Literature DB >> 32430408

Combined RNAseq and ChIPseq Analyses of the BvgA Virulence Regulator of Bordetella pertussis.

Loïc Coutte1, Rudy Antoine2, Stephanie Slupek2, Luis Solans2, Julien Derop3, Amelie Bonnefond3, David Hot2, Camille Locht2.   

Abstract

Bordetella pertussis regulates the production of its virulence factors by the two-component system BvgAS. In the virulence phase, BvgS phosphorylates BvgA, which then activates the transcription of virulence-activated genes (vags). In the avirulence phase, such as during growth in the presence of MgSO4, BvgA is not phosphorylated and the vags are not expressed. Instead, a set of virulence-repressed genes (vrgs) is expressed. Here, we performed transcriptome sequencing (RNAseq) analyses on B. pertussis cultivated with or without MgSO4 and on a BvgA-deficient Tohama I derivative. We observed that 146 genes were less expressed under modulating conditions or in the BvgA-deficient strain than under the nonmodulating condition, while 130 genes were more expressed. Some of the genes code for proteins with regulatory functions, suggesting a BvgA/S regulation cascade. To determine which genes are directly regulated by BvgA, we performed chromatin immunoprecipitation sequencing (ChIPseq) analyses. We identified 148 BvgA-binding sites, 91 within putative promoter regions, 52 within open reading frames, and 5 in noncoding regions. Among the former, 32 are in BvgA-regulated putative promoter regions. Some vags, such as dnt and fhaL, contain no BvgA-binding site, suggesting indirect BvgA regulation. Unexpectedly, BvgA also bound to some vrg putative promoter regions. Together, these observations indicate an unrecognized complexity of BvgA/S biology.IMPORTANCE Bordetella pertussis, the etiological agent of whooping cough, remains a major global health problem. Despite the global usage of whole-cell vaccines since the 1950s and of acellular vaccines in the 1990s, it still is one of the most prevalent vaccine-preventable diseases in industrialized countries. Virulence of B. pertussis is controlled by BvgA/S, a two-component system responsible for upregulation of virulence-activated genes (vags) and downregulation of virulence-repressed genes (vrgs). By transcriptome sequencing (RNAseq) analyses, we identified more than 270 vags or vrgs, and chromatin immunoprecipitation sequencing (ChIPseq) analyses revealed 148 BvgA-binding sites, 91 within putative promoter regions, 52 within open reading frames, and 5 in noncoding regions. Some vags, such as dnt and fhaL, do not contain a BvgA-binding site, suggesting indirect regulation. In contrast, several vrgs and some genes not identified by RNAseq analyses under laboratory conditions contain strong BvgA-binding sites, indicating previously unappreciated complexities of BvgA/S biology.
Copyright © 2020 Coutte et al.

Entities:  

Keywords:  Bordetella pertussis; BvgA; ChIPseq; RNAseq; response regulator

Year:  2020        PMID: 32430408      PMCID: PMC7253368          DOI: 10.1128/mSystems.00208-20

Source DB:  PubMed          Journal:  mSystems        ISSN: 2379-5077            Impact factor:   6.496


INTRODUCTION

Bordetella pertussis, the etiological agent of whooping cough, causes disease via the production of a number of virulence factors, including adhesins and toxins (1). Most of these factors are under the transcriptional control of the BvgA/S two-component system, of which BvgS is an inner membrane-spanning protein sensing environmental signals and BvgA is a cytoplasmic transcription factor (2). Via a BvgS-BvgA phosphorylation cascade, phosphorylated BvgA directly or indirectly activates the transcription of virulence-activated genes (vags). They include genes coding for adhesins and toxins, as well as other virulence factors. In the absence of BvgA/S, vags are not or are only minimally expressed, while the expression of another set of genes, collectively called virulence-repressed genes (vrgs), is strongly enhanced. The vag-vrg expression dichotomy can be observed in the laboratory by growing B. pertussis in the absence or presence of modulators, such as nicotinic acid or MgSO4, compounds that favor vrg expression at the expense of vag expression. A number of studies using microarray (3–6) or, more recently, transcriptome sequencing (RNAseq) technologies (7, 8) have been carried out to define the Bvg regulon by identifying genes whose expression is down- (for the vags) or upregulated (for the vrgs) by the addition of modulators or, in BvgA/S-deficient mutants compared to that in isogenic parent strains, when grown in the absence of modulators. However, these studies did not distinguish vags that are directly regulated by BvgA through its binding to the promoter/operator regions from those that are indirectly regulated by BvgA via a regulatory cascade involving intermediate transcription factors. Examples for indirectly regulated genes include those that code for Bordetella type III secretion system (8). In this study, we combined RNAseq and chromatin immunoprecipitation sequencing (ChIPseq) analyses to identify vags together with BvgA-binding sites on the B. pertussis chromosome as a first step to decipher the global BvgA/S regulon cascade.

RESULTS

RNAseq analysis of the B. pertussis BvgA regulon.

RNAseq analyses were performed to decipher the global regulation of B. pertussis transcriptomes by BvgA according to its state of phosphorylation. RNA was isolated from the B. pertussis Tohama I derivative BPSM (9) grown in the absence or presence of 50 mM MgSO4 (BPSM Mg, referred to as the modulating condition) and from BPSMΔBvgA, a BPSM derivative carrying a genetic deletion of bvgA and in which bvgS is located directly downstream of the bvgA/S promoter. In the absence of MgSO4, BvgA reaches the maximal level of phosphorylation, although even under that condition, only approximately 50% of BvgA is phosphorylated (10). In the presence of MgSO4, BvgA is only present in its nonphosphorylated form (10). In BPSMΔBvgA, BvgA is not detectable, as expected (see Fig. S1 in the supplemental material). Detection of BvgA in cell lysates. Cellular lysates of BPSM, modulated BPSM (BPSM Mg), or BPSMΔBvgA were subjected to SDS-PAGE and immunoblotting with anti-BvgA antibodies. The arrow indicates the position of BvgA. The masses (in kDa) of the molecular markers are indicated at the left. Download FIG S1, PDF file, 0.4 MB. The global transcriptomic profiles of modulated BPSM and BPSMΔBvgA were very similar (Data Set S1, tab 1, Fig. S2). As expected, the expression of the vags (green circle) was lower and that of the vrgs (red circle) was higher in modulated BPSM and in BPSMΔBvgA than in nonmodulated BPSM. The virtually identical overall transcriptomic profiles of modulated BPSM and BPSMΔBvgA suggest that essentially all vags require phosphorylated BvgA to be expressed. The notable exception is bipA, the gene coding for intimin. The expression of this gene requires BvgA, as it was not expressed in BPSMΔBvgA, but its expression in BPSM was not affected by MgSO4 under the conditions tested here. Transcriptome comparisons of different strains under modulating and nonmodulating conditions. RNAseq RPKM gene expression ratios, expressed as log2 ratios, between the BvgA-depleted strain (BPSMΔBvgA) and the BPSM parental strain under modulating and nonmodulating conditions are depicted in the scatter plots. Each point represents one gene. The ratio between modulated and nonmodulated BPSM (x axis) is plotted against the ratio between BPSMΔBvgA and nonmodulated BPSM (y axis). Colored circles highlight genes of interest; green for the vags and red for the vrgs; 50 mM MgSO4 was used as the modulating condition. Download FIG S2, PDF file, 0.6 MB. Tab 1, Overall RNAseq results; tab 2, genes regulated as vags or vrgs in the RNAseq results; tab 3, sRNA identified in the RNAseq results; tab 4, regulation of gene coding for putative B. pertussis regulators; tab 5, ChIPseq CLC Genomics peak caller results; tab 6, overall ChIPseq results; tab 7, comparison of MACS2 and CLC Genomics peak caller lists. Download Data Set S1, XLS file, 1.6 MB. To define the BvgA regulon using the comparative RNAseq data, we identified in BPSMΔBvgA and modulated BPSM genes that presented a Log2 fold change (Log2FC) in transcription less than −3 or greater than 3 compared to those in BPSM and designated them vags(−3) and vrgs(+3), respectively (Data Set S1, tab 1). Rockhopper and SPARTA statistical analyses were performed to keep only statistically significant regulated genes with a P value of <0.05, as presented in Data Set S1, tab 2. In modulated BPSM, 100 vags(−3) and, in BPSMΔBvgA, 102 vags(−3) were identified (Table 1; Data Set S1, tabs 1 and 2). By combining the two conditions, a total of 107 genes were identified as vags(−3), 95 of which were in both BPSM Mg and BPSMΔBvgA (Fig. 1A). Furthermore, in modulated BPSM, 50 vrgs(+3) and, in BPSMΔBvgA, 51 vrgs(+3) were identified by comparison to nonmodulated BPSM. By combining the two conditions, 67 genes were identified as vrgs(+3), and 34 of them were identified in both BPSM Mg and BPSMΔBvgA, compared to those in nonmodulated BPSM (Fig. 1B).
TABLE 1

Summary of RNAseq analysis of the B. pertussis BPSM transcriptome

CategoryValue
BPSMBPSM MgBPSMΔBvgA
No. of genes
    vags(−2)a 146143
    vags(−3)a 100102
    vags(−2) pseudogenesb 101010
    vrgs(+2)c 130140
    vrgs(+3)c 5051
    vrgs(+2) pseudogenesb 252525
% of RPKM from:d
    vags(−2)18.452.034.52
    vags(−3)8.310.270.4
    vrgs(+2)2.0126.8622.76
    vrgs(+3)0.622.7717.27
    vags(−2) pseudogenes0.550.060.03
    vrgs(+2) pseudogenes0.060.680.47
    vags(−3) pseudogenes0.480.020.01
    vrgs(+3) pseudogenes0.020.510.35

Genes presenting a vag profile with a Log2 fold change of less than −2 or −3, as indicated.

Annotated as pseudogenes according to the Tohama I BX470248 genome annotation presenting a vag or vrg profile as indicated.

Genes presenting a vrg profile with a Log2 fold change >2 or >3, as indicated.

Percentage of the vags(−2), vags(−3), vrgs(+2), or vrgs(+3) and annotated pseudogene RPKM over the total RPKM from the complete Tohama I BX470248 genome ORF annotation.

FIG 1

Venn diagrams showing the numbers of overlapping genes between BPSM Mg and BPSMΔBvgA. vags(-3) (A) and vags(-2) (C) are genes that present Log2FCs in transcription of less than −3 and −2, respectively, compared to that in BPSM. vrgs(+3) (B) and vrgs(+2) (D) are genes that present Log2FCs in transcription of >3 and >2, respectively, compared to that in BPSM.

Summary of RNAseq analysis of the B. pertussis BPSM transcriptome Genes presenting a vag profile with a Log2 fold change of less than −2 or −3, as indicated. Annotated as pseudogenes according to the Tohama I BX470248 genome annotation presenting a vag or vrg profile as indicated. Genes presenting a vrg profile with a Log2 fold change >2 or >3, as indicated. Percentage of the vags(−2), vags(−3), vrgs(+2), or vrgs(+3) and annotated pseudogene RPKM over the total RPKM from the complete Tohama I BX470248 genome ORF annotation. Venn diagrams showing the numbers of overlapping genes between BPSM Mg and BPSMΔBvgA. vags(-3) (A) and vags(-2) (C) are genes that present Log2FCs in transcription of less than −3 and −2, respectively, compared to that in BPSM. vrgs(+3) (B) and vrgs(+2) (D) are genes that present Log2FCs in transcription of >3 and >2, respectively, compared to that in BPSM. When less-stringent threshold Log2FCs of −2 and +2 were used, the number of vags and vrgs, named vags(−2) and vrgs(+2), respectively, increased, as shown in the Table 1 and Fig. 1C and D. However, our statistical analysis showed more variability in the expression of these genes in the different samples. Therefore, at least for some of them, it may be questionable whether they are true vags or vrgs regulated by the BvgA/S system. Based on the calculated reads per kilobase per million (RPKM) corresponding to the vags and vrgs under the different conditions, vags(−3) and vags(−2) represent 8.31% and 18.45%, respectively, of the total transcripts in BPSM (Table 1). These proportions decreased drastically in modulated BPSM and in BPSMΔBvgA. The vrgs(+3) represent 0.6% of the BPSM transcriptome, while they represent 22.77% and 17.27% of the modulated BPSM and the BPSMΔBvgA transcriptomes, respectively. As a reference, we used the housekeeping genes that present similar levels of transcription under all tested conditions (data not shown). The impact on the whole transcriptome of vags and vrgs annotated as pseudogenes was also determined. Ten were annotated as pseudogenes among the vags(−2), and only 3 were annotated as pseudogene among the vags(−3), representing 0.56% and 0.49%, respectively, of the total transcripts in BPSM. Among the vrgs(+2), 25 were annotated as pseudogenes versus 11 among the vrgs(+3), and their expression represents between 0.01% and 0.68% of the total transcripts under the different conditions (Table 1). Thus, the total transcripts of the vag and vrg pseudogenes represent only a minor fraction of the entire transcriptome in B. pertussis.

sRNA regulated by BvgA.

As noticed previously (11), the RNAseq data analyses also revealed transcripts corresponding to regions not annotated as coding for proteins (Data Set S1, tab 3). The analysis of all 6 data sets allowed us also to identify potential noncoding RNAs, most of which have already been seen in previous studies (7, 11). Among them, 90 were regulated under at least one tested condition (34 presenting a Log2FC of less than −2.27 presenting a Log2FC of less than −3.56 presenting a Log2FC of >2, and 30 presenting a Log2FC of >3). Most of them are 3′ or 5′ untranslated regions (UTRs) of vags or vrgs. However, 4 of them were not linked to the UTRs of vags or vrgs and showed a vrg-type expression profile (Table 2). An additional noncoding RNA showed a vag-type expression profile (Table 2). Among these 5 potential noncoding RNAs, one had already been identified by Amman et al. (11) as candidate_transcript_301. It starts at the 3′ end of the vrg bp2148 and extends into the open reading frame (ORF) of bp2149 transcribed in the opposite orientation (see Fig. S3). Although transcript_301 is in the same orientation as bp2148, the two transcripts are probably not part of the same operon, as the expression level of transcript_301 is 2- to 3-fold higher than that of bp2148. A second one, corresponding to candidate_transcript_356 (11), is located between bp2568 coding for a transposase of IS481 and the 3′ end of bp2569. Its orientation is opposite that of bp2568 and bp2569. A third transcript, highly transcribed in modulated BPSM and in BPSMΔBvgA, is located in the 3′ region of bp2735, a gene that is not part of the BvgA regulon. This transcript was recently named rgtA and shown to be involved in B. pertussis glutamate metabolism (12). We also detected the already documented transcript_242 (11) in the region upstream of fim3. This transcript was previously named vrgX (7, 13). Finally, we identified a transcript that was not previously described, starting at position 267174 and presenting a vag-like profile. It is close to the bp0258 ATG start codon. bp0258 is not a vag nor is its homologue bb4499 in B. bronchiseptica. bp0258 presented RPKMs in BPSM, BPSM Mg, and BPSMΔBvgA of 1388, 1232, and 1038, respectively, while for the new transcript, RPKM values were 133, 5, and 7 under the same respective conditions.
TABLE 2

Regulated sRNA identified in the B. pertussis BPSM RNAseq analysis

NameTranscription sitea
StrandbRNA size (nt)SynonymcRockhopper Log2FCd
Reference(s)c
StartStopBPSM Mg vs BPSMBPSMΔBvgA vs BPSM
Transcript_30122709792271600+6214.904.8711
Transcript_35627211172720970+1475.125.7211
rgtA29031652903019146rgtA3.553.5212
Transcript_24216471451647308+163vrgX3.123.987, 11, 13
Novel transcript267174267240+66−4.73−4.25This study

Transcription start and stop sites are the first and last nucleotides of the detected sRNA relative to the B. pertussis Tohama I BX470248 genome annotation.

+ and − represent forward and reverse directions, respectively, to the orientation of the B. pertussis Tohama I BX470248 genome annotation.

Correspond to previously described sRNA.

Log2FC, Log2 fold change of the RPKM of the detected sRNA under the tested condition versus BPSM.

Regulated sRNA identified in the B. pertussis BPSM RNAseq analysis Transcription start and stop sites are the first and last nucleotides of the detected sRNA relative to the B. pertussis Tohama I BX470248 genome annotation. + and − represent forward and reverse directions, respectively, to the orientation of the B. pertussis Tohama I BX470248 genome annotation. Correspond to previously described sRNA. Log2FC, Log2 fold change of the RPKM of the detected sRNA under the tested condition versus BPSM. Schematic representation of the bp2147-2149 locus. The blue arrows represent the gene sizes and orientation, and the orange arrow represents the size and orientation of candidate_transcript_301. Download FIG S3, PDF file, 0.5 MB.

BvgA, a regulator of regulators.

As shown previously (3, 7), BvgA is also involved in the regulation of several genes coding for proteins with putative regulatory functions. To evaluate how many regulatory genes are included in the BvgA regulon, we used the MiST2 database (http://mistdb.com) and identified 301 genes annotated in the B. pertussis genome coding for proteins with a putative regulatory function (Data Set S1, tab 4). Among them, 18 were identified as vags(−2) or vrgs(+2) and 12 as vags(−3) or vrgs(+3) (Table 3). Some of them had already been described and their function is known, such as bvgS, bvgA, and brpL. However, for most of them, the function remains unknown. These observations suggest that the BvgA regulon is composed of genes directly regulated by BvgA and of genes indirectly regulated by BvgA via a regulation cascade.
TABLE 3

Regulated genes coding proteins with putative regulatory functions.

Locus taga Gene producta Rockhopper
SPARTA
Log2FC vs BPSMb
RPKM
q value vs BPSM
Log2FC vs BPSMb
P value vs BPSM
BPSM MgBPSMΔBvgABPSMBPSM MgBPSMΔBvgABPSM MgBPSMΔBvgABPSM MgBPSMΔBvgABPSM MgBPSMΔBvgA
bp0744Putative transcriptional regulator−1.79−2.18424123940.00E+000.00E+00−1.83−1.971.26E−234.36E−04
bp0764Probable LysR-family transcriptional regulator−4.17−4.1718004.82E−022.74E−01−4.84−3.763.13E−441.77E−07
bp1496Probable two-component response regulator−4.48−4.26134671.00E+001.00E+00−4.50−4.065.02E−651.09E−09
bp1798Putative DNA-binding protein0.822.072103718790.00E+004.41E−750.812.628.45E−063.82E−04
bp1876Regulatory protein BvgR−6.38−6.3991911111.00E+001.00E+00−5.91−5.751.24E−1291.52E−17
bp1877Virulence sensor protein−2.02−1.7827167791.00E+001.00E+00−1.85−1.571.04E−215.16E−03
bp1878Virulence factor transcription regulator−2.29−3.3933316793181.00E+001.00E+00−2.03−2.753.61E−221.62E−04
bp2142Putative GntR-family transcriptional regulator−1.83−2.6832952.81E−057.46E−141−1.69−2.271.83E−125.10E−04
bp2227Putative anti-sigma factor−3.89−3.8974551.00E+001.00E+00−3.68−3.303.53E−393.38E−07
bp2230Putative regulator−4.46−4.4622001.00E+001.00E+00−4.80−4.139.34E−625.56E−09
bp2234Putative RNA polymerase sigma factor−8.00−8.59770321.00E+001.00E+00−7.82−7.462.51E−1753.45E−24
bp2436Putative membrane protein0.502.6335850622138.19E−071.00E+000.543.261.24E−023.85E−06
bp2437RNA polymerase sigma factor0.182.1364172728052.13E−053.19E−110.112.125.64E−012.49E−03
bp2571Putative transcriptional regulatory protein1.402.01429113317222.63E−014.64E−021.412.371.44E−121.10E−04
bp2635Leucine-responsive regulatory protein1.752.44702353801.00E+001.00E+001.682.787.76E−194.24E−06
bp2872Putative AsnC-family transcriptional regulator2.240.51733101.74E−1487.90E−242.060.766.91E−091.95E−01
bp2935Putative two-component system, histidine kinase−2.81−2.099814235.58E−011.44E−03−2.97−2.151.51E−392.60E−04
bp3702GntR-family transcriptional regulator2.022.36331341704.38E−022.66E−011.962.615.87E−251.72E−06

According to B. pertussis Tohama I BX470248 genome annotation.

Log2FC, Log2 fold change of the RPKM of the select genes under the tested condition versus BPSM.

Regulated genes coding proteins with putative regulatory functions. According to B. pertussis Tohama I BX470248 genome annotation. Log2FC, Log2 fold change of the RPKM of the select genes under the tested condition versus BPSM.

Analysis of the bvgA promoter region.

A focus on the bvg-fha locus indicated that the expression of bvgA was reduced 4.89- and 10.48-fold in modulated BPSM and in BPSMΔBvgA, respectively, compared to that in nonmodulated BPSM. That of bvgS was reduced 4.02- and 3.41-fold, respectively, and that of fhaB was reduced 22.31- and 121.93-fold, respectively (Fig. 2A). We were intrigued by the observation that in the RNAseq analysis, the reads comprising the promoter region and first codons of bvgA were much more abundant in BPSMΔBvgA than in BPSM and BPSM Mg. BPSMΔBvgA contains an in-frame deletion fusing the first 13 codons to the last 7 codons of bvgA, hence coding for a nonfunctional BvgA truncate. We therefore measured specifically the RPKM corresponding to the first 13 bvgA codons under all tested conditions and found that the transcripts of this region were 2.21- and 4.78-fold more abundant in BPSMΔBvgA than in BPSM and BPSM Mg, respectively. Previous studies have shown that the region between the divergently transcribed bvgAS and fhaB genes contains at least three promoters that control bvgA expression (Fig. 2B) (14). The transcriptional start sites of promoters P1, P2, and P3 were reported to be located 93 bp, 143 bp, and 272 bp, respectively, upstream of the bvgA translational start site. Although we did not find any read corresponding to P3 in our RNAseq analysis, we detected many reads corresponding to P1 and P2. To determine which promoter(s) was used to drive bvgA expression under the various conditions, we performed 5′ rapid amplification of cDNA ends (RACE) experiments on the 5′ UTR of bvgA (Fig. 2C) and found that in nonmodulated BPSM, bvgA expression was mainly driven by P1, although some reads were also detected coming from P2. In contrast, in BPSM Mg and BPSMΔBvgA bvgA expression was exclusively driven by P2. To quantify the strength of P1 and P2 under each condition, reverse transcription-quantitative PCR (qRT-PCR) experiments were performed (Fig. 2D) and showed that the transcripts corresponding to P2 were 9.27-fold more abundant in BPSM Mg than in BPSM and 49.67-fold more abundant in BPSMΔBvgA than in BPSM. These results indicate differential usage of the bvgA promoters under the three conditions.
FIG 2

Transcription profiling, RACE, and qRT PCR analysis on the bvgA promoter region. (A) RPKM quantification in BPSM, modulated BPSM (BPSM Mg), and BPSMΔBvgAfor bvgS, bvgA, and fhaB. bvgA13AA corresponds to the region coding for the 13 first amino acids of BvgA. RPKM standard deviations (SD)s are shown. (B) Schematic representation of the B. pertussis fhaB-bvgAS promoter region. P1, P2, and P3 represent the described bvgA promoters. qRT bvgA P1 and P2 depict the regions used to quantify the promoter strength of P1 and P2, respectively, by qRT PCR. (C) Mapping of the RACE reads obtained with the BvgA RACE primer on BPSM, modulated BPSM (BPSM Mg), and BPSMΔBvgA RNA. Single reads mapping in the forward direction are in green. Single reads mapping in the reverse direction are red. Any mismatches between the reads and the reference sequence are shown as colored dots. (D) Quantitative RT-PCR analysis of P1 and P2 promoter regions of bvgA. mRNA transcripts corresponding to the bvgA promoters P1 and P2, as shown in B, were amplified by qRT-PCR using a bvgA-specific reverse primer and a primer corresponding to either P1 or P2 (see panel B). Expression of bvgA P1 and P2 transcripts is presented relative to the level of expression of the housekeeping gene bp3416.

Transcription profiling, RACE, and qRT PCR analysis on the bvgA promoter region. (A) RPKM quantification in BPSM, modulated BPSM (BPSM Mg), and BPSMΔBvgAfor bvgS, bvgA, and fhaB. bvgA13AA corresponds to the region coding for the 13 first amino acids of BvgA. RPKM standard deviations (SD)s are shown. (B) Schematic representation of the B. pertussis fhaB-bvgAS promoter region. P1, P2, and P3 represent the described bvgA promoters. qRT bvgA P1 and P2 depict the regions used to quantify the promoter strength of P1 and P2, respectively, by qRT PCR. (C) Mapping of the RACE reads obtained with the BvgA RACE primer on BPSM, modulated BPSM (BPSM Mg), and BPSMΔBvgA RNA. Single reads mapping in the forward direction are in green. Single reads mapping in the reverse direction are red. Any mismatches between the reads and the reference sequence are shown as colored dots. (D) Quantitative RT-PCR analysis of P1 and P2 promoter regions of bvgA. mRNA transcripts corresponding to the bvgA promoters P1 and P2, as shown in B, were amplified by qRT-PCR using a bvgA-specific reverse primer and a primer corresponding to either P1 or P2 (see panel B). Expression of bvgA P1 and P2 transcripts is presented relative to the level of expression of the housekeeping gene bp3416.

ChIPseq analysis of BvgA binding in B. pertussis.

To identify vags that may be directly regulated by BvgA, ChIPseq analyses were performed to localize the BvgA-binding sites on the genome of B. pertussis. Among the 2,055 signals initially identified by CLC Genomics peak caller using all 6 data sets (2 for BPSM, 2 for BPSM Mg, and 2 for BPSMΔBvgA) (Data Set S1, tab 5), we selected those with a peak shape score of >5 and an associated P value of ≤3.79 × 1043, which revealed 148 BvgA-binding sites in BPSM (Data Set S1, tab 6). None of them were detected in BPSM Mg or BPSMΔBvgA, indicating strong specificity of the assay and showing that the ability of BvgA to bind to its cognate DNA sites depends on its phosphorylation. Ninety-one BvgA-binding sites were found in putative promoter regions of annotated ORFs (first category) (see examples in Fig. S4A and B). Putative promoter regions are defined here as regions upstream of an ORF spanning between −5 and −806 nucleotides (nt) from the predicted translational initiation site and not overlapping with an adjacent ORF. Most of the BvgA-binding sites found in these regions are located between nucleotides −150 and −1 from the predicted ATG translational start site (data not shown). Fourteen of the BvgA-binding sites of the first category were found in the putative promoter regions located between two ORFs orientated in opposite directions (Table 4; Fig. S4B). Five were found in noncoding regions (second category) (Fig. S4C) and 52 within annotated ORFs (third category) (Fig. S4D and E). Among the latter, 14 are located close to the 5′ end of an adjacent ORF and could therefore be part of the promoter/operator region of the downstream gene (Fig. S4E). We also applied MACS2 genomics peak caller comparing the BPSM and the BPSMΔBvgA run data sets. Using a P value threshold of 1.00 e−5, 143 peaks were identified, and all of them were also found in the list established with CLC peak caller (Data Set S1, tab 7). The additional peaks identified by CLC correspond to peaks located within insertion sequences, which were deliberately excluded in the MACS peak caller analysis.
TABLE 4

Summary of ChIPseq analysis of the B. pertussis BvgA regulator

CategoryNo. of genes with BvgA-binding site in:
Putative promoterPromoter betweena Non-codingb Insidec Promoter or insided Total
vagse 23006029
Additional vagsf 8001110
vrg RisA independentg 300115
vrg RisA dependentg 210205
RisA regulatedh 100001
Bvgii 100001
Non-codingj 005006
No vag no vrgk 39120281291
Total771453814148

Putative promoter region located between two ORFs orientated in opposite directions.

Region not annotated in the B. pertussis Tohama I BX470248 genome.

Within annotated ORF of the B. pertussis Tohama I BX470248 genome.

Within annotated ORF and close to the 5′ end of an adjacent ORF.

vags presenting a Log2FC of less than −2 in the RNAseq analysis.

vags presenting a Log2FC between −1.5 and −2 in the RNAseq analysis.

vrgs presenting a Log2FC of >2 in the RNAseq analysis and were described by Coutte et al. (3).

RisA-regulated gene, bp1022, codes for the transcriptional activator FlbB, described by Coutte et al. (3).

Bvgi corresponds to bipA, not regulated by modulation under the conditions tested here but requires BvgA.

Regions not annotated in the B. pertussis Tohama I BX470248 genome.

Gene not regulated as vag or vrg in this RNAseq analysis.

Summary of ChIPseq analysis of the B. pertussis BvgA regulator Putative promoter region located between two ORFs orientated in opposite directions. Region not annotated in the B. pertussis Tohama I BX470248 genome. Within annotated ORF of the B. pertussis Tohama I BX470248 genome. Within annotated ORF and close to the 5′ end of an adjacent ORF. vags presenting a Log2FC of less than −2 in the RNAseq analysis. vags presenting a Log2FC between −1.5 and −2 in the RNAseq analysis. vrgs presenting a Log2FC of >2 in the RNAseq analysis and were described by Coutte et al. (3). RisA-regulated gene, bp1022, codes for the transcriptional activator FlbB, described by Coutte et al. (3). Bvgi corresponds to bipA, not regulated by modulation under the conditions tested here but requires BvgA. Regions not annotated in the B. pertussis Tohama I BX470248 genome. Gene not regulated as vag or vrg in this RNAseq analysis. Representation of the different localizations of the putative BvgA-binding sites identified by ChIPseq. (A) Example of BvgA-binding site found in putative promoter region of annotated ORF. (B) Example of BvgA-binding site found in the putative promoter regions located between two ORFs orientated in opposite directions. (C) Example of BvgA-binding site found in noncoding region. (D) Example of BvgA-binding site found within annotated ORF. (E) Example of BvgA-binding site found within annotated ORF and located close to the 5′ end of an adjacent ORF. The yellow arrows represent the gene orientation. Single reads mapping in their forward direction are in green. Single reads mapping in their reverse direction are red. Any mismatches between the read and reference are shown as colored dots. More reads are mapped to the reference than can be shown in detail; so, these reads are displayed in an overflow graph below the reads. The overflow graph is shown in the same colors as the reads, and mismatches in reads are shown as colored narrow vertical lines within the overflow graph. Download FIG S4, PDF file, 0.7 MB. A comparison of the RNAseq data using Log2FC of less than −2 as the cutoff with the ChIPseq data indicated that among the 148 BvgA-binding sites, 29 are located closed to vags (23 in putative promoter regions and 6 within ORFs) (Table 4 and Fig. 3). In addition, some genes with a BvgA-binding site also showed a vag-like profile, with a Log2FC between −1.5 and −2. Ten of them showed a BvgA-binding site (9 in putative promoter regions and 1 within ORF). Ten BvgA-binding sites were found located close to vrgs, 5 of which were previously identified as being RisA dependent and 5 as RisA independent (3). The RisA-regulated gene identified in Table 4 and Fig. 3 has a BvgA-binding site close to bp1022, coding for the transcriptional activator FlbB involved in the transcription of the flagellar operon that does not depend on BvgA but is regulated by BvgR and RisA (3). Furthermore, bipA, a gene that is not regulated by modulation under the conditions tested here but requires BvgA (Table 4 and Data Set S1, tab 1), also contains a BvgA-binding site, called Bvgi in Fig. 3 and in Data Set S1, tab 6.
FIG 3

Graphical representation of the different BvgA-binding sites with respect to identified BvgA-regulated genes on the B. pertussis genome. Numbers correspond to the numbers of BvgA-binding sites in each category.

Graphical representation of the different BvgA-binding sites with respect to identified BvgA-regulated genes on the B. pertussis genome. Numbers correspond to the numbers of BvgA-binding sites in each category. Six BvgA-binding sites were found located either between the 3′ ends of two convergent genes or in a region upstream of fim3, called vrgX, and identified as transcript 151 in the RNAseq data (7, 13). We also identified a BvgA-binding site close to the novel transcript upstream of bp0258, confirming the vag-like profile of this small RNA (sRNA). None of the other putative sRNA identified by RNAseq were associated with a BvgA-binding site. The remaining 91 BvgA-binding sites located close to ORFs were not found to be regulated as vags or vrgs in our RNAseq data (Table 4). A comparison of ChIPseq and RNAseq data is presented as a scatterplot in Fig. S5. Genes immediately downstream of a ChIPseq peak or with an internal ChIPseq peak present a vag, a vrg, or an unregulated profile of regulation in our study, indicating the diversity of BvgA regulation. Scatterplot representation of the RNAseq and ChIPseq data comparison. Regulation of the 91 genes presenting BvgA-binding sites found in putative promoter regions of annotated ORFs are represented in black and regulation of the 52 genes presenting BvgA-binding sites found in within ORFs are represented in red. RNAseq RPKM gene expression ratios, expressed as log2 ratios, between BPSMΔBvgA and BPSM parental strain (y axis) and modulated and nonmodulated BPSM (x axis). Each point represents one gene; 50 mM MgSO4 was used as the modulating condition. Download FIG S5, PDF file, 0.4 MB. The 107 genes identified as vags by our RNAseq analyses are grouped into 42 different transcription units, 23 of which contain strong BvgA-binding sites (Table 4; Fig. S5). Three additional ones contained a ChIPseq peak in their promoter region with less than 1,000 reads used as threshold (bp2486 with 850 reads; bp2738/bapC with 950 reads and bp3619 with 979 reads). However, the reads corresponding to these regions were much more abundant in BPSM than under the other conditions, suggesting that they indeed contain true BvgA-binding sites. fim2 and fim3 did not present an automatically detectable ChIPseq peak, likely due to the informatic processing of the Illumina reads that removes reads with long stretches of cytosines. In fact, both genes present atypical ChIPseq peaks in their promoter region, but the numbers of reads are consistent with them having a BvgA-binding site (see Fig. S6). Finally, 16 transcription units of vags did not present any ChIPseq peak, suggesting that they are not directly regulated by BvgA. They are bp0399, bp0499, bp0500, bp0456 (hemC), bp0535, bp2147, bp2226, bp2227, bp2232, bp2233, bp2256, bp2257, bp2749, bp2907 (fhaL), bp3433, and bp3439 (dnt), identified as vags(−3) in the RNAseq analysis. Representation of the ChIPseq reads mapping on the fim2 and fim3 loci. (A) ChIPseq-mapped reads on the fim2 locus on BPSM ChIPseq run 1 (top) and BPSM ChIPseq run 2 (bottom). (B) ChIPseq-mapped reads on the fim3 locus on BPSM ChIPseq run 1 (top) and BPSM ChIPseq run 2 (bottom). The yellow arrows represent the gene orientation. Single reads mapping in their forward direction are in green. Single reads mapping in their reverse direction are red. Any mismatches between the read and reference are shown as colored dots. More reads are mapped to the reference than can be shown in detail. Therefore, these reads are displayed in an overflow graph over the reads. The overflow graph is shown in the same colors as the reads, and mismatches in reads are shown as colored narrow vertical lines within the overflow graph. Download FIG S6, PDF file, 0.7 MB. Therefore, we examined the ChIPseq data to identify BvgA-binding sites close to genes coding for proteins with regulatory functions. Among the 301 genes annotated in the B. pertussis genome that code for proteins with a putative regulatory function, 15 presented a BvgA-binding site in their promoter region or belong to an operon containing a BvgA-binding site (see Fig. S7) and would therefore be candidates as intermediate regulators of certain vags. Heat map of expression of regulatory genes presenting BvgA-binding sites. The genes, products, and synonyms correspond to the Tohama I Sanger Centre annotation. BPSM Mg versus BPSM corresponds to the Log2FC RPKM ratios between BPSM cultivated in the presence of 50 mM MgSO4 and in nonmodulated BPSM. BPSMΔBvgA versus BPSM corresponds to the Log2FC RPKM ratios between BPSMΔBvgA and nonmodulated BPSM. The indicated ratios are the means from all the experiments. Red, increased transcript abundance; green, decreased transcript abundance; black, no significant change in transcript abundance; the level of transcript abundance is defined by the colored Log2FC scale shown on the bottom. Download FIG S7, PDF file, 0.5 MB.

Search for BvgA binding consensus.

In an attempt to identify BvgA-binding consensus sequences based on the ChIPseq data, we used MEME ChIPseq software with the “zero or one occurrence per sequence” or “any number of repetitions” options to analyze the regions showing BvgA binding. For each binding site, we considered the center of the peak detected in ChIPseq BPSM run 1 and 100 nucleotides on each side to define a 201-bp region. We clustered them in 3 categories, binding at any position (Fig. 4A) (n = 148), binding in putative promoter regions (Fig. 4B) (n = 91), and binding within ORFs. In using the regions corresponding to the 148 BvgA-binding sites or the 91 sites located in putative promoter regions, a strong and consensus motif was found using the “zero or one occurrence per sequence” option (Fig. 4A and B). This 10-bp motif is similar to the BvgA-binding site consensus already described (15). Using the 52 regions comprising sites within ORFs, we were not able to identify a statistically relevant consensus.
FIG 4

MEME analysis of motifs identified in the ChIPseq peaks. (A) Motif found using the 148 putative BvgA-binding sites. (B) Motif found using the 91 putative BvgA-binding sites located in promoter regions.

MEME analysis of motifs identified in the ChIPseq peaks. (A) Motif found using the 148 putative BvgA-binding sites. (B) Motif found using the 91 putative BvgA-binding sites located in promoter regions.

DISCUSSION

This study presents a combined RNAseq and ChIPseq analysis of the BvgA regulon of B. pertussis to identify the transcriptome of B. pertussis directly or indirectly regulated by BvgA. A comparison of our RNAseq data with those of a previous study (7) showed that while most vags and vrgs identified here were also identified by Moon et al. (7) (see Fig. S8), some differences remained. They could be due to (i) use of different Tohama I derivatives between the two studies, (ii) differences in fold change threshold levels used to identify vags and vrgs, (iii) the use of different culture media in the two studies, (iv) annotation errors, and (v) use of a BPSM BvgA mutant versus a BP536 BvgA/S double mutant. As an example of an annotation error, bp1055 was considered vag by Moon et al. (7) but not in this study because of reads overlapping from the 3′ end of the vag bp1054 (prn) to bp1055, which is not a vag in our study (Fig. S8A). Scatterplot representations of RNAseq data comparisons. Comparison of the RNAseq RPKM gene expression ratios, expressed as log2 ratios, between the data set of Moon et al. (7) and the RNAseq data set of this study. (A) The ratio between modulated and nonmodulated BPSM (x axis; this study) is plotted against the ratio between modulated and nonmodulated BP536 (y axis; Moon et al. [7]). (B) The ratio between BPSMΔBvgA and the nonmodulated BPSM parental strain (x axis; this study) is plotted against the ratio between BP536ΔBvgAS and the nonmodulated BP536 parental strain (y axis; Moon et al. [7]). RPKM gene expression ratios are expressed as log2 ratios; 50 mM MgSO4 was used as the modulating condition for both studies. Download FIG S8, PDF file, 0.6 MB. Together with a few housekeeping genes, the vags are among the most highly expressed genes under nonmodulating conditions, representing almost 20% of the transcriptome. Under modulating conditions or in BPSMΔBvgA, the vrgs are also highly expressed, representing almost one-quarter of the transcriptome. These observations indicate that expression control by the BvgA/S two-component system has a major impact on overall transcriptional activity in B. pertussis. In contrast to that of functional vags and vrgs, the expression of vag and vrg pseudogenes plays a minor role in the overall transcriptomic activity of B. pertussis. The RNAseq analysis allowed us also to identify 5 putative sRNAs regulated by BvgA, which could not be identified in previous DNA microarray studies (3, 4), as these studies only considered annotated ORFs of the B. pertussis chromosome. The most highly expressed and tightly regulated sRNA, rgtA, was recently shown to play a role in B. pertussis glutamate metabolism, linking the BvgA regulon to an important metabolic pathway, as glutamate is the main carbon source for B. pertussis in culture media (12). A BvgA-binding site was detected upstream of a novel transcript with a vag-type expression profile, confirming its regulation by BvgA. Additional experiments will be required to confirm the remaining sRNAs and to decipher their roles in B. pertussis biology or pathogenesis. The regulation of bvgA expression itself is complex and is both BvgA dependent and independent. Promoter P1 is highly active in the virulent phase (nonmodulated BPSM), while P2 is mostly used in the avirulent phase (during modulation or in BPSMΔBvgA). This mechanism may be used by B. pertussis to ensure an almost constant level of BvgA regardless of the virulence phases, as seen by immunoblot analyses (Fig. S1), even in the absence of phosphorylation by BvgS, such as under modulating conditions. Interestingly, P2 is stronger in BPSMΔBvgA than in modulated BPSM, suggesting that nonphosphorylated BvgA may inhibit transcription driven by P2. However, we did not detect BvgA binding to the P2 region under modulating conditions, suggesting that nonphosphorylated BvgA does not bind to its own promoter region. Inhibition of P2 activity by nonphosphorylated BvgA may thus occur indirectly. The ChIPseq analyses revealed 148 BvgA-binding sites in the BPSM chromosome. We arbitrarily grouped them into 3 categories depending on their localization with respect to the corresponding ORF, either located within putative promoter regions (category 1), within ORFs (category 2), or in noncoding regions (category 3). Some of the BvgA-binding sites are located in intergenic regions between two divergently transcribed genes. In this case, it is not possible to determine to which gene the BvgA-binding site corresponds. In some cases, the information may come from the RNAseq analyses if one of the two genes has been identified as a vag. However, even in this case, it cannot be excluded that the gene not identified as vag by RNAseq may under certain conditions also be regulated by BvgA. Conversely, when two vags identified by RNAseq present a common promoter region, such as is the case for bvgA/S and fhaB, a unique BvgA-binding site can be detected that is a mean between the two or more actual BvgA-binding sites on the bvgA and fhaB promoter region. In many cases, the BvgA-binding site could readily be located within the putative promoter region of vags identified by the transcriptomic studies. However, several BvgA-binding sites were detected within ORFs, some of which were identified as vags. ChIPseq studies in other bacteria have demonstrated that transcription factors may bind to sites within ORFs (16–19). Although the function of such binding is still largely unknown, it was recently shown that noncanonical binding within ORFs of several Escherichia coli genes may in fact drive transcription of highly unstable RNAs and may have an impact on genome evolution (16). It should be kept in mind that the Tohama I BX470248 genome annotation may present some errors, as exemplified by the recent correction of the fmtB translational start site (20), which was originally proposed to be 99 bp upstream of the actual experimentally determined initiation codon. A BvgA-binding site was detected by ChIPseq close to the 5′ end of fmtB, with a peak at position −71 from the experimentally determined translational initiation codon. This BvgA-binding site would have been positioned within the ORF centered at position +28 if the original annotation had been considered. In addition, the technology used here to sequence the DNA fragments isolated by ChIP does not allow us to determine the exact sequence to the nucleotide level to which BvgA binds. Hence, for some genes, in particular, those without a 5′ UTR, the BvgA-binding site detected by the ChIPseq analysis may overlap the ORF. Furthermore, it has been shown that several promoter regions of genes regulated by BvgA contain multiple BvgA-binding sites, some with high and some with low affinity (21–23). Therefore, the ChIPseq data define a zone were BvgA binds but do not identify the precise binding site to the nucleotide level. Some bona fide vags had no obvious BvgA-binding site. Some of them (bp0499, bp0500, bp2232, bp2233, bp2256, and bp2257) are members of the type III secretion system loci and are regulated by BrpL (8), the gene for which contains a strong BvgA-binding site in its putative promoter region and was shown to be directly regulated by BvgA (7). These genes are thus regulated by a regulation cascade involving BrpL whose expression is regulated directly by BvgA. Similar regulation cascades may also control the expression of other vags lacking a BvgA-binding site. A total of 10 genes in that category were identified, including fhaL and dnt. The direct regulators of these genes remain to be identified. The vags coding for regulatory proteins are obvious candidates. Surprisingly, we found 10 BvgA-binding sites in proximity of vrgs. The expression of most vrgs depends on the transcription factor RisA (3), and 5 RisA-dependent vrgs contain BvgA-binding sites. These observations suggest that these genes are regulated by a dual mechanism: transactivation by RisA and repression by BvgA. Five of the vrgs containing BvgA-binding sites are not regulated by RisA. Their expression is enhanced in the absence of BvgA and under modulating conditions, even in the absence of RisA, suggesting that for these genes, phosphorylated BvgA acts as a repressor. Among the 148 BvgA-binding sites, 91 are in proximity of genes that were not defined as vags or as vrgs by our RNAseq analysis. Hence, in addition to the RNAseq data shown here, we therefore also examined published data coming from other transcriptomic analyses of B. pertussis and Bordetella bronchiseptica (5, 7, 8, 24). One of them was identified as a vag by Moon et al. (7) and one as a vrg. The data set of Ahuja et al. (8) allowed us to identify 6 orthologue genes regulated as vags and 4 orthologue genes regulated as vrgs. The data set of Gestal et al. (5) allowed us to identify an additional 25 genes that are overexpressed in the presence of serum or blood only in a BvgS-producing strain and not in a BvgS mutant but are not BvgS-regulated in the absence of blood or serum. All together, these investigations identified 31 different genes that were not found to be regulated in our RNAseq study but were shown to be regulated by BvgS under other conditions. Additionally, 4 of these 91 nonregulated genes were shown to be more expressed by the addition of blood or serum in the culture media but independently of the presence of BvgS, and 2 of these 91 nonregulated genes are more expressed in vivo in mice than in vitro (24). For the remaining 56 genes presenting BvgA-binding sites, it is unclear whether they are differentially regulated under conditions not examined so far, such as during the course of whooping cough in human patients, or whether they contain nonproductive BvgA-binding sites. The analyses of the BvgA-binding site sequences in the putative promoter region allowed the MEME algorithm to identify a consensus motif similar to that already published (15), strengthening the motif already described and the detection method used in our study. However, when using the BvgA-binding site sequences found within ORFs, we were not able to identify a consensus motif. The binding sites found in the putative promoter regions are distributed randomly in the 201-bp regions used as the template (data not shown), probably because promoter regions of BvgA-regulated genes may contain from 1 to 10 binding sites with weak or strong affinity (21–23). In conclusion, this combined RNAseq and ChIPseq study provides new insights in the BvgA-dependent regulation cascade, identifies bona fide directly BvgA-regulated genes, and uncovers surprising new features of the Bvg regulon, such as BvgA binding to vrgs. Therefore, these findings open new avenues for the study of the complex virulence regulation by B. pertussis.

MATERIALS AND METHODS

Construction of B. pertussis mutant strains.

The B. pertussis strains used in this study were derived from the Tohama I derivative BPSM (9). B. pertussis BPSMΔBvgA was obtained by homologous recombination using pSS1129 as an allelic exchange vector (25). The recombinant plasmids were introduced into B. pertussis by conjugation via Escherichia coli SM10 (26). BPSMΔBvgA carries a 570-bp internal deletion in bvgA (bp1878) and was obtained as follows. Two 400-bp DNA fragments flanking the region to be deleted were obtained by PCR using the BPSM genomic DNA as the template and the oligonucleotide pairs 5′-AGACTTGAGAGCATCGCTACCATTCTAGATGAAATCCAGTGCCATAGTCT-3′ and 5′-TACAGGGTGATCGTCAATGATG-3′ and 5′-CATCATTGACGATCACCCTGTAAAACGCAACAATCTCGCCTAGC-3′ and 5′-ATAAGCTTGCCATTGACGGTGCCGATGAG-3′ as primers. The two resulting PCR products were used as the template with the first and last oligonucleotides described above to obtain an 865-bp final DNA fragment. The resulting XbaI-HindIII fragment was then introduced into XbaI-HindIII-digested pSS1129, yielding pSS1129ΔBvgA. This construct was used for allelic exchange in BPSM, yielding BPSMΔBvgA that produces a truncated form of BvgA composed of the 13 first and 6 last amino acids of BvgA.

RNA extractions.

B. pertussis strains were grown on BG agar plates for 2 days at 37°C and then cultured in modified Stainer-Scholte (SS) liquid medium supplemented when indicated with 50 mM MgSO4 at 37°C under agitation. The bacterial cultures were stopped at mid-exponential phase (optical density at 600 nm [OD600] of 1.5 to 2) by adding 2 ml of a mixture of 5:95 phenol/ethanol (vol/vol) to 8 ml of bacterial suspensions. Bacteria were pelleted, and total RNA was extracted using TRI Reagent (Invitrogen) according to the manufacturer’s instructions. Genomic DNA was removed by DNase I treatment (Sigma-Aldrich).

Illumina RNA sequencing.

RNAseq experiments were performed on two independent cultures for each condition. For each RNAseq sample, DNA-depleted total RNA was treated with the Ribo-Zero rRNA removal kit (Illumina) according to the manufacturer’s recommendations. The rRNA-depleted RNA was then used to build the Illumina library using the TruSeq RNA library preparation kit, followed by sequencing on an Illumina NextSeq 500 benchtop sequencer on SR150 high-output run mode. The RNAseq data of each sample were analyzed using both Rockhopper v2.0.3 and SPARTA with the default parameters to calculate the RPKM and P values for each coding sequence with B. pertussis Tohama I BX470248 genome annotation (27).

ChIP analysis.

The B. pertussis ChIP protocol was adapted from that described by Solans et al. (28). B. pertussis strains were grown on Bordet-Gengou (BG) agar plates for 2 days at 37°C and then cultured in modified Stainer-Scholte (SS) liquid medium supplemented when indicated with 50 mM MgSO4 at 37°C under agitation. The bacterial cultures were stopped at mid-exponential phase (OD600 of 1.5 to 2) by adding 1% final concentration of formaldehyde and incubating for 30 min at 37°C with gentle shaking. Next, 125 mM glycine was added to saturate the cross-linking reaction and incubated for 30 min at 37°C with gentle shaking. The bacterial suspension was centrifuged at 5,000 × g for 10 min and washed twice with phosphate-buffered saline (PBS). Cell pellets were resuspended in immunoprecipitation buffer plus antiprotease Mini (Roche). Bacteria were lysed by sonication with a refrigerated Diagenode Bioruptor at 4°C with specific TPX Diagenode tubes. Cell debris was removed by centrifugation (15 min, 4,000 rpm, 4°C). To check the DNA fragmentation before immunoprecipitation (IP), a sample of DNA fragments was heated for 6 h at 65°C, treated with RNase A and proteinase K, and precipitated. The fragment size distribution was checked on a bioanalyzer to obtain a fragmentation size between 150 bp and 600 bp. IP was performed with anti-BvgA antibodies that recognize phosphorylated and nonphosphorylated BvgA equally well (29), and the samples were incubated at 4°C on a wheel for 16 h. Protein G magnetic Dynabeads (Invitrogen) were added to the IP samples and incubated for 4 h at 4°C on the wheel. Beads were separated from the lysate with a magnet and washed with IP buffer as in described in reference 28. Beads were finally resuspended in Tris-EDTA (TE) buffer and incubated for 6 h at 65°C. The supernatant was then treated with RNase A and proteinase K, and the DNA fragments were extracted with phenol-chloroform and precipitated with isopropanol. The ChIP procedure was performed on two independent cultures of each strain and on one culture of BPSM without BvgA antibody as a ChIP negative control.

Illumina ChIPseq sequencing.

The DNA fragments isolated by ChIP were used to build the Illumina library using the Illumina TruSeq ChIP library preparation kit, followed by sequencing on an Illumina NextSeq 500 benchtop sequencer on SR150 high-output run mode. The ChIPseq data of each sample were analyzed using the ChIPseq analysis module of CLC Genomics v11.0 using the default parameters and the B. pertussis Tohama I BX470248 genome annotation to map reads, do the peak calling, and calculate peak shape scores. To avoid false positives and to increase clarity, ChIPseq peaks were considered informative if the CLC Genomics peak shape score was >5 and if the number of reads at the center of the peak was >1,000. The BvgA ChIPseq data obtained from the BPSM cultures were biologically reproducible between the two experiments with a correlation value R of 0.897 (data not shown). To determine the ChIPseq enriched regions, read alignments were analyzed using the peak caller software MACS2 version 2.1.2 with the following command: “macs2 callpeak -t CHIP_FILE –c CONTROL_FILE –format=BAM –name=bvgA –gsize = 2860332 –broad –nomodel -p 0.00001” (30). The mapped read depth was calculated on ChIPseq CLC Genomics output bam files using the SAMtools depth module of SAMtools (31).

RACE analysis.

For each RACE sample, total RNA, extracted as described above, was treated with GeneRacer kit (Invitrogen) according to the manufacturer’s instructions and using BvgA RACE primer ATCAGGACCCGGACGGCGAATC. The cDNA isolated by the RACE experiment was then used to build the Illumina library using the Illumina TruSeq ChIP library preparation kit, followed by sequencing on an Illumina NextSeq 500 benchtop sequencer on SR150 low-output run mode.

Quantitative real-time PCR.

Generation of cDNA and quantitative PCR (qPCR) were performed as described by Coutte et al. (3) using primers BvgA RACE (ATCAGGACCCGGACGGCGAATC), qPCR P1 BvgA (CACTCATGCCCGTATCGTTG), and qPCR P2 BvgA (AGCCATTCCTTTGACGCATC). At completion of the qPCR run, a dissociation curve from 55°C to 95°C was run to verify that a single product was generated. The efficiency of amplification for each primer pair was determined by serial dilution. The expression of the housekeeping gene bp3416 was used as reference to normalize the data (3). The experiments were performed on two replicative cultures with at least 3 technical replicates for each condition.

Data availability.

RNAseq data have been deposited at Gene Expression Omnibus under accession GSE137180, and ChIPseq data were deposited at Gene Expression Omnibus under accession GSE137027.
  30 in total

Review 1.  The Bordetella pertussis model of exquisite gene control by the global transcription factor BvgA.

Authors:  Kimberly B Decker; Tamara D James; Scott Stibitz; Deborah M Hinton
Journal:  Microbiology       Date:  2012-05-24       Impact factor: 2.777

2.  The construction of a cloning vector designed for gene replacement in Bordetella pertussis.

Authors:  S Stibitz; W Black; S Falkow
Journal:  Gene       Date:  1986       Impact factor: 3.688

3.  Adaptation of Bordetella pertussis to the Respiratory Tract.

Authors:  Lucille F van Beek; Daan de Gouw; Marc J Eleveld; Hester J Bootsma; Marien I de Jonge; Frits R Mooi; Aldert Zomer; Dimitri A Diavatopoulos
Journal:  J Infect Dis       Date:  2018-05-25       Impact factor: 5.226

4.  Novel architectural features of Bordetella pertussis fimbrial subunit promoters and their activation by the global virulence regulator BvgA.

Authors:  Qing Chen; Kimberly Baxter Decker; Philip E Boucher; Deborah Hinton; Scott Stibitz
Journal:  Mol Microbiol       Date:  2010-09       Impact factor: 3.501

5.  Heparin-inhibitable lectin activity of the filamentous hemagglutinin adhesin of Bordetella pertussis.

Authors:  F D Menozzi; R Mutombo; G Renauld; C Gantiez; J H Hannah; E Leininger; M J Brennan; C Locht
Journal:  Infect Immun       Date:  1994-03       Impact factor: 3.441

6.  Characterization of a Bvg-regulated fatty acid methyl-transferase in Bordetella pertussis.

Authors:  Alex Rivera-Millot; Elodie Lesne; Luis Solans; Loic Coutte; Justine Bertrand-Michel; Philippe Froguel; Véronique Dhennin; David Hot; Camille Locht; Rudy Antoine; Françoise Jacob-Dubuisson
Journal:  PLoS One       Date:  2017-05-11       Impact factor: 3.240

7.  Signal transduction-dependent small regulatory RNA is involved in glutamate metabolism of the human pathogen Bordetella pertussis.

Authors:  Kristina Keidel; Fabian Amman; Ilona Bibova; Jakub Drzmisek; Vladimir Benes; David Hot; Branislav Vecerek
Journal:  RNA       Date:  2018-08-10       Impact factor: 4.942

8.  Non-canonical protein-DNA interactions identified by ChIP are not artifacts.

Authors:  Richard P Bonocora; Devon M Fitzgerald; Anne M Stringer; Joseph T Wade
Journal:  BMC Genomics       Date:  2013-04-15       Impact factor: 3.969

9.  Model-based analysis of ChIP-Seq (MACS).

Authors:  Yong Zhang; Tao Liu; Clifford A Meyer; Jérôme Eeckhoute; David S Johnson; Bradley E Bernstein; Chad Nusbaum; Richard M Myers; Myles Brown; Wei Li; X Shirley Liu
Journal:  Genome Biol       Date:  2008-09-17       Impact factor: 13.583

10.  The multifaceted RisA regulon of Bordetella pertussis.

Authors:  Loïc Coutte; Ludovic Huot; Rudy Antoine; Stephanie Slupek; Tod J Merkel; Qing Chen; Scott Stibitz; David Hot; Camille Locht
Journal:  Sci Rep       Date:  2016-09-13       Impact factor: 4.379

View more
  5 in total

1.  A balancing act in transcription regulation by response regulators: titration of transcription factor activity by decoy DNA binding sites.

Authors:  Rong Gao; Libby J Helfant; Ti Wu; Zeyue Li; Samantha E Brokaw; Ann M Stock
Journal:  Nucleic Acids Res       Date:  2021-11-18       Impact factor: 16.971

2.  A Mutation Upstream of the rplN-rpsD Ribosomal Operon Downregulates Bordetella pertussis Virulence Factor Production without Compromising Bacterial Survival within Human Macrophages.

Authors:  Jakub Novák; David Jurnečka; Irena Linhartová; Jana Holubová; Ondřej Staněk; Daniel Štipl; Ana Dienstbier; Branislav Večerek; Nayara Azevedo; Jan Provazník; Vladimír Beneš; Peter Šebo
Journal:  mSystems       Date:  2020-12-08       Impact factor: 6.496

Review 3.  Pathogenicity and virulence of Bordetella pertussis and its adaptation to its strictly human host.

Authors:  Thomas Belcher; Violaine Dubois; Alex Rivera-Millot; Camille Locht; Françoise Jacob-Dubuisson
Journal:  Virulence       Date:  2021-12       Impact factor: 5.882

4.  The regulon of Brucella abortus two-component system BvrR/BvrS reveals the coordination of metabolic pathways required for intracellular life.

Authors:  Olga Rivas-Solano; Mathilde Van der Henst; Amanda Castillo-Zeledón; Marcela Suárez-Esquivel; Lohendy Muñoz-Vargas; Zeuz Capitan-Barrios; Nicholas R Thomson; Esteban Chaves-Olarte; Edgardo Moreno; Xavier De Bolle; Caterina Guzmán-Verri
Journal:  PLoS One       Date:  2022-09-21       Impact factor: 3.752

Review 5.  Conquering the host: Bordetella spp. and Pseudomonas aeruginosa molecular regulators in lung infection.

Authors:  Alina M Holban; Courtney M Gregoire; Monica C Gestal
Journal:  Front Microbiol       Date:  2022-09-26       Impact factor: 6.064

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.