Yu-Hui Li1, Ming Zhong2, Hong-Liang Zang1, Xiao-Feng Tian1. 1. Department of General Surgery, The China-Japan Union Hospital, Jilin University, Changchun, China. 2. Respiratory Department, The China-Japan Union Hospital, Jilin University, Changchun, China.
Abstract
Global incidence and mortality associated with hepatocellular carcinoma (HCC) is steadily increasing. Metastasis-associated 1 (MTA1) can induce tumorigenesis and metastatic progression in HCC. However, the mechanistic details of MTA1-mediated regulation of HCC has not been completely defined. Epigenetic histone modification is closely related to tumor development. Histone cluster 1 H1 family member c (H1.2) is important for epigenetic histone modification and chromatin remodeling; however, whether it has a role in HCC tumorigenesis is not known. In the current study, we confirmed that MTA1 promoted HCC cell growth and migration. Our results further show that MTA1 inhibited the phosphorylation of histone cluster 1 H1 family member c (H1.2) at threonine-146 residue (T146) (H1.2T146ph). MTA1 inhibited H1.2T146ph by mediating proteasomal degradation of the DNA protein kinase (DNA-PK). Pharmacological inhibition of proteasomal degradation of DNA-PK or genetic ablation of E3 ligase mouse double minute 2 (MDM2) rescued expression of DNA-PK, and subsequent phosphorylation of H1.2. MTA1's role in HCC was inhibited by ectopic expression of H1.2T146ph in HCC cell lines. Our results showed that H1.2T146ph can bind to MTA1 target genes. Collectively, our study confirms that MTA1 functions as an oncogene and promotes HCC progression. The epigenetic histone modifier H1.2T146ph exerts critical role in the regulation of MTA1-induced tumorigenesis. MTA1 regulates posttranslational activation of H1.2 by regulating the cognate kinase, DNA-PK, via the ubiquitin proteasome system. MTA1 expression was inversely correlated to both DNA-PK and phosphorylated H1.2 in HCC tissue specimens compared to tumor adjacent normal hepatic tissue, revealing that the MTA1/MDM2/DNA-PK/H1.2 is an important therapeutic axis in HCC.
Global incidence and mortality associated with hepatocellular carcinoma (HCC) is steadily increasing. Metastasis-associated 1 (MTA1) can induce tumorigenesis and metastatic progression in HCC. However, the mechanistic details of MTA1-mediated regulation of HCC has not been completely defined. Epigenetic histone modification is closely related to tumor development. Histone cluster 1 H1 family member c (H1.2) is important for epigenetic histone modification and chromatin remodeling; however, whether it has a role in HCC tumorigenesis is not known. In the current study, we confirmed that MTA1 promoted HCC cell growth and migration. Our results further show that MTA1 inhibited the phosphorylation of histone cluster 1 H1 family member c (H1.2) at threonine-146 residue (T146) (H1.2T146ph). MTA1 inhibited H1.2T146ph by mediating proteasomal degradation of the DNA protein kinase (DNA-PK). Pharmacological inhibition of proteasomal degradation of DNA-PK or genetic ablation of E3 ligase mouse double minute 2 (MDM2) rescued expression of DNA-PK, and subsequent phosphorylation of H1.2. MTA1's role in HCC was inhibited by ectopic expression of H1.2T146ph in HCC cell lines. Our results showed that H1.2T146ph can bind to MTA1 target genes. Collectively, our study confirms that MTA1 functions as an oncogene and promotes HCC progression. The epigenetic histone modifier H1.2T146ph exerts critical role in the regulation of MTA1-induced tumorigenesis. MTA1 regulates posttranslational activation of H1.2 by regulating the cognate kinase, DNA-PK, via the ubiquitin proteasome system. MTA1 expression was inversely correlated to both DNA-PK and phosphorylated H1.2 in HCC tissue specimens compared to tumor adjacent normal hepatic tissue, revealing that the MTA1/MDM2/DNA-PK/H1.2 is an important therapeutic axis in HCC.
Primary liver cancer is the second leading cause of all cancer-related mortality (1). In 2018, there were more than 800,000 newly diagnosed primary liver cancer cases and 750,000 deaths worldwide (1). Hepatocellular carcinoma (HCC) is the major type of primary liver cancer and occupies ~80% of primary liver cancer (1). Despite significant advances, treatment outcomes in HCC are poor (2, 3). The molecular mechanism underlying the malignant and aggressive features of this tumor type remains largely undefined.Metastasis-associated 1 (MTA1) is overexpressed in several different types of humantumors, including liver cancer (4, 5). Elevated MTA1 expression level positively correlates with poor prognosis of patients (6). Thus, MTA1 is also considered as a potential therapeutic target (6). Expression of MTA1 is also critical for metastatic progression (7–9), transcriptional regulation, and chromatin remodeling (10).Histone modification is central for chromatin remodeling and epigenetic regulation, in turn impinging on transcriptional regulation and cellular functions (11). Linker histone cluster 1 H1 family member c (H1.2) has specific roles in epigenetic regulation of several genes (12). H1 proteins are themselves regulated by posttranslational modifications (13). The serine/threonine protein kinase, DNA-dependent protein kinase (DNA-PK), plays a vital role in DNA double-stranded breaks (14). It has been shown that DNA-PK phosphorylates H1.2 at T146 site (15). Mouse double minute 2 (MDM2) is a multifunctional protein and can promote cancer cell growth, invasion, drug resistance, and survival property (16, 17). MDM2 is involved in proteasome-mediated protein degradation and plays a central role in tumorigenesis pathways (18).Hence, our objective was to understand how MTA1's function in HCC is regulated. Our results provide evidence that MTA1 promotes hepatocellular carcinoma progression by proteasomal-mediated degradation of DNA-PK, resulting in inhibition of H1.2 phosphorylation. Proteasomal inhibitor or genetic ablation of the E3 ligase MDM2 inhibited degradation of DNA-PK and rescued H1.2 phosphorylation. Phosphorylated H1.2 can bind and inhibit premetastatic target genes of MTA1. The results from this study thus reveal a yet undefined MTA1/MDM2/DNA-PK/H1.2 axis in HCC that can be potentially targeted by proteasomal inhibitors to reverse MTA1's role in HCC.
Materials and Methods
Plasmids and Reagents
The HIST1H1C (encoding H1.2), PRKDC (encoding DNA-PK), MDM2, and MTA1 coding sequences were cloned from HeLa complementary DNA (cDNA) by PCR into pDest-eGFP-N1 (Addgene #31796) and pCMV-HA (Addgene #32530) vectors. H1.2T146E was generated by site-directed mutagenesis. MDM2-specific small-interfering RNA (siRNA) was obtained from Shanghai GenePharma. MG132 (#C2211) was bought from Millipore Sigma and was used at a final concentration of 25 μmol/L.
Cell Culture
The HuH6, SNU449, and THLE-2 cells were purchased from the American Type Culture Collection (ATCC) and were maintained in 10% fetal bovine serum (FBS) supplemented Dulbecco's modified Eagle's medium (DMEM) (complete medium). All cells were incubated and cultured at 37°C in a 5% CO2 atmosphere.
Transient Transfection
Approximately 5.0 × 105 cells/well were seeded in six-well plates. Twenty-four hours postseeding, cells were transfected with indicated siRNA (10 nmol) or expression plasmids using Lipofectamine 2000 (Thermo Fisher) following manufacturer's recommendations. Cells were harvested 72 h after transfection and analyzed in indicated experiments.
Detection of Cell Viability
The indicated plasmids were transiently transfected into cells in 24-well plates. Forty-eight hours posttransfection, 20 μl 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (5 mg/ml) was added in the medium. Following incubation for 4 h at 37°C, 100 μl dimethyl sulfoxide (DMSO) was added in each well, and the absorbance was measured.
RNA Extraction and Real-Time-PCR
Total RNA was extracted using Trizol reagent (Thermo Fisher) following manufacturer's recommendations. The isolated RNA was treated with DNase-I and was then used to synthesize the cDNA using Moloney murine leukemia virus (M-MuLV) reverse transcriptase (Fermentas) and oligo-dT primers (Thermo Fisher). The cDNA was used to template qRT-PCR using QuantiTect SYBR Green PCR Kit (Qiagen) using indicated primers (Table 1). Human β-actin (ACTB) messenger RNA (mRNA) was used as internal control in each group.
Table 1
Oligonucleotide primers used in the current study.
Gene name
Forward primer (5′−3′)
Reverse primer (5′−′)
MMP9
GCCACTACTGTGCCTTTGAGTC
CCCTCAGAGAATCGCCAGTACT
MMP7
TCGGAGGAGATGCTCACTTCGA
GGATCAGAGGAATGTCCCATACC
CCND1
TCTACACCGACAACTCCATCCG
TCTGGCATTTTGGAGAGGAAGTG
NT5E
AGTCCACTGGAGAGTTCCTGCA
TGAGAGGGTCATAACTGGGCAC
GDF15
CAACCAGAGCTGGGAAGATTCG
CCCGAGAGATACGCAGGTGCA
CARD16
ATTCCGAAAGGGGCACAGGCAT
TCTGCCTTCTGGGCTTGAGCAT
ACTB
CACCATTGGCAATGAGCGGTTC
AGGTCTTTGCGGATGTCCACGT
Oligonucleotide primers used in the current study.
Colony Formation Assay
Transfected cells were suspended in complete medium, which included 0.35% low-melting agarose. Cells (1.0 × 103/well) were plated onto 0.6% solidified agarose in complete medium in six-well plates. After 3 weeks, cells were fixed with 10% formalin for 10 min and subsequently stained for 20 min with 0.05% crystal violet dye and then washed with phosphate-buffered saline (PBS). The cell colony numbers were imaged, counted, and analyzed.
Transwell Migration Assay
The 8-μm pore filters Transwell system (Costar, Boston, MA, USA) was used to detect the migration of cell. The lower chamber was filled with 800 μl complete media; then, serum-starved cells were trypsinized, and 3 × 104 cells in 300 μl Dulbecco's modified Eagle's medium (DMEM) without FBS were seeded into the upper chamber. Following 24 h incubation at 37°C, the migrated cells were fixed and stained with 0.5% crystal violet and washed. A cotton swab was used to remove the cells on the top surface of the membrane, and the wells were imaged. The cells were then lysed with acetic acid until dry. Finally, the optical density (OD) at 570 nm of each Transwell was measured and analyzed.
Western Blotting
Cells were harvested 72 h posttransfection and washed with PBS. Cell lysates were prepared using lysis buffer. The protein content of the cell lysates was measured by bicinchoninic acid (BCA) protein kit. Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). The following primary antibodies were used, anti-H1.2 (GeneTex, GTX122561), anti-H1.2T146ph (Abcam, ab3596), anti-MTA1 (Abcam, ab71153), anti-DNA-PK (Abcam, ab70250), anti-MDM2 (Sigma, M7815), antigreen fluorescent protein (anti-GFP) (MBL, M048-3), anti-His (MBL, PM032), anti-HA (MBL, M180-3), antiglyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH) (Santa Cruz, sc-32233).
Immunohistochemistry
All studies with human samples were approved by the Institutional Review Board of our hospital. HCC tumor and tumor-adjacent normal tissues were obtained from nine patients after informed consent. Tissue specimens were processed by routine methodology and stained with antibodies used for Western blotting but at 1:100 dilution. Shown are representative images. Slides were scored based on intensity and percent, and a cumulative staining score was assigned, where 1 represented the lowest and 5 represented the highest staining.
Cell Cycle Distribution Analysis
The HuH6 cells were collected and washed twice in ice-cold PBS and fixed in 1% paraformaldehyde for 1 h at room temperature. Then, the cells were washed using ice-cold PBS and treated with 70% ethanol for 2 h at 4°C. The cells were rehydrated in PBS and then incubated for half an hour at room temperature in a propidium iodide (PI) staining solution [0.2 mg/ml propidium iodide, 0.2 mg/ml DNAse-free RNAse A (Roche, Basel, Switzerland) and 0.1% Triton X-100 in PBS]. The results were detected using an Epics XL flow cytometer (Beckman Coulter, Fullerton, CA, USA). The percentage of cells in each cell cycle phase was determined and analyzed.
Chromatin Immunoprecipitation
About 3 × 106 cells in each sample were cross-linked for 10 min in 1% (v/v) formaldehyde at room temperature. Cells were then washed twice with cold PBS and lysed with SDS lysis buffer (Upstate, #20-163). After the sonication step in an ultrasonic bath, the samples were centrifuged at 15,000 g, and the supernatants of the samples were diluted with chromatin immunoprecipitation (ChIP) dilution buffer (Upstate, #20-153) and immunoprecipitated with anti-H1.2T146ph (Abcam, ab3596) (2 μg) at 4°C overnight. Two micrograms normal anti-immunoglobulin (IgG) antibody was used as control immunoprecipitations. The beads were washed sequentially for 5 min each in low-salt (Upstate, #20-154), high-salt (Upstate, #20-155), and LiCl buffers (Upstate, #20-156) at 4°C. Finally, the beads were washed twice in 1 × Tris–ethylenediaminetetraacetic acid (TE) (Upstate, #20-157) for 2 min at room temperature. The DNA was eluted from the beads in 1% SDS/100 mM NaHCO3 for 15 min at room temperature. NaCl was added to a final concentration of 200 mM, and the crosslinks were reversed for 7 h at 65°C. The DNA was eluted and precipitated with ethanol at −20°C overnight, treated with 20 μg proteinase K and purified using QIAquick PCR Purification Columns (Qiagen) followed by instructions. The immunoprecipitated DNA and serial dilutions of the input DNA were analyzed using real-time PCR.
Statistical Analysis
All data were represented as mean ± standard deviation (SD) of at least three independent replicates. Statistical significance between groups was analyzed using the Student's t-test. P < 0.05 was considered to have statistical significance.
Results
MTA1 Downregulates Phosphorylation of H1.2T146
To identify the function of MTA1 and the relationship between MTA1 and H1.2 in HCC cells, normal liver cell line THLE-2, or HCC cell lines HuH6 and SNU449 were transfected either with control pEGFP-N1 (pEGFP) or MTA1 expression plasmid. Ectopic overexpression of MTA1 significantly decreased the phosphorylation of H1.2T146 (H1.2T146ph) without affecting total H1.2 expression in both the normal (Figures 1A,B) and HCC cell lines (Figures 1C,D). Taken together, these results indicated that MTA1 directly or indirectly is inhibiting phosphorylation of H1.2. Relative expression of MTA1 was comparatively higher in the HCC cell lines SNU449 and HuH6 compared to the normal liver cell line THLE-2 (Figures 1A,C).
Figure 1
Phosphorylation of histone cluster 1 H1 family member c (H1.2) is regulated by the metastasis-associated 1 (MTA1). (A,B) Normal liver THLE-2 cells were transfected with pEGFP-N1 (empty vector) or pEGFP-MTA1-expressing plasmids. The H1.2 at threonine-146 residue (H1.2T146ph) levels were then determined using Western blotting. Shown are representative blots (A) and quantification of three independent experiments (B). **P < 0.01, t-test. (C,D) SNU449 and HUH6 liver cancer cells were transfected with pEGFP-N1 (empty vector) or pEGFP-MTA1-expressing plasmids. The H1.2T146ph levels were then determined using Western blotting. Shown are representative blots (C) and quantification of three independent experiments (D). **P < 0.01, t-test.
Phosphorylation of histone cluster 1 H1 family member c (H1.2) is regulated by the metastasis-associated 1 (MTA1). (A,B) Normal liver THLE-2 cells were transfected with pEGFP-N1 (empty vector) or pEGFP-MTA1-expressing plasmids. The H1.2 at threonine-146 residue (H1.2T146ph) levels were then determined using Western blotting. Shown are representative blots (A) and quantification of three independent experiments (B). **P < 0.01, t-test. (C,D) SNU449 and HUH6 liver cancer cells were transfected with pEGFP-N1 (empty vector) or pEGFP-MTA1-expressing plasmids. The H1.2T146ph levels were then determined using Western blotting. Shown are representative blots (C) and quantification of three independent experiments (D). **P < 0.01, t-test.
H1.2T146ph Functionally Inhibited MTA1-Induced Cell Growth and Migration
We next determined if modulation of phosphorylation of H1.2 by MTA1 impacted effect of MTA1 on in vitro cell growth and migration. The HCC cell line HuH6 was chosen for this experiment, as we observed almost complete ablation of H1.2 phosphorylation following ectopic overexpression of MTA1 (Figures 1C,D). HuH6 cells were cotransfected with MTA1 and either wild-type H1.2 or increasing concentrations of the phosphomimic H1.2T146E plasmids and compared to cells transfected with the EGFP plasmid alone. The rationale behind using the phosphomimic H1.2T146E was that it will mimic the phosphorylated H1.2 in charge and will not be affected by MTA1-mediated dephosphorylation as the wild-type H1.2. Ectopic overexpression of MTA1, wild type, and H1.2T146E was verified by Western blot (Figure 2A). Overexpression of MTA1 promoted cell viability compared to mock EGFP-transfected HuH6 cells (Figure 2B). However, ectopic expression of the phosphomimic H1.2T146E significantly decreased MTA1-induced cell growth in a dose-dependent manner (Figure 2B).
Figure 2
Histone cluster 1 H1 family member c at threonine-146 residue (H1.2T146ph) is involved in the pro-oncogenic function of MTA1. (A) HuH6 cells were transfected with pEGFP-N1, pEGFP-H1.2, pEGFP-MTA1, and pEGFP-H1.2T146E plasmids indicated as GFP, H1.2, MTA1, and H1.2T146E (0.5, 1, and 2 μg, respectively), and relative expression of MTA1 and H1.2 were determined by Western blotting. Shown are representative blots from three independent experiments. (B) Cell viability was detected in the transfected HuH6 cells. **P < 0.01, t-test. (C,D) Colony formation experiment was performed using soft agar. Representative images (C) and quantification of numbers of colonies (D) in the transfected HuH6 cells. **P < 0.01, t-test. (E,F) Transwell assays were performed in the transfected HuH6 cells. Shown are representative images (E) and quantification (F) of the migrating cells (F).**P < 0.01, t-test.
Histone cluster 1 H1 family member c at threonine-146 residue (H1.2T146ph) is involved in the pro-oncogenic function of MTA1. (A) HuH6 cells were transfected with pEGFP-N1, pEGFP-H1.2, pEGFP-MTA1, and pEGFP-H1.2T146E plasmids indicated as GFP, H1.2, MTA1, and H1.2T146E (0.5, 1, and 2 μg, respectively), and relative expression of MTA1 and H1.2 were determined by Western blotting. Shown are representative blots from three independent experiments. (B) Cell viability was detected in the transfected HuH6 cells. **P < 0.01, t-test. (C,D) Colony formation experiment was performed using soft agar. Representative images (C) and quantification of numbers of colonies (D) in the transfected HuH6 cells. **P < 0.01, t-test. (E,F) Transwell assays were performed in the transfected HuH6 cells. Shown are representative images (E) and quantification (F) of the migrating cells (F).**P < 0.01, t-test.The effect on cell proliferation was mimicked in colony formation assays. There were significantly greater number of colonies in MTA1/H1.2-transfected group compared with EGFP/H1.2 control group (Figures 2C,D). H1.2T146E overexpression suppressed the colony formation (Figures 2C,D). Moreover, Transwell assays indicated that MTA1 overexpression promoted migration of HuH6 cells (Figures 2E,F), but the promigration effect of MTA1 was reversed by H1.2T146E overexpression (Figures 2E,F). Taken together, these results elucidated that MTA1-mediated suppression of H1.2 phosphorylation is critical for MTA1's role in promoting cell proliferation, anchorage-independent growth, and in vitro migration in the HuH6 cells.
H1.2T146ph Is Involved in the Regulation of MTA1 Target Genes
We next determined why or how dephosphorylation of H1.2 at T146 impacted MTA1-induced cellular functions. mRNA expression of known MTA1 target genes were determined in HuH6 cells transfected as described in Figure 2 (19, 20). Matrix metallopeptidase (MMP)-9, MMP-7, and cyclin D1 mRNA expression levels were significantly upregulated, whereas NT5E, GDF15, and CARD16 mRNA expression levels were significantly reduced after MTA1 overexpression according to the real-time PCR results (Figure 3A). Importantly, the expression of those genes could be partially reversed by overexpression of H1.2T146E (Figure 3A). Since MMP-7 and MMP-9 function in cell migration and cyclin D1 is known to be involved in cell proliferation (19, 20), these results explained why ectopic overexpression of the phosphomimic H1.2 impacted MTA1-mediated cell proliferation and migration.
Figure 3
Transcription of metastasis-associated 1 (MTA1)-targeted genes were partially rescued by increased expression of histone cluster 1 H1 family member c at threonine-146 residue (H1.2T146ph). (A) Expressions of genes were tested using quantitative reverse transcription PCR (qRT-PCR) in HuH6 cells transfected with pEGFP-N1 + H1.2, pEGFP-MTA1 + H1.2, pEGFP-MTA1 + H1.2T146E plasmids (indicated as GFP, +H1.2, MTA1 + H1.2, and MTA1 + H1.2T146E, respectively). **P < 0.01, t-test. (B) Interaction of H1.2T146ph with the indicated genes was determined by chromatin immunoprecipitation (ChIP) assays in HuH6 cells transfected with pEGFP-N1 + H1.2 and pEGFP-MTA1 + H1.2 plasmids (indicated as GFP + H1.2 and MTA1 + H1.2, respectively). **P < 0.01, t-test.
Transcription of metastasis-associated 1 (MTA1)-targeted genes were partially rescued by increased expression of histone cluster 1 H1 family member c at threonine-146 residue (H1.2T146ph). (A) Expressions of genes were tested using quantitative reverse transcription PCR (qRT-PCR) in HuH6 cells transfected with pEGFP-N1 + H1.2, pEGFP-MTA1 + H1.2, pEGFP-MTA1 + H1.2T146E plasmids (indicated as GFP, +H1.2, MTA1 + H1.2, and MTA1 + H1.2T146E, respectively). **P < 0.01, t-test. (B) Interaction of H1.2T146ph with the indicated genes was determined by chromatin immunoprecipitation (ChIP) assays in HuH6 cells transfected with pEGFP-N1 + H1.2 and pEGFP-MTA1 + H1.2 plasmids (indicated as GFP + H1.2 and MTA1 + H1.2, respectively). **P < 0.01, t-test.To determine if the MTA1 target genes were epigenetically regulated by H1.2T146ph, we performed ChIP analysis. Data analysis revealed that H1.2T146ph bind to the promotor region of MTA1 target genes (Figure 3B). Given that not all mRNAs were up- or downregulated by phosphorylated H1.2, it would be indicative that there are other epigenetic factors impacting transcription of the MTA1 targets. Taken together, we concluded that H1.2T146ph could regulate the expression of MTA1 target genes through binding to the promotor region of these genes in vitro.
Ectopic Expression of DNA-PK Inhibited MTA1-Induced H1.2 Dephosphorylation
Given that DNA-PK phosphorylates H1.2 at T146 site (15), we next determined if ectopic expression of DNA-PK could reverse dephosphorylation of H1.2T146ph in MTA1-overexpressed cells. HuH6 cells were transfected with HA-tagged DNA-PK overexpression plasmid (DNA-PK-HA). Successful overexpression was verified by PCR (Figure 4A) and Western blot (Figure 4B). Ectopic overexpression of DNA-PK did not impact total H1.2 expression (Figure 4C). However, overexpression of DNA-PK rescued MTA1-mediated dephosphorylation of H1.2 (Figure 4C), reduced MTA1-mediated cell migration (Figures 4D,E), and cell proliferation (Figure 4F). Decrease in cell proliferation was associated with increased G0/G1 phase cell ratio and decreased cell ratio in S phase (Figure 4G). Taken together, these results suggested that inhibition of DNA-PK-mediated H1.2 phosphorylation is central to MTA1's role in in vitro cell proliferation, growth, and migration in HuH6 cells.
Figure 4
Ectopic expression of DNA protein kinase (DNA-PK) inhibited metastasis-associated 1 (MTA1)-induced histone cluster 1 H1 family member c (H1.2) dephosphorylation and pro-oncogenic functions of MTA1. (A) Messenger RNA expression of DNA-PK was determined by PCR in HuH6 cells transfected with DNA-PK-HA expressing or pCMV-HA control plasmids. (B) Protein expression of DNA-PK was determined by Western blotting in HuH6 cells transfected with DNA-PK-HA-expressing or pCMV-HA control plasmids. (C) Western blotting in HuH6 cells cotransfected with pEGFP-MTA1 or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids. (D,E) Transwell assays were performed in HuH6 cells transfected with pEGFP-MTA1 or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids as indicated (MTA1, GFP, DNA-PK, or pCMV, respectively). Shown are representative images (D) and quantification of data obtained from three independent experiments (E). **P < 0.01, t-test. (F) Cell viability were detected in HuH6 cells transfected with pEGFP-K-MTA1G12V/T35S or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids as indicated (MTA1, GFP, DNA-PK, or pCMV, respectively) and increasing amounts of DNA-PK-HA expressing plasmid were used (0.5, 1 μg). **P < 0.01, t-test. (G) Cell cycle progression was measured using flow cytometry in HuH6 cells transfected with pEGFP-K-MTA1G12V/T35S or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids as indicated (MTA1, GFP, DNA-PK, or pCMV, respectively) and increasing amounts of DNA-PK-HA-expressing plasmid were used (0.5, 1 μg).
Ectopic expression of DNA protein kinase (DNA-PK) inhibited metastasis-associated 1 (MTA1)-induced histone cluster 1 H1 family member c (H1.2) dephosphorylation and pro-oncogenic functions of MTA1. (A) Messenger RNA expression of DNA-PK was determined by PCR in HuH6 cells transfected with DNA-PK-HA expressing or pCMV-HA control plasmids. (B) Protein expression of DNA-PK was determined by Western blotting in HuH6 cells transfected with DNA-PK-HA-expressing or pCMV-HA control plasmids. (C) Western blotting in HuH6 cells cotransfected with pEGFP-MTA1 or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids. (D,E) Transwell assays were performed in HuH6 cells transfected with pEGFP-MTA1 or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids as indicated (MTA1, GFP, DNA-PK, or pCMV, respectively). Shown are representative images (D) and quantification of data obtained from three independent experiments (E). **P < 0.01, t-test. (F) Cell viability were detected in HuH6 cells transfected with pEGFP-K-MTA1G12V/T35S or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids as indicated (MTA1, GFP, DNA-PK, or pCMV, respectively) and increasing amounts of DNA-PK-HA expressing plasmid were used (0.5, 1 μg). **P < 0.01, t-test. (G) Cell cycle progression was measured using flow cytometry in HuH6 cells transfected with pEGFP-K-MTA1G12V/T35S or pEGFP-N1 plasmids and DNA-PK-HA-expressing or pCMV-HA plasmids as indicated (MTA1, GFP, DNA-PK, or pCMV, respectively) and increasing amounts of DNA-PK-HA-expressing plasmid were used (0.5, 1 μg).
MTA1-Mediated Proteasomal Degradation of DNA-PK
Next, we investigated whether MTA1 could regulate the expression of DNA-PK. MTA1 overexpression did not affect mRNA expression of DNA-PK (Figure 5A) but downregulated protein expression (Figure 5B) in the HuH6 cells. Treatment with the proteasomal inhibitor MG-132 rescued DNA-PK protein expression in the MTA1-transfected cells (Figure 5C), indicating that DNA-PK is actively getting degraded in HCC cancer cells. Similar results were obtained when the experiments were repeated over a time course (Figure 5D). Taken together, our results indicated that MTA1-mediated HCC disease progression occurs at least in part by promoting degradation of DNA-PK and subsequent dephosphorylation of the epigenetic regulator H1.2.
Figure 5
Metastasis-associated 1 (MTA1) overexpression was associated with DNA protein kinase (DNA-PK) degradation. (A) Semiquantitative PCR was performed to assess DNA-PK messenger RNA (mRNA) expression in HuH6 cells transfected with pEGFP-MTA1 or pEGFP-N1. (B) Whole cell extracts from HuH6 cells that were transfected with DNA-PK-HA, pEGFP-MTA1, or pEGFP-N1 plasmids (left panel) and pEGFP-MTA1 or pEGFP-N1 plasmids were analyzed using Western blotting. (C) Western blotting results were shown in MG132 or dimethyl sulfoxide (DMSO)-treated HuH6 cells after transfecting with indicated plasmids. (D) Whole cell extracts from HuH6 cells that were untreated (the samples were collected at 24, 48, and 51 h following transfection, left panel) or treated with MG132 (MG132 was added at 48 h following transfection, and the samples were collected at 24, 48, 51, and 54 h following transfection; right panel) were analyzed using Western blotting.
Metastasis-associated 1 (MTA1) overexpression was associated with DNA protein kinase (DNA-PK) degradation. (A) Semiquantitative PCR was performed to assess DNA-PK messenger RNA (mRNA) expression in HuH6 cells transfected with pEGFP-MTA1 or pEGFP-N1. (B) Whole cell extracts from HuH6 cells that were transfected with DNA-PK-HA, pEGFP-MTA1, or pEGFP-N1 plasmids (left panel) and pEGFP-MTA1 or pEGFP-N1 plasmids were analyzed using Western blotting. (C) Western blotting results were shown in MG132 or dimethyl sulfoxide (DMSO)-treated HuH6 cells after transfecting with indicated plasmids. (D) Whole cell extracts from HuH6 cells that were untreated (the samples were collected at 24, 48, and 51 h following transfection, left panel) or treated with MG132 (MG132 was added at 48 h following transfection, and the samples were collected at 24, 48, 51, and 54 h following transfection; right panel) were analyzed using Western blotting.
MDM2 Mediated MTA1-Induced DNA-PK Degradation
Given that MTA1 has been shown to regulate protein stability via ubiquitination by E3 ubiquitin ligases mouse double minute 2 (Mdm2) (21), we analyzed whether MDM2 participated in MTA1-induced DNA-PK degradation. Cells were cotransfected with MTA1 and HA-tagged DNA-PK with or without His-tagged MDM2 plasmid. Transfection of MDM2 downregulated expression of HA-DNA-PK (Figure 6A). Similar results were obtained when endogenous DNA-PK levels were checked posttransfection with MDM2 (Figure 6B). That this was a direct effect of MDM2 on DNA-PK degradation was confirmed by the fact that transfection with a mutant MDM2 did not degrade exogenous or endogenous DNA-PK (Figures 6C,D).
Figure 6
The metastasis-associated 1 (MTA1)-induced degradation of DNA protein kinase (DNA-PK) was mediated by mouse double minute 2 (MDM2). (A) Western blotting was performed in HuH6 cells cotransfected with DNA-PK-HA, pEGFP-MTA1, pEGFP-N1 plasmids, and increasing amounts of MDM2-His plasmid (0.5 and 1 μg). (B) Western blotting was performed in HuH6 cells cotransfected with pEGFP-MTA1, pEGFP-N1 plasmids, and increasing amounts of MDM2-His plasmid (0.5 and 1 μg). (C) Western blotting was performed in HuH6 cells cotransfected with pEGFP-MTA1, pEGFP-N1, MDM2-His, and MDM2-mutated plasmids. (D) Whole cell extracts from HuH6 cells transfected with pEGFP-N1, pEGFP-MTA1, MDM2-His, and MDM2-mutated plasmids were analyzed using Western blotting. (E) Whole cell extracts from HuH6 cells that were transfected with pEGFP-N1 or pEGFP-MTA1 were analyzed using Western blotting. Shown are representative blots and quantification of three independent experiments, *P < 0.05; **P < 0.01, t-test. (F) Whole cell extracts from HuH6 cells that were transfected with control small-interfering RNA (siRNA) or MDM2 siRNA were analyzed using Western blotting. Shown are representative blots and quantification of three independent experiments, *P < 0.05, t-test. (G) Whole cell extracts from pEGFP-N1 or pEGFP-MTA1-transfected HuH6 cells that were treated with control siRNA or MDM2 siRNA were analyzed using Western blotting. Shown are representative blots and quantification of three independent experiments, **P < 0.01, t-test.
The metastasis-associated 1 (MTA1)-induced degradation of DNA protein kinase (DNA-PK) was mediated by mouse double minute 2 (MDM2). (A) Western blotting was performed in HuH6 cells cotransfected with DNA-PK-HA, pEGFP-MTA1, pEGFP-N1 plasmids, and increasing amounts of MDM2-His plasmid (0.5 and 1 μg). (B) Western blotting was performed in HuH6 cells cotransfected with pEGFP-MTA1, pEGFP-N1 plasmids, and increasing amounts of MDM2-His plasmid (0.5 and 1 μg). (C) Western blotting was performed in HuH6 cells cotransfected with pEGFP-MTA1, pEGFP-N1, MDM2-His, and MDM2-mutated plasmids. (D) Whole cell extracts from HuH6 cells transfected with pEGFP-N1, pEGFP-MTA1, MDM2-His, and MDM2-mutated plasmids were analyzed using Western blotting. (E) Whole cell extracts from HuH6 cells that were transfected with pEGFP-N1 or pEGFP-MTA1 were analyzed using Western blotting. Shown are representative blots and quantification of three independent experiments, *P < 0.05; **P < 0.01, t-test. (F) Whole cell extracts from HuH6 cells that were transfected with control small-interfering RNA (siRNA) or MDM2 siRNA were analyzed using Western blotting. Shown are representative blots and quantification of three independent experiments, *P < 0.05, t-test. (G) Whole cell extracts from pEGFP-N1 or pEGFP-MTA1-transfected HuH6 cells that were treated with control siRNA or MDM2 siRNA were analyzed using Western blotting. Shown are representative blots and quantification of three independent experiments, **P < 0.01, t-test.Elevated MDM2 expression was found after the MTA1 overexpression in cells (Figure 6E). This resulted in the downregulation of DNA-PK and decreased phosphorylation of H1.2 (Figure 6E). siRNA-mediated knockdown of MDM2 (Figure 6F) rescued MTA1-mediated downregulation of phosphorylated H1.2 (Figure 6G), indicating that DNA-PK is a bona fide target of MDM2-mediated ubiquitination.Finally, to confirm if our observations translate to patient samples, we performed immunohistochemistry (IHC) to detect MTA1 expression in tissue samples obtained from HCC patients and tumor adjacent normal tissue (normal liver) (Figure 7). MTA1 expression was significantly higher, whereas both DNA-PK and phosphorylated H1.2 were significantly lower in HCC tissues compared to tumor-adjacent normal liver tissues (Figures 7A–C). Taken together, our results confirmed that MTA1-mediated induction of MDM2 is actively degrading DNA-PK resulting in decrease in phosphorylated H1.2.
Figure 7
Metastasis-associated 1 (MTA1) expression was negatively correlated with DNA protein kinase (DNA-PK) and phosphorylated histone cluster 1 H1 family member c (H1.2) in hepatocellular carcinoma (HCC) tumor samples. Immunohistochemistry (IHC) analyses of MTA1, DNA-PK, and phosphorylated H1.2 in HCC tumor tissue (A) and tumor-adjacent normal tissue specimen (B). Shown are representative images obtained from nine patients (A,B) and quantification of IHC score (C) based on percent staining and intensity of staining—where 1 was the lowest score, and 5 was the highest score. Scale bar, 30 μm.
Metastasis-associated 1 (MTA1) expression was negatively correlated with DNA protein kinase (DNA-PK) and phosphorylated histone cluster 1 H1 family member c (H1.2) in hepatocellular carcinoma (HCC) tumor samples. Immunohistochemistry (IHC) analyses of MTA1, DNA-PK, and phosphorylated H1.2 in HCC tumor tissue (A) and tumor-adjacent normal tissue specimen (B). Shown are representative images obtained from nine patients (A,B) and quantification of IHC score (C) based on percent staining and intensity of staining—where 1 was the lowest score, and 5 was the highest score. Scale bar, 30 μm.
Discussion
Metastasis-associated proteins (MTAs) are a family of transcriptional co-regulators and related with tumor metastasis (19). MTA1 is one of the family members and can modulate differential gene expressions via epigenetic changes of the target gene chromatin. On the other hand, elevated expression of MTA1 is frequently found and suggested to be a novel predictor and potential therapeutic target for HCC. Furthermore, MTA1 had been found to regulate the response of different genes such as p53 and c-Myc (19). MTA1 can be induced by metabolic stress like hypoxia and in turn can contribute to hypoxia-inducible factor 1-alpha (HIF1α) stabilization and tumor metastasis (22, 23). Other epigenetic factors like microRNAs can regulate MTA1 expression as well (24).Importantly, MTA1 is a subunit of the nucleosome remodeling and deacetylase (NuRD) (25). MTA1 can exhibit dual co-regulatory activity, acting as both co-activator and co-repressor, based on distinct chromatin remodeling components it associates within the context of target gene nucleosome landscape and upstream signaling (25). Even in the current study, we observed that some of the MTA1 targets were transcriptionally upregulated, whereas the others were downregulated, indicating that the observed role of MTA1 in HCC is closely linked to its participation in the NuRD complex.MDM2 protein is overexpressed in multiple types of tumors and thought as one of the reasons for cancer progression (26). MDM2 and p53 form an autoregulatory feedback loop that regulates each other's cellular expression level and thus maintain a low level of p53 in normal cells (17, 18). The results of our study indicate that DNA-PK is also a substrate of MDM2 that functions as an effector of the oncogenic functions of MTA1.Our results indicate that MTA1 can promote protumorigenic and prometastatic behavior in HCC via inhibiting phosphorylation-dependent activation of H1.2. Our results indicate that MTA1's action might be mediated by MMP-7, MMP-9, and cyclin D1. However, a caveat of our study was that direct evidence was not provided that these are the only genes through which the action of MTA1 on HCC is being mediated.Our results confirmed that phosphorylated H1.2T146 binds to the promotor region of MTA1 target genes. Our results show that MTA1-induced MDM2 degrades DNA-PK, which thus results in decreased levels of functionally active H1.2 in HCC cells. Even in patients with HCC, MTA1 expression was higher compared to tumor-adjacent normal tissue, and the high expression of MTA1 was correlated with low DNA-PK and phosphorylated H1.2. These results reveal an important therapeutic axis in HCC.It remains to be investigated if additional kinases can modify H1.2 or if other E3 ligases can modulate expression of DNA-PK. We did not investigate the affinity between DNA-PK and its substrates after overexpression of different plasmids. A decrease in the affinity between DNA-PK and its substrates would also influence the results simultaneously. Finally, it remains to be determined if the cellular localization of DNA-PK changed after MTA1 overexpression since this will also lead to the decreased amount of DNA-PK bound to the substrate, leading to the downregulation of H1.2T146ph level.
Data Availability Statement
All the data used to support the findings of this study are included within the article. Any additional information is available from the corresponding author.
Author Contributions
Y-HL and X-FT conceived, designed, and performed experiments. MZ performed experiments. H-LZ analyzed experimental results. Y-HL wrote the manuscript. All authors read and approved the final manuscript.
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Authors: Freddie Bray; Jacques Ferlay; Isabelle Soerjomataram; Rebecca L Siegel; Lindsey A Torre; Ahmedin Jemal Journal: CA Cancer J Clin Date: 2018-09-12 Impact factor: 508.702
Authors: Maria Rita Braghini; Oriana Lo Re; Ilaria Romito; Maite G Fernandez-Barrena; Barbara Barbaro; Silvia Pomella; Rossella Rota; Manlio Vinciguerra; Matias A Avila; Anna Alisi Journal: J Exp Clin Cancer Res Date: 2022-03-24