Literature DB >> 32431212

Sodium Tanshinone IIA Sulfonate Attenuates Tumor Oxidative Stress and Promotes Apoptosis in an Intermittent Hypoxia Mouse Model.

Xiao-Bin Zhang1, Xiao-Yang Chen2, Peng Sun1, Xiao-Man Su1, Hui-Qing Zeng1, Yi-Ming Zeng2, Miao Wang1, Xiongbiao Luo3.   

Abstract

OBJECTIVE: Intermittent hypoxia, a significant feature of obstructive sleep apnea, has pro-tumorigenic effects. Here, we investigated the effect of sodium tanshinone IIA sulfonate on oxidative stress and apoptosis in a mouse model of Lewis lung carcinoma with intermittent hypoxia.
METHODS: Mice were randomly assigned to normoxia (control), normoxia plus sodium tanshinone IIA sulfonate (control + sodium tanshinone IIA sulfonate), intermittent hypoxia, and intermittent hypoxia + sodium tanshinone IIA sulfonate groups. Intermittent hypoxia administration lasted 5 weeks in the intermittent hypoxia groups. Lewis lung carcinoma cells were injected into the right flank of each mouse after 1 week of intermittent hypoxia exposure. Sodium tanshinone IIA sulfonate was injected intraperitoneally in the control + sodium tanshinone IIA sulfonate and intermittent hypoxia + sodium tanshinone IIA sulfonate groups. Tumor oxidative stress was evaluated by detection of malondialdehyde and superoxide dismutase. The apoptosis of tumor cells was evaluated by the terminal deoxynucleotidyl transferase dUTP nick-end labeling assay as well as by Western blot analysis of B-cell lymphoma 2-associated X protein and cleaved caspase-3 expression. Additionally, the expression of hypoxia-induced factor-1α, nuclear factor erythroid 2-related factor 2, and nuclear factor kappa B was also evaluated by Western blot.
RESULTS: Compared with the control group, the intermittent hypoxia treatment significantly increased Lewis lung carcinoma tumor growth and oxidative stress (serum malondialdehyde) but decreased serum levels of SOD and pro-apoptotic markers (terminal deoxynucleotidyl transferase dUTP nick-end labeling staining, B-cell lymphoma 2-associated X protein, and cleaved caspase-3). These changes were significantly attenuated by intraperitoneal injection of sodium tanshinone IIA sulfonate. Lower nuclear factor erythroid 2-related factor 2 and higher nuclear factor kappa B levels in the intermittent hypoxia group were clearly reversed by sodium tanshinone IIA sulfonate treatment. In addition, sodium tanshinone IIA sulfonate administration decreased the high expression of hypoxia-induced factor-1α induced by intermittent hypoxia.
CONCLUSION: Intermittent hypoxia treatment resulted in high oxidative stress and low apoptosis in Lewis lung carcinoma-implanted mice, which could be attenuated by sodium tanshinone IIA sulfonate administration possibly through a mechanism mediated by the nuclear factor erythroid 2-related factor 2/nuclear factor kappa B signaling pathway.

Entities:  

Keywords:  apoptosis; intermittent hypoxia; oxidative stress; sodium tanshinone IIA sulfonate; tumor

Mesh:

Substances:

Year:  2020        PMID: 32431212      PMCID: PMC7249596          DOI: 10.1177/1533033820928073

Source DB:  PubMed          Journal:  Technol Cancer Res Treat        ISSN: 1533-0338


Introduction

Sodium tanshinone IIA sulfonate (TSA) is a natural compound extracted from the Chinese herb Salvia miltiorrhiza. Previous studies have indicated that TSA has antioxidant and anti-inflammatory effects through reduction of reactive oxygen species (ROS) production and alleviation of pro-inflammatory cytokines.[1,2] Studies have shown that TSA is extensively applied for cardiovascular disease and inflammatory disorders, such as chronic hepatitis.[3,4] Recent in vitro studies revealed the anticancer activity of TSA in many cancer types including lung cancer, leukemia, liver cancer, and gastric cancer.[5-8] Indeed, an in vivo study also verified the anticancer activity of TSA.[9] The anticancer effects of TSA may be partly attributed to its antioxidant and proapoptotic properties.[6,9] Obstructive sleep apnea (OSA) is a disorder with high global prevalence (15% to 24%).[10-12] Obstructive sleep apnea is characterized by recurrent cycles of intermittent hypoxia (IH), which contributes to systematic inflammation, oxidative stress, endothelial dysfunction, and apoptosis.[13,14] During the last decade, a considerable amount of literature has shown a higher cancer incidence and mortality in OSA patients.[15,16] In addition, a study by our group and others demonstrated that IH induced tumor growth, invasion, and metastasis in mouse models of sleep apnea.[17-20] Based on the abovementioned findings, we hypothesized that oxidative stress and apoptosis may play important roles in the pathogenesis of cancer progression accelerated by IH. Sodium tanshinone IIA sulfonate has antioxidative activity that partially attenuates OSA-induced tumor growth. Thus, the aim of this study was to assess the effects and underlying molecular mechanisms of TSA on tumor oxidative stress and apoptosis in an IH mouse model mimicking OSA.

Materials and Methods

Animals and Groups

Forty-eight 7-week-old male C57BL/6 mice were purchased from the Chinese Academy of Science Laboratory Animals Center (Shanghai, China). All mice were housed in standard cages with a 12:12-hour light-dark cycle and free access to water and food. Mice were randomly assigned to the following groups (n = 12 in each group): normoxia (control, CTL), control plus TSA (CTL + TSA), IH, and IH plus TSA (IH + TSA). The body weight of the mice in each group was measured every week.

Ethical Approval

The study protocol was approved by the ethics committee of Zhongshan Hospital, Xiamen University (approval no. 2017-015) and conducted in accordance with the Guide for the Care and Use of Laboratory Animals.[21]

IH Exposure

Intermittent hypoxia exposure was conducted as described previously.[20,22-24] Briefly, mice in the IH and IH + TSA groups (n = 24) were placed in a self-made plexiglass chamber with 1-way valves in which the gas flow of oxygen, nitrogen, and compressed air was controlled by a program to enable alteration of the oxygen concentration from 21% to nadir 6% to 8%. The cycle time of hypoxia (6% to 8%) and reoxygenation (21%) was 120 seconds. Intermittent hypoxia exposure was conducted from 8:00 am to 4:00 pm daily for 5 consecutive weeks.

Cell Culture, Tumor Implantation, and Measurement

Lewis lung carcinoma (LLC) cells (CoBioer Biosciences) were cultured according to the manufacturer’s instructions. Briefly, LLC cells were maintained in high-glucose Dulbecco’s Modified Eagle’s Medium and supplemented with 10% fetal bovine serum (Gibco). A total of 1 × 106 LLC cells in 100-µL phosphate-buffered saline (PBS) were subcutaneously injected into the right flank of each mouse in week 1 of the experiment. When the tumor was palpable, its width (W) and length (L) were recorded with an electric caliper weekly. Tumor volume (V, mm3) was calculated as W2 × L/2.

Drug Administration

Once tumor volume reached approximately 200 mm3 (about 5-7 days after LLC injection), mice in the CTL + TSA and IH + TSA groups were intraperitoneally injected daily with TSA (10 mg/kg; Shanghai No.1 Biochemical & Pharmaceutical).[2,25-27] Meanwhile, mice in the CTL and IH groups were intraperitoneally injected with the same volume of saline.

Serum and Tissue Sample Preparation from LLC-Implanted Mice

At 5 weeks after LLC implantation, all mice were deeply anesthetized with pentobarbital and exsanguinated by cardiac puncture, after which plasma was isolated. After excision and weighing, the tumors were either frozen in liquid nitrogen/−80 °C freezer (for further analysis) or fixed in buffered 10% formalin for histological examination.

Oxidative Stress Measurement

Two of the most common indicators of oxidative stress, malondialdehyde (MDA) and superoxide dismutase (SOD), were assayed using relevant kits according to the manufactures’ instructions (Catalog numbers: S0131 and S0087; Beyotime Biotechnology). Briefly, the frozen tumor tissue samples were homogenized with a 5-mL glass Potter-Elvehjem homogenizer in ice-cold PBS (10% Wt/Vol).[22,28] After lysis for 15 minutes on ice, the homogenates were centrifuged and the supernatants were obtained for further investigation. Malondialdehyde concentration in the homogenates was determined spectrophotometrically by measuring the presence of thiobarbituric acid reactive substances (utilizing the principle of the thiobarbituric acid colorimetric method).[29,30] Superoxide dismutase was detected by a corresponding assay kit based on the principle of the WST-8 colorimetric reaction, which employs a thiazole salt for detection of superoxide anions by producing a colored product. The amount (mg) of enzyme that transformed 1-μmol substrate (superoxide radical for SOD) in 1 minute was defined as 1 enzyme activity unit. The absorbance of the MDA and SOD assays was measured at wavelengths of 535 and 560 nm, respectively.

Quantitative Polymerase Chain Reaction

TRIzol reagent (Invitrogen) was used for total messenger RNA extraction from the tumors, according to the manufacturer’s instructions (TakaRa Biotechnology). Then 2-mg total RNA was reverse-transcribed using TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) to obtain the first-strand complementary DNA. Next, 1 µL of the complementary DNA was applied as template for the quantitative polymerase chain reaction (qPCR) using SYBR Green PCR reagent kit (Toyobo Co) in the Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems) under the following conditions: 95 °C for 30 seconds, followed by 40 cycles at 95 °C for 3 seconds and 60 °C for 30 seconds. The primers used in the qPCR reactions are outlined in Table 1. The relative gene expression levels were calculated with 2−ΔΔCt. β-Actin was used as the internal reference.
Table 1.

Primers Used in the RT-PCR Analysis.

Primer nameForwardReverse
HIF-1αCGACCACTGCTAAGGCATCAAGTGGCAGACAGGTTAAGGC
β-actinCCACTGCCGCATCCTCTTCCCTCGTTGCCAATAGTGATGACCTG

Abbreviation: RT-PCR, reverse transcription polymerase chain reaction.

Primers Used in the RT-PCR Analysis. Abbreviation: RT-PCR, reverse transcription polymerase chain reaction.

Western Blot Analysis

Tumor tissues were homogenized with RIPA buffer (Beyotime) containing protease and phosphatase inhibitors in a glass homogenizer. After centrifugation, the supernatants were extracted and total protein concentration was measured with the bicinchoninic acid protein assay (Beyotime). Then the proteins were resolved on 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels (40 µg/lane) and electrotransferred onto polyvinylidene fluoride (PVDF) membranes (Millipore). After blocking in 5% (Wt/Vol) skim milk, the membrane was incubated with the following antibodies at 4 °C overnight: mouse anti-hypoxia-induced factor-1α (HIF-1α) monoclonal antibody (1:250; Novus Biologicals), rabbit anti-B-cell lymphoma 2-associated protein X (BAX;1:1000; Cell Signaling Technology [CST]), rabbit anti-cleaved caspase-3 (1:1000; CST), rabbit antinuclear factor erythroid 2-related factor 2 (Nrf2; 1:2000; Abcam), rabbit antinuclear factor kappa B (NF-κB) p65 (1:1000; CST), rabbit anti-phosphorylated NF-κB (p-NF-κB) p65 (1:1000; CST), or mouse anti-β-actin (1:2000; Santa Cruz Biotechnology). After rinsing 3 times with Tris-buffered saline, 0.1% Tween-20 (TBST), the PVDF membranes were incubated with goat anti-rabbit or goat anti-mouse IgG horseradish peroxidase-conjugated antibody (1:10000; Santa Cruz Biotechnology) at 37 °C for 1 hour. After 3 washes with TBST, the membranes were developed using an enhanced chemiluminescence kit (Clarity Western ECL Substrate; Bio-Rad). The protein bands were visualized using ImageQuant LAS 400 Mini (GE Healthcare Life Sciences). Each experiment was repeated in triplicate. Densitometry was done using Image J analysis software (National Institutes of Health).

Terminal Deoxynucleotidyl Transferase dUTP Nick-End Labeling Assay

Tumor tissues were fixed in 10% formalin for 24 hours, dehydrated in graded series of alcohol, cleaned with xylene, and then embedded in paraffin. The embedded tissues were sectioned to 5 μm, placed on glass slides, and washed with PBS. Then the terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay was performed at 37 °C for 1 hour using the In Situ Cell Death Detection Kit (Roche). After washing with PBS and incubation with 4′, 6-diamidino-2-phenylindole (Sigma) for 5 minutes, the TUNEL-stained cells were analyzed and photographed with a microscope (SPII2-AOBS; Leica) at a 400× magnification. Both TUNEL-positive cells and total cells were counted in 5 sections of each group. The apoptotic rate was calculated as follows: TUNEL-positive cell number/total cell number × 100%.

Statistical Analysis

GraphPad Prism software 5.0 (GraphPad Software, Inc.) was conducted to analyze the data. All data are presented as the mean ± standard deviation and were compared using an analysis of variance followed by the Fisher exact test. A P value less than .05 indicated statistical significance.

Results

TSA Injection Significantly Reduces IH-Induced Elevation in Tumor Volume and Tumor Weight

During the 5 weeks of the experiment, no mouse died and no severe TSA-related adverse event occurred in any group. Mice administered IH clearly lost body weight in weeks 2 to 5 (P < .05) compared with the CTL group (Figure 1A). However, both tumor volume (p < .05) and tumor weight (P < .001) in the IH group were obviously higher than those in the CTL group in the fifth week (Figure 1B-D). Sodium tanshinone IIA sulfonate injection (IH + TSA group) significantly reduced IH-induced increases in tumor volume (P < .01) and tumor weight (P < .05) compared with the IH group (Figure 1B-D).
Figure 1.

TSA injection significantly reduces IH-induced increases in tumor volume and tumor weight. A, The body weight of mice was measured at the indicated weeks after IH administration in the CTL, CTL + TSA, IH, and IH + TSA groups. B, Tumor volume in the indicated groups was measured at 14, 21, 28, and 35 days after IH administration. C, Tumor weight in the indicated groups was estimated in the fifth week after IH. Data represent the mean of independent assays performed in triplicate. P values are noted above the corresponding groups. D, The representative tumor size in each group was photographed. CTL indicates control; IH, intermittent hypoxia; TSA, sodium tanshinone IIA sulfonate.

TSA injection significantly reduces IH-induced increases in tumor volume and tumor weight. A, The body weight of mice was measured at the indicated weeks after IH administration in the CTL, CTL + TSA, IH, and IH + TSA groups. B, Tumor volume in the indicated groups was measured at 14, 21, 28, and 35 days after IH administration. C, Tumor weight in the indicated groups was estimated in the fifth week after IH. Data represent the mean of independent assays performed in triplicate. P values are noted above the corresponding groups. D, The representative tumor size in each group was photographed. CTL indicates control; IH, intermittent hypoxia; TSA, sodium tanshinone IIA sulfonate.

TSA Effectively Attenuates IH-Induced Tumor Oxidative Stress

To evaluate the tumor oxidative state, serum levels of MDA and SOD were detected using colorimetric and enzymatic assays. Malondialdehyde serum level in the IH group was significantly higher than that in the CTL group (P < .05). Notably, TSA injection (IH + TSA group) significantly decreased MDA level compared with the IH group (P < .01). On the other hand, SOD serum level in the IH group was significantly reduced compared to the CTL group (P < .01). TSA injection (IH + TSA group) significantly increased SOD level compared with the IH group (P < .01; Figure 2).
Figure 2.

TSA effectively attenuates IH-induced tumor oxidative stress. A, Serum levels of MDA and B, SOD in the indicated groups were detected in the fifth week after IH administration using colorimetric and enzymatic assays. Data represent the mean of independent experiments. P values are noted above the corresponding groups. CTL indicates control; IH, intermittent hypoxia; MDA, malondialdehyde; SOD, superoxide dismutase; TSA, sodium tanshinone IIA sulfonate.

TSA effectively attenuates IH-induced tumor oxidative stress. A, Serum levels of MDA and B, SOD in the indicated groups were detected in the fifth week after IH administration using colorimetric and enzymatic assays. Data represent the mean of independent experiments. P values are noted above the corresponding groups. CTL indicates control; IH, intermittent hypoxia; MDA, malondialdehyde; SOD, superoxide dismutase; TSA, sodium tanshinone IIA sulfonate.

IH Administration Increases HIF-1α Expression in LLC

Hypoxia-induced factor-1α gene and protein expressions in LLC tumors were markedly increased in the IH group compared with the CTL group (P < .001). However, TSA injection did not attenuate the IH-induced elevation of HIF-1α expression in either the CTL or IH group (P > .05; Figure 3).
Figure 3.

IH administration increases HIF-1α expression in LLC-implanted mice. HIF-1α mRNA and protein expression was analyzed by qRT-PCR (A) and Western blotting (B) in LLC tumor samples in the indicated groups. β-actin was used as the endogenous reference. Data represent the mean of independent experiments performed in triplicate. P values are noted above the corresponding groups. CTL indicates control; HIF-1α, hypoxia-inducible factor-1 α; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; RT-PCR, real-time polymerase chain reaction; TSA, sodium tanshinone IIA sulfonate.

IH administration increases HIF-1α expression in LLC-implanted mice. HIF-1α mRNA and protein expression was analyzed by qRT-PCR (A) and Western blotting (B) in LLC tumor samples in the indicated groups. β-actin was used as the endogenous reference. Data represent the mean of independent experiments performed in triplicate. P values are noted above the corresponding groups. CTL indicates control; HIF-1α, hypoxia-inducible factor-1 α; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; RT-PCR, real-time polymerase chain reaction; TSA, sodium tanshinone IIA sulfonate.

TSA Significantly Promotes Tumor Apoptosis

Apoptotic factors BAX and cleaved caspase-3 were detected in the LLC tumor samples by Western blot analysis. Intermittent hypoxia administration (IH group) significantly decreased the protein expression of both BAX and cleaved caspase-3 (P < .001). Interestingly, TSA injection (IH + TSA group) significantly attenuated the IH-induced decrease of BAX and cleaved caspase-3 (P < .001; Figure 4A and B). Further detection of apoptosis in the LLC tumors by TUNEL staining showed that TSA injection (IH + TSA group) noticeably promoted apoptotic activity compared with the IH group (P < .001; Figure 4C).
Figure 4.

Pro-apoptotic activity of TSA in tumor samples from LLC-implanted mice. Protein expression of BAX (A) and cleaved caspase-3 (B) was analyzed by Western blotting of LLC tumor samples in the indicated groups. Upper panels are representative images; lower panels of the graphs are a summary of independent experiments performed in triplicate. β-actin was employed as the endogenous reference. Representative images of apoptotic cells stained with TUNEL are shown in C. Summary of independent TUNEL assays performed in triplicate are shown in C. P values are noted above the corresponding groups. BAX indicates B-cell lymphoma 2-associated protein X; CTL, control; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; TSA, sodium tanshinone IIA sulfonate; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling.

Pro-apoptotic activity of TSA in tumor samples from LLC-implanted mice. Protein expression of BAX (A) and cleaved caspase-3 (B) was analyzed by Western blotting of LLC tumor samples in the indicated groups. Upper panels are representative images; lower panels of the graphs are a summary of independent experiments performed in triplicate. β-actin was employed as the endogenous reference. Representative images of apoptotic cells stained with TUNEL are shown in C. Summary of independent TUNEL assays performed in triplicate are shown in C. P values are noted above the corresponding groups. BAX indicates B-cell lymphoma 2-associated protein X; CTL, control; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; TSA, sodium tanshinone IIA sulfonate; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling.

Signaling Pathways Underlying the Anticancer Activity of TSA in LLC

Western blot analysis showed that Nrf2 protein expression was downregulated in the IH group compared with the CTL group (P < .01). However, TSA treatment significantly reversed the IH-induced decrease of Nrf2 (Figure 5; P < .01). By contrast, the mean p-NF-κB p65 level was clearly upregulated after IH treatment (IH group) compared with the CTL group (P < .001). Notably, TSA treatment significantly attenuated the IH-induced increase of p-NF-κB p65 (Figure 6; P < .001).
Figure 5.

TSA attenuates the IH-induced decrease of Nrf2 protein expression. Western blot analysis of Nrf2 from LLC tumor samples in the indicated groups was conducted. β-actin was employed as the endogenous reference. The upper panel is a representative Western blot image of Nrf2. The lower panel is a summary of independent experiments performed in triplicate in the indicated groups. P values are noted above the corresponding groups. CTL indicates control; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; Nrf2, nuclear factor erythroid 2-related factor 2; TSA, sodium tanshinone IIA sulfonate.

Figure 6.

TSA attenuates the IH-induced upregulation of p-NF-κ protein expression. Western blot analysis of p-NF-κB p65 from LLC tumor samples in the indicated group was conducted. Total p65 was employed as the p65 loading reference. The upper panel is a representative Western blot image of p-NF-κB p65; the lower panel is a summary of independent experiments performed in triplicate in the indicated groups. P values are noted above the corresponding groups. CTL indicates control; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; NF-κB, nuclear factor kappa B; TSA, sodium tanshinone IIA sulfonate.

TSA attenuates the IH-induced decrease of Nrf2 protein expression. Western blot analysis of Nrf2 from LLC tumor samples in the indicated groups was conducted. β-actin was employed as the endogenous reference. The upper panel is a representative Western blot image of Nrf2. The lower panel is a summary of independent experiments performed in triplicate in the indicated groups. P values are noted above the corresponding groups. CTL indicates control; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; Nrf2, nuclear factor erythroid 2-related factor 2; TSA, sodium tanshinone IIA sulfonate. TSA attenuates the IH-induced upregulation of p-NF-κ protein expression. Western blot analysis of p-NF-κB p65 from LLC tumor samples in the indicated group was conducted. Total p65 was employed as the p65 loading reference. The upper panel is a representative Western blot image of p-NF-κB p65; the lower panel is a summary of independent experiments performed in triplicate in the indicated groups. P values are noted above the corresponding groups. CTL indicates control; IH, intermittent hypoxia; LLC, Lewis lung carcinoma; NF-κB, nuclear factor kappa B; TSA, sodium tanshinone IIA sulfonate.

Discussion

Recent studies have indicated that IH administration promotes tumor growth.[15-17,19] Our previous study confirmed this finding and showed that IH treatment clearly increased LLC growth in mice.[20,22] Here, we showed that not only the size but also the weight of the implanted LLC tumor significantly increased in the IH group. Excessive oxidative stress is one pathological characteristic of cancer. Growing data have shown that overproduction of ROS can significantly accelerate tumor cell proliferation, angiogenesis, invasiveness, and metastasis.[31] Antioxidant therapy can suppress ROS-driven tumor progression and metastasis,[32] although over-oxidative stress could be a strategy of anticancer therapy.[33] Studies have indicated that IH (a hallmark feature of OSA) upregulates oxidative stress in tumor models.[15-17,19] The underlying molecular mechanism of IH-induced tumor growth was investigated in this study in an LLC-implanted mouse model, showing that IH-treatment enhanced MDA levels but declined SOD activity in LLC-implanted mice, suggesting that excessive oxidative stress might be a mechanism to facilitate tumor growth. Hypoxia-induced factor-1α and other pro-inflammatory factors (eg, activator protein 1, p53, NF-κB) are regulated by redox, in which Nrf2, SOD, and redox factor-1 play crucial roles in many pathological processes.[34,35] Our data revealed that IH administration markedly decreased Nrf2 expression, accompanied by an increase in NF-κB and HIF-1α, indicating that inhibition of Nrf2 and upregulation of NF-κB and HIF-1α might be a mechanism of IH-induced tumor growth. Indeed, Zhou et al [36] found that overexpression of Nrf2 in the heart increased resistance to IH-induced injury, whereas knockout (KO) of Nrf2 resulted in high sensitivity to IH-induced injury in Nrf2-KO mice. These data suggest that Nrf2 acts as an antioxidative factor during IH. In an IH-treated rat model, Zhang et al [37] reported that both NF-κB and HIF-1α expression were significantly upregulated in the heart after 6 weeks of IH treatment. This finding indicates that NF-κB and HIF-1α play important roles in IH-induced heart injury. Our data showed similar findings in tumorigenesis. Sodium tanshinone IIA sulfonate is an extract of the Chinese herb S miltiorrhiza. Its anti-inflammatory and antioxidant activities are widely used in clinical practice to treat a large number of cardiovascular and organ system diseases.[3,25] More recently, experimental studies have illustrated that TSA exerts anticancer effects through antioxidant activity and apoptosis regulation.[6,7] These findings were confirmed in our study as well. Sodium tanshinone IIA sulfonate treatment suppressed IH-induced oxidative stress in the LLC-implanted tumor model through downregulation of NF-κB and elevation of both Nfr2 and SOD expression, but not of HIF-1α. Further studies are needed to determine how IH and TSA influence SOD production and affect the expression of those transcription factors. Numerous antioxidant processes involve activation of Nrf2-related signaling pathways.[38-40] Lower expression of Nrf2 has been observed in OSA patients and in IH animal models.[41,42] Our results are in accordance with previous studies showing that Nrf2 expression is downregulated in IH-treated LLC-implanted mice, which is attenuated by TSA treatment. NF-κB plays a crucial role in inflammation, oxidative stress, and apoptosis.[43,44] Previous studies have shown the importance of NF-κB in OSA and IH. Israel et al [45] showed that NF-κB is activated in children with OSA. Another study by Ryan and coworkers[46] showed that NF-κB-dependent gene expression was increased in OSA patients. Experimental studies have demonstrated that NF-κB is activated after exposing in mice or cells to IH.[24,47] Sodium tanshinone IIA sulfonate may protect against immune-mediated liver injury via the NF-κB signaling pathway in mice.[48] This study showed the activation (phosphorylation) of NF-κB in IH-treated LLC-implanted mice, which was attenuated by TSA administration. A large number of studies have demonstrated the correlation between Nrf2 and NF-κB[49-51]; however, the precise effects and underlying molecular mechanisms of Nrf2 and NF-κB in IH-induced oxidative stress and apoptosis are still unknown. Our previous study suggested that HIF-1α is increased by IH treatment.[22] Here, we showed that increased HIF-1α expression was not reversed by TSA treatment. This finding conflicts with a previous study showing that TSA suppressed HIF-1α expression in vitro and in vivo. [52,53] Whether this discrepancy can be attributed to the different study subjects and different pretreatment conditions needs further studies. Apoptosis is a natural mechanism for removing aged or damaged cells from the body. In cancer, however, the activation of antiapoptotic systems leads to loss of control of cell proliferation.[54] In this study, IH treatment markedly induced the growth of implanted LLC tumors, accompanied by decreased apoptosis (ie, decrease in BAX and cleaved caspase-3 expression, increase in TUNEL staining). Previous studies have shown that TSA has proapoptotic activity in several cancer cell lines and thus may be a potential therapy for cancer. The present study also revealed the antiapoptotic activity of TSA in IH-treated LLC-implanted mice. Interestingly, TSA increased tumor apoptosis with IH treatment. There were several limitations of this study. First, only 1 dose (10 mg/kg) of TSA was administered to the mice, so the dose–effect relationship was not evaluated. Second, only tumor oxidative stress and apoptotic levels were measured to evaluate the therapeutic effects of TSA on IH. Other properties including tumor cell proliferation, migration, and invasion should be assessed in future studies. Third, we observed discrepant expression of Nrf2 and p-NF-κB among groups. Expression of p-NF-κB and its inhibitor in both the cytoplasm and nucleus was not detected in this study. RNA interference (small interfering RNA against Nrf2 or NF-κB) or DNA binding experiments (electrophoretic mobility shift assay) are required to elucidate the role of Nrf2/NF-κB[51] in the effect of TSA on the behavior of tumors under IH.

Conclusion

This study showed that IH promoted oxidative stress and inhibited apoptosis in LLC-implanted mice. Improvements of IH-induced oxidative stress and apoptosis by TSA may involve the Nrf2/NF-κB signaling pathway. The results of this study indicate that TSA may be an adjunctive therapy for OSA patients with cancer.
  53 in total

1.  Tanshinone IIA induces growth inhibition and apoptosis in gastric cancer in vitro and in vivo.

Authors:  Jian Chen; Dong-Yun Shi; Shan-Lin Liu; Liang Zhong
Journal:  Oncol Rep       Date:  2011-10-27       Impact factor: 3.906

Review 2.  Biosynthesis, total syntheses, and antitumor activity of tanshinones and their analogs as potential therapeutic agents.

Authors:  Yizhou Dong; Susan L Morris-Natschke; Kuo-Hsiung Lee
Journal:  Nat Prod Rep       Date:  2011-01-12       Impact factor: 13.423

3.  Sodium tanshinone IIA sulfonate ameliorates ischemia-induced myocardial inflammation and lipid accumulation in Beagle dogs through NLRP3 inflammasome.

Authors:  Qinghua Hu; Bo Wei; Linlin Wei; Kai Hua; Xing Yu; Huanqiu Li; Hui Ji
Journal:  Int J Cardiol       Date:  2015-05-29       Impact factor: 4.164

4.  The cytoprotective effect of butin against oxidative stress is mediated by the up-regulation of manganese superoxide dismutase expression through a PI3K/Akt/Nrf2-dependent pathway.

Authors:  Rui Zhang; Sungwook Chae; Jun Hwa Lee; Jin Won Hyun
Journal:  J Cell Biochem       Date:  2012-06       Impact factor: 4.429

5.  Predictors of elevated nuclear factor-kappaB-dependent genes in obstructive sleep apnea syndrome.

Authors:  Silke Ryan; Cormac T Taylor; Walter T McNicholas
Journal:  Am J Respir Crit Care Med       Date:  2006-07-13       Impact factor: 21.405

6.  A pro-inflammatory role for nuclear factor kappa B in childhood obstructive sleep apnea syndrome.

Authors:  Lee P Israel; Daniel Benharoch; Jacob Gopas; Aviv D Goldbart
Journal:  Sleep       Date:  2013-12-01       Impact factor: 5.849

7.  Intermittent hypoxia-induced changes in tumor-associated macrophages and tumor malignancy in a mouse model of sleep apnea.

Authors:  Isaac Almendros; Yang Wang; Lev Becker; Frances E Lennon; Jiamao Zheng; Brittney R Coats; Kelly S Schoenfelt; Alba Carreras; Fahed Hakim; Shelley X Zhang; Ramon Farré; David Gozal
Journal:  Am J Respir Crit Care Med       Date:  2014-03-01       Impact factor: 21.405

8.  Protective effect of salidroside on cardiac apoptosis in mice with chronic intermittent hypoxia.

Authors:  Mei-Chih Lai; Jaung-Geng Lin; Pei-Ying Pai; Mei-Hsin Lai; Yueh-Min Lin; Yu-Lan Yeh; Shiu-Min Cheng; Yi-fan Liu; Chih-Yang Huang; Shin-Da Lee
Journal:  Int J Cardiol       Date:  2014-04-21       Impact factor: 4.164

9.  Telmisartan attenuates kidney apoptosis and autophagy-related protein expression levels in an intermittent hypoxia mouse model.

Authors:  Xiao-Bin Zhang; Jing-Huang Cai; Yu-Yun Yang; Yi-Ming Zeng; Hui-Qing Zeng; Miao Wang; Xiao Cheng; Xiongbiao Luo; Henry Chidozie Ewurum
Journal:  Sleep Breath       Date:  2018-09-15       Impact factor: 2.816

Review 10.  The many functions of APE1/Ref-1: not only a DNA repair enzyme.

Authors:  Gianluca Tell; Franco Quadrifoglio; Claudio Tiribelli; Mark R Kelley
Journal:  Antioxid Redox Signal       Date:  2009-03       Impact factor: 8.401

View more
  1 in total

Review 1.  Targeting Oxidative Stress and Endothelial Dysfunction Using Tanshinone IIA for the Treatment of Tissue Inflammation and Fibrosis.

Authors:  Tsuo-Cheng Lu; Yi-Hsiu Wu; Wei-Yu Chen; Yu-Chiang Hung
Journal:  Oxid Med Cell Longev       Date:  2022-04-07       Impact factor: 7.310

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.