating gene transcription during cellular proliferation and differentiation processes (Shi and Vakoc, 2014; Jiang et al., 2017). Moreover, BRD4 has been recently identified to repress autophagy and lysosomal genes transcription by binding to the promoter regions (Sakamaki et al., 2017). BRD4 inhibition can enhance autophagic flux and lysosomal function, thus promoting the degradation of pathogenic proteins (Sakamaki et al., 2017). However, the role of BRD4 in the pathogenesis of AP remains undetermined. Therefore, we aim to explore the role of BRD4 using experimental models of pancreatitis. Firstly, we found that BRD4 is upregulated in various models of AP. Inhibition of BRD4 by JQ1 protected against pancreatic acinar cell injury induced by cholecystokinin (CCK). Furthermore, inhibition or knockdown of BRD4 restored impaired autophagic flux via enhancing autophagosome-lysosome fusion and lysosomal degradation. Interestingly, BRD4 did not alter the initiation of autophagy in pancreatic acinar cells. In addition, BRD4 inhibition upregulated SIRT1 and inhibition of SIRT1 reversed the effects of BRD4 inhibition on autophagic flux, suggesting that inhibition of BRD4 via upregulating SIRT1 exerted its effects on autophagy. Finally, we showed that BRD4 inhibition also protected against two clinically representative models of AP through restoring impaired autophagy in vivo.

Materials and Methods

Chemicals and Reagents

Caerulein (CER) (#HY-A0190) was purchased from MedChemExpress (Monmouth Junction, NJ). Palmitoleic acid (POA), CCK, L-Arginine (L-Arg), and Na taurocholate (NaT) were purchased from Sigma-Aldrich Chemical (St. Louis, MO, USA). BSA was purchased from Yeasen (Shanghai, China). JQ1, EX527 were purchased from Selleck Chemicals (Houston, TX, USA). Antibodies against microtubule associated protein 1 light chain 3 beta (LC3B) (#3868S), p62 (#23214S), ATG14 (#96752S), cathepsin B (#31718S), AMP activated protein kinase (AMPK) (#5831T), phosphorylated AMPK (#2535T), mammalian target of rapamycin (mTOR) (#2983T), phosphorylated mTOR (#5536T), β-actin (#3700s) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibody against Amylase (#sc46657) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Antibodies against BRD4 (#ab128874), LAMP2 (#ab203224), syntaxin 17 (STX17) (#ab229646), cathepsin L (#ab6314) were purchased from Abcam (Cambridge, MA, USA). Antibody against CD45 (#550539) were purchased from BD Biosciences (Franklin, NJ, USA).

Animals

All experiments involving animals were approved by the Institutional Animal Care and Research Ethics Committee of Shanghai Jiao Tong University School of Medicine (SYXK 2013–0050, Shanghai, China) and carried out in accordance with the guidelines of the National Institute of Health for the Care and Use of Laboratory Animals. Male C57BL/6 mice (6–8 weeks, 20–22 g) were purchased from Shanghai SLAC Laboratory Animal Co Ltd (Shanghai, China). All mice were housed under specific pathogen-free environment with controlled temperature (23 ± 1°C), 12 h light-dark cycle, humidity of 40–70% and free access to water and standard rodent diet. Mice were randomly allocated into groups for all the in vivo studies (n = 5 per group).

Isolation and Treatments of Mouse Pancreatic Acinar Cells

Pancreatic acinar cells were prepared by collagenase digestion, as described previously (Wen et al., 2018). Isolated pancreatic acinar cells were incubated at 37°C in DMEM/F-12 medium containing 10% fetal bovine serum with or without CCK or BRD4 inhibitor (JQ1) or chloroquine (CQ) (Sigma, #C6628) or SIRT1 inhibitor (EX527). For viral transduction, cells were infected with 107 plaque forming unit per ml adenovirus 24 h before stimulation. The siRNA sequence used for viral transduction is CCATGGATATGGGAACAAT (#1), GCCTCCAAAGAAGGATGTA (#2), GCCTGAAGAGCCAGTTGTT (#3), and TTCTCCGAACGTGTCACGT (Negative Control).

ATP Measurement

ATP levels in acinar cells were detected by using the Cell Titer Glo Luminescent Cell Viability Assay kit (Promega, Madison, WI) according to the manufacturer’s instructions, as previously described (Han et al., 2017). In brief, cells (3.0 × 106/ml) were treated with JQ1 (500 nmol/L) for 1 h, prior to CCK (200 nmol/L) treatment for 4 h. After the treatment, add 100 ul cell suspension into 96-well culture plate. Then add the ATP depletion reagents, and detect the level of bioluminescence using a Synergy multifunctional Microplate Reader (Gene Company Ltd, China). Data were normalized to protein concentration for each sample, then normalized to the untreated controls as 100%.

Assessment of PI Uptake

Isolated pancreatic acinar cells (3.0 × 106 per ml) were treated with JQ1 (500 nmol/L) for 1 h, prior to CCK (200 nmol/L) treatment for 4 h. Then cells were treated with propidium iodide (PI; 1 μmol/ml) for 5 min and the fluorescent intensity (excitation 536, emission 617), as PI uptake by the cells, was detected using a Synergy multifunctional Microplate Reader. Then 10 µl of 25% Triton-X100 (Sigma, #T8787) was added into the cells, and shake for 10 min and the fluorescent intensity (excitation 536, emission 617) was measured, as total amount of the cells. The percentage of PI uptake was calculated by Read 1 dividing Read 2 (% PI uptake = Read 1/Read 2 ×100).

Measurement of LDH Release

Detecting necrosis in pancreatic acinar cells was used the method of determining LDH released into the cultured medium, as reported earlier (Gukovskaya et al., 1997; Mareninova et al., 2006; Sung et al., 2009). In brief, cells (3.0 × 106/ml) were treated with JQ1 (500 nmol/L) for 1 h, prior to CCK (200 nmol/L) treatment for 4 h. LDH release was measured using LDH Cytotoxicity Assay Kit (Beyotime, Shanghai, China. C0017) according to the manufacturer’s instructions. The absorbance at 490 nm was detected by using Microplate Reader (BioTek Instruments, USA).

LysoTarcker Red Staining

Isolated pancreatic acinar cells (3.0 × 106/ml) were treated with JQ1 (500 nmol/L) for 1 h, prior to CCK (200 nmol/L) treatment for 4 h and then were harvested. After incubating with 500 μl of pre-warmed medium containing 75 nmol/L LysoTracker Red DND-99 dye (excitation 577 nm, emission 590 nm; 40739ES50, Yeasen, China) for 1 h, cells were washed and resuspended with Hoechst 33528 (40730ES10, Yeasen, China) for 15 min at 37°C. Lysosomal function was imaged by confocal imaging (Leica, Wetzlar, Germany).

Measurement the Activities of Cathepsin B and Cathepsin L

The activities of cathepsin B and cathepsin L were measured by the Cathepsin B Assay Kit (Abcam, #ab65300) and Cathepsin L Activity Assay Kit (Abcam, #ab65306), respectively, according to the manufacturer’s instructions. Briefly, isolated pancreatic acinar cells (3.0 × 106/ml) were pre-treated with JQ1 (500 nmol/L) with or without 10 μmol/L EX527 for 1 h, prior to CCK (200 nmol/L) stimulation for 4 h. The cell lysate and reaction buffer were added to a 96‐well black plate (Block Plate, WHB, Shanghai, China). The fluorescent intensity (excitation 400, emission 505) for both was detected using a Synergy multifunctional Microplate Reader.

Induction of Experimental Acute Pancreatitis

CER hyperstimulation pancreatitis was induced by ten hourly intraperitoneal injections of CER (100 μg/kg) (Lerch and Gorelick, 2013). Controls received similar injections of physiologic saline. JQ1 (20 mg/kg) was injected via tail vein 1 h before the first injection of CER. Mice were anesthetized by pentobarbital sodium (1.5%, w/v) 12 h after the first injection of CER, then blood and pancreas were collected. Fatty acid ethyl ester pancreatitis model was induced by two hourly intraperitoneal injections of POA (150 mg/kg) and ethanol (1.35 g/kg) (Huang et al., 2014; Wen et al., 2015). The control animals were injected with equal volumes of ethanol. JQ1 (20 mg/kg) was injected via tail vein 1 h before the first injection of POA and ethanol. Mice were anesthetized by pentobarbital sodium (1.5%, w/v) 24 h after the first injection of POA and ethanol, then blood and pancreas were harvested. L-Arg pancreatitis model was induced by two hourly intraperitoneal injections of 8% L-Arg (pH = 7.0), at a dose of 4 g/kg body weight (Dawra et al., 2007). Control group were injected with equal volume of saline. Mice were killed humanely by cervical dislocation 72 h after the first L-Arg injection and pancreas was harvested. NaT pancreatitis was induced by pancreatic duct retrograde injection of 2% NaT (5 μl/min by infusion pump for 10 min), which is described previously (Perides et al., 2010). Control mice received the laparotomy only. After 24 h, mice were humanely killed by cervical dislocation pancreas were collected.

Serum Amylase

Blood samples were collected and centrifuged for 10 min at 3,000 rpm in 4°C. Serum amylase levels were detected by enzyme dynamics chemistry using commercial kits according to the manufacturer’s protocols (Roche, Basel, Switzerland).

Hematoxylin–Eosin Staining and Immunohistochemistry

H&E staining was performed after being fixed in 4% paraformaldehyde and embedded in paraffin, tissues were cut into 4 μm sections. Pancreatic sections were scored by two pathologists in a blind manner for edema, inflammatory infiltration, and necrosis, ranging from 0 to 3 (Wildi et al., 2007). CD45 antibody (1:100) was used for immunohistochemistry to evaluate pancreatic inflammatory cell infiltration (Wen et al., 2018). Briefly, after deparaffinization and antigen retrieval by proteinase K, non-specific bindings were blocked by 5% bovine serum albumin, and then primary antibody was incubated overnight at 4°C. Sections were treated with alkaline phosphatase labeled secondary antibody for 1 h and then imaged by substrate tablets (Sigma-Aldrich, St. Louis, MO, USA).

Immunofluorescence

The pancreas samples were embedded in paraffin and then deparaffinized. Antigen retrieval was performed by sodium citrate buffer (pH= 6), and then sections were blocked by 5% bovine serum albumin for 1 h. Sections were stained with monoclonal antibody against BRD4 (1:200) and amylase (1:300) overnight at 4°C; Alexa Fluor 488-labeled secondary antibody (1:200) and Alexa Fluor 488-labeled secondary antibody (1:300) for 1 h. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min. Sections were imaged by confocal microscope.

Western Blot

Total protein of pancreatic tissue and pancreatic acinar cells were lysed with RIPA which contained protease and phosphatase inhibitors, as previously described (Han et al., 2017). Proteins were loaded on a 15% or 10% polyacrylamide gel. Primary antibodies LC3B (1:1,000), p62 (1:1,000), AMPK (1:1,000), phosphorylated AMPK (1:1,000), mTOR (1:1,000), phosphorylated mTOR (1:1,000), ATG14 (1:1,000), STX17 (1:1,000), cathepsin B (1:1,000), cathepsin L (1:1,000), LAMP2 (1:1,000), BRD4 (1:800), and β-actin (1:1000) were used. The protein bands were detected by chemiluminescence (Millipore, USA) using Amersham Imager 600 (GE Healthcare, USA) and quantified by using Image J software.

Quantitative Reverse Transcription PCR (qRT-PCR)

Total RNA from the pancreatic acinar cells or pancreatic tissues was isolated using Trizol reagent (Takara, Japan). Reverse transcription was used PrimeScript RT Master Mix (Perfect Real Time) (Takara, Japan). Gene expression was detected by real-time PCR using TB Green chemistry (Takara, Japan) on a QuantStudio 6 Flex System using gene-specific, intron-spanning primers ( ). The results were normalized to β-actin and expressed as fold changes over control group.
Table 1

Primer sequences used for qRT-PCR.

Gene nameForward primers (5′ →3′)  Reverse primers(5′ →3′)
Brd4 AAATCAGCTCACCAGGCTGTTCTTGGGCTTGTTAGGGTTG
Tnf TCTCTTCAAGGGACAAGGCTGATAGCAAATCGGCTGACGGT
Il1b TTGACGGACCCCAAAAGATGAAGCTGGATGCTCTCATCTG
Il6 TTCATTCTCTTTGCTCTTGAATTAGAGTCTGACCTTTAGCTTCAAATCCT
Map1lc3b CGTCCGAGAAGACCTTCAAGCAGTGCGGCAGGAGAACCTACTGG
Vmp1 TAAGGATCAGCACAATGGAAGT TCCAGAGAGAAATACTGCAAGG
Atg2a GCTGCTCAGTGCCGTCAACCAGAAGAAGAGGTCCGTGCTGTCC
Becn1 GGCCAATAAGATGGGTCTGAGCTGCACACAGTCCAGAAAA
Sirt1 ATCGGCTACCGAGACAACGTCACTAGAGCTGGCGTGT
β-actin ATGGAGGGGAATACAGCCCTTCTTTGCAGCTCCTTCGTT
Primer sequences used for qRT-PCR.

Statistical Analysis

Data were showed as mean ± SEM and analyzed by GraphPad Prism 4.0c (GraphPad Software, Inc.). The comparison between two groups was determined by Student’s un-paired, two-tailed t-test. P value <0.05 was considered statistically significant.

Results

BRD4 Is Upregulated in Mouse Models of Acute Pancreatitis

To examine the role of BRD4 during experimental AP, we firstly evaluated the expression of BRD4 in various clinically representative mouse models of AP. We found that the mRNA and protein expression of BRD4 were markedly upregulated in caerulein hyperstimulation pancreatitis, L-arginine-induced pancreatitis representing severe form of AP (Dawra et al., 2007), fatty acid ethyl ester pancreatitis mimicking alcohol associated acute pancreatitis (Huang et al., 2014), and NaT pancreatitis mimicking biliary acute pancreatitis (Perides et al., 2010) ( ). Consistently, immunofluorescent co-staining for BRD4 and amylase revealed that there was virtually undetectable expression of BRD4 in the exocrine of the pancreas in normal mice ( ). In contrast, BRD4 expression was markedly increased in the pancreas during four models of AP ( ). These results suggest that BRD4 may play a role in the pathogenesis of AP.
Figure 1

BRD4 is upregulated during various models of experimental acute pancreatitis. (A) Representative H&E images of pancreatic sections in CER, L-Arg, Ethanol- and POA, and NaT (200×), scale bar: 100 μm. (B) mRNA levels of Brd4. (C) Immunoblot analysis of BRD4 from pancreatic tissue. (D) Double immunofluorescent staining of BRD4 (red) and amylase (green) from pancreatic tissues (400×). 4′,6-Diamidino-2-phenylindole (DAPI; blue) was used to counterstain nuclei. Scale bar: 20 μm. Data represent the mean values ± SEM (n = 5). Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05 versus control.

BRD4 is upregulated during various models of experimental acute pancreatitis. (A) Representative H&E images of pancreatic sections in CER, L-Arg, Ethanol- and POA, and NaT (200×), scale bar: 100 μm. (B) mRNA levels of Brd4. (C) Immunoblot analysis of BRD4 from pancreatic tissue. (D) Double immunofluorescent staining of BRD4 (red) and amylase (green) from pancreatic tissues (400×). 4′,6-Diamidino-2-phenylindole (DAPI; blue) was used to counterstain nuclei. Scale bar: 20 μm. Data represent the mean values ± SEM (n = 5). Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05 versus control.

BRD4 Inhibition Protects Against Pancreatic Acinar Cell Injury

In order to evaluate the therapeutic benefit of BRD4 in AP, we measured the effect of BRD4 inhibition on CCK-induced pancreatic acinar cell injury in vitro. In isolated primary pancreatic acinar cells, stimulation with CCK resulted in a marked reduction in the intracellular ATP levels and treatment with BRD4 inhibitor (JQ1) prevented CCK-induced loss of intracellular ATP ( ). To further confirm the effect of BRD4 inhibition on pancreatic acinar cell necrosis, we quantified acinar cell necrosis by LDH release and PI uptake. Inhibition of BRD4 by JQ1 markedly inhibited CCK-induced LDH release and the percentage of PI uptake, suggesting that BRD4 inhibition protected against necrotic cell death pathway activation in primary pancreatic acinar cells ( ). Moreover, we found that BRD4 inhibition also evidently inhibited the expression of several pro-inflammatory mediators, including Tnf, Il1b, and Il6 ( ). These results demonstrate that BRD4 inhibition protects against CCK-induced pancreatic acinar cell injury and inflammation.
Figure 2

BRD4 inhibition prevents the activation of cell death pathway and downregulation of proinflammatory gene expression in vitro. (A) ATP levels were measured by luminescence in isolated pancreatic acinar cells. Data were normalized to untreated control as 100% (n = 5). (B) The percentage of total cellular lactate dehydrogenase (LDH) released into the extracellular medium in isolated pancreatic acinar cells stimulated with CCK (200 nmol·L-1) in the absence or presence of JQ1 (500 nmol·L-1) (n = 5). (C) PI uptake induced by CCK (200 nmol·L-1) with or without JQ1 (500 nmol·L-1) in isolated pancreatic acinar cells (n = 5). (D) mRNA levels of Tnf, Il1b, and Il6 in CCK-stimulated pancreatic acinar cells with or without JQ1 (n = 3). Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to CCK-stimulated group.

BRD4 inhibition prevents the activation of cell death pathway and downregulation of proinflammatory gene expression in vitro. (A) ATP levels were measured by luminescence in isolated pancreatic acinar cells. Data were normalized to untreated control as 100% (n = 5). (B) The percentage of total cellular lactate dehydrogenase (LDH) released into the extracellular medium in isolated pancreatic acinar cells stimulated with CCK (200 nmol·L-1) in the absence or presence of JQ1 (500 nmol·L-1) (n = 5). (C) PI uptake induced by CCK (200 nmol·L-1) with or without JQ1 (500 nmol·L-1) in isolated pancreatic acinar cells (n = 5). (D) mRNA levels of Tnf, Il1b, and Il6 in CCK-stimulated pancreatic acinar cells with or without JQ1 (n = 3). Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to CCK-stimulated group.

BRD4 Inhibition Restores Impaired Autophagic Flux In Vitro and the Effect of BRD4 Inhibition Is Mediated by Upregulating SIRT1

Impaired autophagy plays an important role in the pathogenesis of AP (Piplani et al., 2019). It has been shown that a series of autophagy-associated genes, including induction of autophagy, the fusion of autophagosome with lysosome and lysosomal degradation are repressed by BRD4 (Sakamaki et al., 2017), we next sought to determine whether BRD4 influences autophagic flux in AP. Firstly, we found that the protein expression of the LC3B-II and p62 was significantly elevated in pancreatic acinar cells after CCK stimulation. Treatment with chloroquine (CQ) in the presence or absence of CCK, an well-known inhibitor of autophagy that blocks lysosomal degradation, similarly led to an increase in the protein expression of the LC3B-II. Compared to CCK-stimulated and CQ-treated cells, inhibition or knockdown of BRD4 decreased the accumulation of LC3B-II and more markedly decreased the accumulation of p62, indicating that BRD4 inhibition may enhance autophagic flux ( ; ). Next, we assessed the effect of BRD4 inhibition on AMPK and mTOR, which regulate autophagy induction through Ulk1 phosphorylation (Kim et al., 2011). Interestingly, we found that BRD4 inhibition had no significant effect on the activation of AMPK and mTOR, suggesting that inhibition of BRD4 did not affect the induction of autophagy in isolated pancreatic acinar cells ( ). We also found BRD4 inhibition did not affect the expression of the genes that were related to autophagosomes formation, including Becn1, Vmp1, Atg2a, and Map1lc3b ( ). Since the histone deacetylase, SIRT1 has been reported to regulate autophagy-lysosomal pathway (Hariharan et al., 2010; Huang et al., 2019) and can be upregulated by BRD4 inhibition (Kokkola et al., 2015). We examined whether BRD4 inhibition restores impaired autophagy by upregulating SIRT1. As expected, the expression of SIRT1 was upregulated by JQ1 treatment or BRD4 knockdown in isolated pancreatic acinar cells ( ; ). Furthermore, compared with JQ1-treated group, treatment with the SIRT1 inhibitor EX527 resulted in an increased expression of the autophagic markers such as LC3B-II and p62 ( ).
Figure 3

BRD4 inhibition restores impaired autophagic influx, but has no effect on autophagy initiation. (A) Immunoblot analysis of LC3B level at 4 h after CCK or CQ stimulation in isolated pancreatic acinar cells (n = 3). (B) Immunoblot analysis of AMPK, mTOR phosphorylation levels at 1 h after CCK stimulation in isolated pancreatic acinar cells (n = 3). (C) mRNA levels of Map1lc3b, Vmp1, Becn1, and Atg2a at 4 h after CCK stimulation (n = 3). Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to CCK-stimulated group;##P < 0.05, compared to the CQ-stimulated group; #P < 0.05, compared to CCK+CQ-stimulated group.

Figure 4

BRD4 inhibition upregulated SIRT1 and inhibition of SIRT1 reversed the effects of BRD4 inhibition on autophagic flux. (A) mRNA level of Sirt1 at 4 h after CCK stimulation in isolated pancreatic acinar cells (n = 3). (B) Immunoblot analysis of SIRT1 level at 4 h after CCK stimulation (n = 5). (C) Immunoblot analysis for LC3B and p62 expression in isolated pancreatic acinar cells pretreated with 500 nmol·L-1 JQ1 or 10 μmol·L-1 EX527 followed by stimulation with 200 nmol·L-1 CCK for 4 h (n = 4). (D) Immunoblot analysis for ATG14, STX17, and LAMP2 expression (n = 5). (E) Immunoblot analysis for cathepsin B (n = 3) and cathepsin L expression (n = 5). (F) The activities of cathepsin B (n = 3) and cathepsin L (n = 3). Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to CCK-stimulated group; +P < 0.05, compared to JQ1-treated group.

BRD4 inhibition restores impaired autophagic influx, but has no effect on autophagy initiation. (A) Immunoblot analysis of LC3B level at 4 h after CCK or CQ stimulation in isolated pancreatic acinar cells (n = 3). (B) Immunoblot analysis of AMPK, mTOR phosphorylation levels at 1 h after CCK stimulation in isolated pancreatic acinar cells (n = 3). (C) mRNA levels of Map1lc3b, Vmp1, Becn1, and Atg2a at 4 h after CCK stimulation (n = 3). Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to CCK-stimulated group;##P < 0.05, compared to the CQ-stimulated group; #P < 0.05, compared to CCK+CQ-stimulated group. BRD4 inhibition upregulated SIRT1 and inhibition of SIRT1 reversed the effects of BRD4 inhibition on autophagic flux. (A) mRNA level of Sirt1 at 4 h after CCK stimulation in isolated pancreatic acinar cells (n = 3). (B) Immunoblot analysis of SIRT1 level at 4 h after CCK stimulation (n = 5). (C) Immunoblot analysis for LC3B and p62 expression in isolated pancreatic acinar cells pretreated with 500 nmol·L-1 JQ1 or 10 μmol·L-1 EX527 followed by stimulation with 200 nmol·L-1 CCK for 4 h (n = 4). (D) Immunoblot analysis for ATG14, STX17, and LAMP2 expression (n = 5). (E) Immunoblot analysis for cathepsin B (n = 3) and cathepsin L expression (n = 5). (F) The activities of cathepsin B (n = 3) and cathepsin L (n = 3). Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to CCK-stimulated group; +P < 0.05, compared to JQ1-treated group. Autophagosome fusion with lysosome is a key step in autophagy progression, which is regulated by ATG14 and the complex formed by STX17, synaptosome associated protein 29, and vesicle associated membrane protein 8 (Itakura and Mizushima, 2013). We measured the expression of ATG14, STX17, and LAMP2 and found that the protein levels of ATG14, STX17, and LAMP2 were downregulated in pancreatic acinar cells after CCK stimulation and inhibition of BRD4 by JQ1 or knockdown of BRD4 by transfecting shRNA restored their expression ( ; ), suggesting that BRD4 inhibition enhances the fusion of autophagosomes with lysosomes. Furthermore, using LysoTracker staining, we found that BRD4 inhibition maintained lysosomal pH ( ). Interestingly, we also observed that treatment with the SITR1 inhibitor, EX527 reversed the effects of BRD4 inhibition on the expression of autophagosome and lysosome fusion markers, including ATG14, STX17, and LAMP2 ( ), indicating the influence of BRD4 inhibition on autophagosome fusion with lysosome was mediated by SIRT1. It has been shown that during AP, impaired autophagy is related to an imbalance between cathepsin L and cathepsin B as the former degrades trypsinogen and trypsin into amino acid and the latter converts trypsinogen into trypsin (Mareninova et al., 2009). We next measured the expression of cathepsin L and cathepsin B and found that inhibition or knockdown BRD4 significantly increased the level of the pro-enzyme and cleaved form of cathepsin L. Interestingly, BRD4 inhibition did not alter the expression of cathepsin B, but BRD4 knockdown markedly decreased the expression of cathepsin B ( ; ), suggesting that BRD4 mediates the balance between cathepsin L and cathepsin B, therefore, resulting in reduced pancreatic acinar cell injury. And with the SITR1 inhibitor treatment, the pro-enzyme and the cleaved form of cathepsin L was decreased, but the level of cathepsin B was not changed ( ). To further assess the effect of JQ1 on lysosomal function, we measured the activity of cathepsin B and L. BRD4 inhibition increased the activity of cathepsin L and SIRT1 inhibitor reversed its effect, but there was no effect on the activity of cathepsin B ( ). Taken together, these data suggest that BRD4 inhibition enhances the fusion of autophagosome with lysosome and improves lysosomal degradation, but has no influence on autophagy initiation and autophagosome formation. Secondly, the influence of BRD4 inhibition on autophagy was likely mediated by upregulating SIRT1.

BRD4 Inhibition Alleviates Two Acute Pancreatitis Models

Then, we examined the influence of BRD4 inhibition on pancreatitis severity during two experimental models of AP in vivo. Firstly, we tested JQ1, the inhibitor of BRD4 in caerulein hyperstimulation pancreatitis, a widely used and highly reproducible AP model (Lerch and Gorelick, 2013). We showed that JQ1 markedly reduced pancreatic edema, inflammatory infiltration, and necrosis ( ). Furthermore, leukocyte infiltration assessed by CD45 immunostaining and pro-inflammatory cytokines such as Tnf, Il1b, and Il6 in the pancreas were decreased with JQ1 treatment ( ). The second AP model was induced by administrations of POA and ethanol, which is associated with alcohol-induced pancreatitis (Huang et al., 2014). Similarly, we found that JQ1 significantly reduced histological scores in the pancreas, including edema, inflammation, and necrosis ( ). Furthermore, JQ1 decreased leukocyte infiltration and inflammatory factors in the pancreas and serum amylase levels in this model ( ). Consistently with our in vitro findings, these data showed that BRD4 inhibition protects against two clinically relevant models of AP.
Figure 5

BRD4 inhibition protects against caerulein- and ethanol plus POA-induced pancreatitis in vivo. (A) Representative H&E images of pancreatic sections in CER and ethanol plus POA-induced pancreatitis (200×) (n = 5). (B) Histopathological scores for edema, inflammation, necrosis, and the total histology score (n = 5). (C) Representative micrographs of leukocyte marker CD45 immunohistochemical staining for the pancreas (200×). (D) mRNA levels of Tnf, Il1b, and Il6 from pancreatic tissue (n = 3) and serum amylase levels (n = 5). Scale bar = 100 μm. Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to AP group.

BRD4 inhibition protects against caerulein- and ethanol plus POA-induced pancreatitis in vivo. (A) Representative H&E images of pancreatic sections in CER and ethanol plus POA-induced pancreatitis (200×) (n = 5). (B) Histopathological scores for edema, inflammation, necrosis, and the total histology score (n = 5). (C) Representative micrographs of leukocyte marker CD45 immunohistochemical staining for the pancreas (200×). (D) mRNA levels of Tnf, Il1b, and Il6 from pancreatic tissue (n = 3) and serum amylase levels (n = 5). Scale bar = 100 μm. Data represent the mean values ± SEM. Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to AP group.

BRD4 Inhibition Restores Impaired Autophagy In Vivo

Finally, we evaluated the effect of BRD4 inhibition on autophagy in vivo. In these two AP models, JQ1 treatment significantly downregulated p62 levels ( ). BRD4 inhibition downregulated LC3B-II expression in fatty acid ethyl ester-induced pancreatitis, while had no effect on LC3B-II expression CER model ( ). These data suggest that BRD4 inhibition restores impaired autophagy in vivo. Furthermore, we found that BRD4 inhibition upregulated the expression of ATG14 and LAMP2, but had no effect on STX17 in both models ( ), indicating BRD4 inhibition enhances the fusion of the autophagosome with lysosome in vivo. Finally, we detected the expression of SIRT1 in vivo and found that BRD4 inhibition significantly upregulated SIRT1 levels ( ). Collectively, our data suggest that BRD4 inhibition via upregulating SIRT1 restores impaired autophagy in vivo.
Figure 6

BRD4 inhibition restores impaired autophagic influx in vivo via promoting autophagosome-lysosome fusion and lysosomal degradation. (A) Immunoblot analysis for LC3 and p62 in the pancreas from CER (upper) or ethanol plus POA (lower). (B) Immunoblot analysis for ATG14 and STX17 in the pancreas from CER (upper) or ethanol plus POA (lower). (C) Immunoblot analysis for LAMP2 in the pancreas from CER (upper) or ethanol plus POA (lower). Data represent the mean values ± SEM (n = 3). Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to AP group.

BRD4 inhibition restores impaired autophagic influx in vivo via promoting autophagosome-lysosome fusion and lysosomal degradation. (A) Immunoblot analysis for LC3 and p62 in the pancreas from CER (upper) or ethanol plus POA (lower). (B) Immunoblot analysis for ATG14 and STX17 in the pancreas from CER (upper) or ethanol plus POA (lower). (C) Immunoblot analysis for LAMP2 in the pancreas from CER (upper) or ethanol plus POA (lower). Data represent the mean values ± SEM (n = 3). Statistical analysis was performed by Student’s un-paired, two-tailed t-test between two groups, *P < 0.05, compared to the control; #P < 0.05, compared to AP group.

Discussion

The BET protein family includes four subtypes: Brd2, Brd3, Brd4, and Brd6/t which is testis specific. (Shi and Vakoc, 2014; Sakamaki et al., 2017). It has been known that among these isoforms only BRD4 knockdown mediates autophagy and lysosomal function (Sakamaki et al., 2017). Therefore, we focused our study on the role of BRD4 in AP. Among BRD4 inhibitors, we choose JQ1 since it is widely used pharmacological BRD4 inhibitor in various other diseases (Jiang et al., 2017; Rudman et al., 2018; Song et al., 2019). We found that BRD4 inhibition reduced CCK-induced pancreatic acinar cell injury and pro-inflammatory expression in vitro, and protected against two AP models. Interestingly, Huang et al. reported that treatment with I-BET-762, another BET inhibitor, markedly alleviated taurolithocholic acid-induced pancreatitis and POA plus ethanol AP, but not caerulein hyperstimulation pancreatitis (Huang et al., 2017), suggesting that different BET inhibitor may exert their anti-inflammatory effects through different mechanisms. As shown in our study, BRD4 inhibition by JQ1 protects against AP mainly through restoring impaired autophagic flux, which has been reported to be pivotal in the pathogenesis of AP. Autophagy is a critical catabolic process which can degrade and recycle damaged organelles, lipids, and proteins (Habtezion et al., 2019). SQSTM1, also known as p62, is an autophagy receptor. As degraded along with cargos, it can be used as a marker of autophagic degradation (Klionsky et al., 2016). The excessive accumulation of p62 is a marker of impaired autophagy (Gukovskaya et al., 2017). We found that BRD4 inhibition and knockdown had a pronounced effect on reducing the accumulation of p62, indicating that BRD4 inhibition enhances autophagic degradation. It has been reported that BRD4 inhibition and knockdown promotes autophagy induction in early stages, the formation of autophagosomes, and subsequent fusion with lysosomes (Sakamaki et al., 2017). In our study, we found that BRD4 inhibition had no effects on the phosphorylation of mTOR and AMPK, two markers of autophagic induction, nor on the genes that were related to autophagosomes formation, suggesting that BRD4 inhibition did not affect autophagy induction and autophagosome formation. This may partly be explained by that pancreatic basal autophagy is high and is crucial for pancreatic hemostasis (Antonucci et al., 2015), but during experimental AP, activated autophagy is protective while incomplete autophagic process might be detrimental (Gukovskaya et al., 2017). Accumulating evidence demonstrated that autophagy in acute pancreatitis models is impaired (Mareninova et al., 2009; Gukovskaya et al., 2017; Biczo et al., 2018). The fusion of autophagosome with lysosome is critical for efficient lysosomal degradation and is regulated by a series of proteins, such as ATG14, Rab7, LAMP2, and STX17 (Itakura and Mizushima, 2013; Zhang et al., 2019). We found that BRD4 inhibition or knockdown increased the expression of ATG14, STX17, and LAMP2 in isolated pancreatic acinar cells and in two clinically relevant models of AP, suggesting that BRD4 inhibition restores impaired autophagy by improving the fusion of autophagosome with lysosome in vitro and in vivo. In addition to the fusion of autophagosome with lysosome, efficient lysosomal degradation depends on the integrity of lysosome membrane and the activities of acidic hydrolases (Saftig and Klumperman, 2009). Cathepsin B and cathepsin L are involved in this process, cathepsin B converts trypsinogen to trypsin while cathepsin L degrades both trypsin and trypsinogen into amino acids (Halangk et al., 2000; Wartmann et al., 2010; Gukovskaya and Gukovsky, 2012). Previous studies have shown that in pancreatitis level of fully processed (mature) forms of these cathepsins decreased and accumulation of intermediate forms increased (Mareninova et al., 2009; Gukovskaya and Gukovsky, 2012; Biczo et al., 2018). Moreover, acidic environment in the lysosome plays a critical role in maintaining the normal activities of these enzymes (Mindell, 2012). In this study, we found that BRD4 inhibition maintained lysosomal pH, increased the expression of mature form of cathepsin L and the activity of cathepsin L in isolated pancreatic acinar cells, suggesting that BRD4 inhibition restores impaired autophagy during AP also by enhancing lysosomal degradation. SIRT1 is a member of class III histone deacetylase, which is involved in the regulation of cell metabolism, apoptosis, and autophagy (Oellerich and Potente, 2012). It has been showed that BRD4 inhibitor JQ1 upregulated SIRT1 and alleviated inflammatory responses in a cellular model of lung disease (Kokkola et al., 2015). In addition, BRD4 inhibition induced ferritinophagy and downregulated the expression of genes that are related to ferroptosis by enhancing the expression of SIRT1 or suppressing the expression of the histone methyltransferase G9a (Sui et al., 2019). Consistently, we found that BRD4 inhibition or knockdown upregulated SIRT1 in pancreatic acinar cells and in experimental models of AP. It has been reported that SIRT1 regulates autophagy by interacting with autophagy related genes and deacetylating them. For example, SIRT1 deacetylate autophagy genes such as Atg5, Atg7, and Atg8, which is critical for the activation of autophagy induced by starvation (Lee et al., 2008). Moreover, SIRT1 deacetylated FOXO1 (forkhead box O1), enhancing autophagosome-lysosome fusion (Hariharan et al., 2010; Huang et al., 2019). SIRT1 also deacetylates FOXO3 (forkhead box O3), leading Bnip3‐mediated autophagy (Kume et al., 2010). In addition, SIRT1 deacetylates TFEB (transcription factor EB), enhancing the expression of autophagy/lysosome-associated genes (Bao et al., 2016). In this study, we observed that the inhibition of SIRT1 deacetylation with EX527 reversed the effects of BRD4 inhibition on autophagic flux. Specifically, inhibition of SIRT1 reversed the increased expression of LC3B-II and p62 with BRD4 inhibition, downregulated the increased expression of ATG14, STX17, and LAMP2 with BRD4 inhibition, and decreased the pro-enzyme and the cleaved form and the activity of cathepsin L, but the level and the activity of cathepsin B was not changed. These data suggest that SIRT1 is a crucial mediator that is responsible for BRD4-mediated autophagy during AP.

Conclusion

In summary, in this study, we showed that BRD4 expression is upregulated in various experimental models of pancreatitis. BRD4 inhibition alleviated pancreatic acinar cell injury and two clinically relevant mouse models of experimental AP. These protective effects were mediated by restoring impaired autophagic flux, primarily through enhancing autophagosome fusion with lysosome and lysosomal degradation. The regulation of impaired autophagic flux by BRD4 inhibition is through upregulating SIRT1 ( ).
Figure 7

Schematic diagram for the mechanism of BRD4 inhibition on impaired autophagy during acute pancreatitis. BRD4 inhibition protects against pancreatic injury in the in vitro and in vivo settings of AP. Inhibition or knockdown of BRD4 upregulated SIRT1, leading to enhanced autophagosome fusion with lysosome and lysosomal degradation, therefore restored impaired autophagic flux by pancreatitis insults.

Schematic diagram for the mechanism of BRD4 inhibition on impaired autophagy during acute pancreatitis. BRD4 inhibition protects against pancreatic injury in the in vitro and in vivo settings of AP. Inhibition or knockdown of BRD4 upregulated SIRT1, leading to enhanced autophagosome fusion with lysosome and lysosomal degradation, therefore restored impaired autophagic flux by pancreatitis insults.

Data Availability Statement

All datasets generated for this study are included in the article/ .

Ethics Statement

All experiments involving animals were approved by the Institutional Animal Care and Research Ethics Committee of Shanghai Jiao Tong University School of Medicine (SYXK 2013–0050, Shanghai, China).

Author Contributions

SS, BL, and JD performed the experiments and drafted the manuscript. SS, ZW, and YH performed the statistical analysis. LW, GH, and XW designed, conceived the study, revised the manuscript, and provided funding to support the study. All authors read and approved the submitted version.

Funding

This work was sponsored by Natural Science Foundation of China to GH (81670584 and 81970556), XW (81570580), and LW (81900585), Shanghai Pujiang Program to GH (18PJD041) and LW (19PJ1408400), Shanghai Municipal Education Commission-Gaofeng Clinical Medicine Grant to LW.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflicts of interest. The reviewer OM declared a past co-authorship with one of the authors LW to the handling editor.
  46 in total

1.  Calorie restriction enhances cell adaptation to hypoxia through Sirt1-dependent mitochondrial autophagy in mouse aged kidney.

Authors:  Shinji Kume; Takashi Uzu; Kihachiro Horiike; Masami Chin-Kanasaki; Keiji Isshiki; Shin-Ichi Araki; Toshiro Sugimoto; Masakazu Haneda; Atsunori Kashiwagi; Daisuke Koya
Journal:  J Clin Invest       Date:  2010-03-24       Impact factor: 14.808

Review 2.  Acute pancreatitis: bench to the bedside.

Authors:  Stephen J Pandol; Ashok K Saluja; Clement W Imrie; Peter A Banks
Journal:  Gastroenterology       Date:  2007-03       Impact factor: 22.682

Review 3.  Lysosome biogenesis and lysosomal membrane proteins: trafficking meets function.

Authors:  Paul Saftig; Judith Klumperman
Journal:  Nat Rev Mol Cell Biol       Date:  2009-08-12       Impact factor: 94.444

4.  Transient High Pressure in Pancreatic Ducts Promotes Inflammation and Alters Tight Junctions via Calcineurin Signaling in Mice.

Authors:  Li Wen; Tanveer A Javed; Dean Yimlamai; Amitava Mukherjee; Xiangwei Xiao; Sohail Z Husain
Journal:  Gastroenterology       Date:  2018-06-19       Impact factor: 22.682

5.  AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1.

Authors:  Joungmok Kim; Mondira Kundu; Benoit Viollet; Kun-Liang Guan
Journal:  Nat Cell Biol       Date:  2011-01-23       Impact factor: 28.824

Review 6.  Autophagy and pancreatitis.

Authors:  Anna S Gukovskaya; Ilya Gukovsky
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2012-09-06       Impact factor: 4.052

7.  FoxO1 inhibits autophagosome-lysosome fusion leading to endothelial autophagic-apoptosis in diabetes.

Authors:  Hui Zhang; Song Ge; Kesuai He; Xin Zhao; Ya Wu; Yongfeng Shao; Xiaohong Wu
Journal:  Cardiovasc Res       Date:  2019-12-01       Impact factor: 10.787

8.  Simvastatin induces autophagic flux to restore cerulein-impaired phagosome-lysosome fusion in acute pancreatitis.

Authors:  Honit Piplani; Stefanie Marek-Iannucci; Jon Sin; Jean Hou; Toshimasa Takahashi; Ankush Sharma; Juliana de Freitas Germano; Richard T Waldron; Hannaneh Saadaeijahromi; Yang Song; Aiste Gulla; Bechien Wu; Aurelia Lugea; Allen M Andres; Herbert Y Gaisano; Roberta A Gottlieb; Stephen J Pandol
Journal:  Biochim Biophys Acta Mol Basis Dis       Date:  2019-08-06       Impact factor: 6.633

9.  Exercise activates lysosomal function in the brain through AMPK-SIRT1-TFEB pathway.

Authors:  Jun Huang; Xue Wang; Yi Zhu; Zhe Li; Yu-Ting Zhu; Jun-Chao Wu; Zheng-Hong Qin; Min Xiang; Fang Lin
Journal:  CNS Neurosci Ther       Date:  2019-03-12       Impact factor: 5.243

10.  Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Authors:  Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier
Journal:  Autophagy       Date:  2016       Impact factor: 16.016

View more
  2 in total

Review 1.  New insights into the etiology, risk factors, and pathogenesis of pancreatitis in dogs: Potential impacts on clinical practice.

Authors:  Harry Cridge; Sue Yee Lim; Hana Algül; Jörg M Steiner
Journal:  J Vet Intern Med       Date:  2022-05-12       Impact factor: 3.175

2.  Effects of Snake-Derived Phospholipase A2 Inhibitors on Acute Pancreatitis: In vitro and in vivo Characterization.

Authors:  Yanping Wu; Gen-You Liao; Hua-Jing Ke; Pi Liu
Journal:  Drug Des Devel Ther       Date:  2020-11-06       Impact factor: 4.162

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.