Cheng-Hsin Liu1,2, Ryan Seo3, Tammy Szu-Yu Ho1, Michael Stankewich4, Peter J Mohler5, Thomas J Hund6, Jeffrey L Noebels1,3, Matthew N Rasband1,2. 1. Department of Neuroscience, Baylor College of Medicine, Houston, United States. 2. Program in Developmental Biology, Baylor College of Medicine, Houston, United States. 3. Department of Neurology, Baylor College of Medicine, Houston, United States. 4. Department of Pathology, Yale University, New Haven, United States. 5. Department of Physiology and Cell Biology, The Ohio State University, Columbus, United States. 6. Department of Biomedical Engineering, The Ohio State University, Columbus, United States.
Abstract
Previously, we showed that a hierarchy of spectrin cytoskeletal proteins maintains nodal Na+ channels (Liu et al., 2020). Here, using mice lacking β1, β4, or β1/β4 spectrins, we show this hierarchy does not function at axon initial segments (AIS). Although β1 spectrin, together with AnkyrinR (AnkR), compensates for loss of nodal β4 spectrin, it cannot compensate at AIS. We show AnkR lacks the domain necessary for AIS localization. Whereas loss of β4 spectrin causes motor impairment and disrupts AIS, loss of β1 spectrin has no discernable effect on central nervous system structure or function. However, mice lacking both neuronal β1 and β4 spectrin show exacerbated nervous system dysfunction compared to mice lacking β1 or β4 spectrin alone, including profound disruption of AIS Na+ channel clustering, progressive loss of nodal Na+ channels, and seizures. These results further define the important role of AIS and nodal spectrins for nervous system function.
Previously, we showed that a hierarchy of spectrin cytoskeletal proteins maintains nodal Na+ channels (Liu et al., 2020). Here, using mice lacking β1, β4, or β1/β4 spectrins, we show this hierarchy does not function at axon initial segments (AIS). Although β1 spectrin, together with AnkyrinR (AnkR), compensates for loss of nodal β4 spectrin, it cannot compensate at AIS. We show AnkR lacks the domain necessary for AIS localization. Whereas loss of β4 spectrin causes motor impairment and disrupts AIS, loss of β1 spectrin has no discernable effect on central nervous system structure or function. However, mice lacking both neuronal β1 and β4 spectrin show exacerbated nervous system dysfunction compared to mice lacking β1 or β4 spectrin alone, including profound disruption of AIS Na+ channel clustering, progressive loss of nodal Na+ channels, and seizures. These results further define the important role of AIS and nodal spectrins for nervous system function.
Clustered ion channels at axon initial segments (AIS) and nodes of Ranvier are essential for proper nervous system function. Spectrin tetramers, consisting of α2 and β4 spectrins have been proposed to participate in Na+ channel clustering at the AIS and nodes of Ranvier. Mice lacking α2 spectrin have disrupted AIS and node integrity, and axon degeneration (Huang et al., 2017b; Huang et al., 2017a), suggesting spectrin cytoskeletons are required in these domains. Mice with mutant forms of β4 spectrin also show disrupted AIS integrity, but they have a milder phenotype than α2 spectrin-deficient mice (Komada and Soriano, 2002; Lacas-Gervais et al., 2004; Yang et al., 2004). Differences may reflect truncated remnants of β4 spectrin that partially execute spectrin’s function. Furthermore, compensation by other β spectrins has been found at nodes of Ranvier (Ho et al., 2014), but has not been elucidated at the AIS.Using conditional knockout mice, we previously showed that loss of β4 spectrin from nodes of Ranvier can be compensated for by β1 spectrin (Liu et al., 2020). Furthermore, we found that nodal spectrins are not required for node assembly, but rather function to maintain the molecular organization of nodes including high densities of voltage-gated Na+ (Nav) channels. However, these experiments only examined nodes in dorsal root ganglion sensory neurons in order to separate the function of nodal spectrins from AIS spectrins; DRG neurons do not have an AIS (Gumy et al., 2017). Consistent with these findings in mice, human pathogenic variants of β4 spectrin do not have sensory neuron dysfunction (Wang et al., 2018). However, these individuals have severe motor axonal neuropathy. These differences suggest that an AIS may render neurons particularly susceptible to loss of spectrin cytoskeletons. To determine why AIS are more sensitive to loss of AIS spectrins and to gain insight into the pathomechanisms of human spectrinopathies, we generated β1, β4, and β1/β4 spectrin-deficient mice.
Results
Loss of β4 spectrin impairs AIS nav channel clustering
To disrupt the function of β4 spectrin at AIS we generated Nes-Cre;Sptbn4 mice. Mice lacking β4 spectrin show a pronounced tremor and perform significantly worse on the rotarod (Figure 1A) compared to littermate controls. Immunostaining showed that in the absence of β4 spectrin, AIS Nav channels and AnkG are significantly reduced in β4 spectrin-deficient mice (Figure 1B,C). These results are similar to those obtained in other whole-body β4 spectrin mutant mice (Komada and Soriano, 2002; Lacas-Gervais et al., 2004). Remarkably, despite the loss of β4 spectrin, super-resolution stimulated emission depletion (STED) microscopy of AIS AnkG (Figure 1D) showed that AnkG retained its appropriate periodic spacing (Figure 1E). In contrast to AIS, nodes of Ranvier in Nes-Cre;Sptbn4 mice still had appropriately clustered nodal Nav channels (Figure 1F) since β1 spectrin and AnkR compensate for loss of β4 spectrin and AnkG at CNS nodes in the corpus callosum (Figure 1G,H; Ho et al., 2014; Liu et al., 2020). Thus, AIS are disrupted without β4 spectrin. In contrast, Nes-Cre;Sptbn4 CNS nodes of Ranvier are rescued by β1 spectrin and AnkR.
Figure 1.
Mice lacking β4 spectrin in the central nervous system have impaired motor behavior and disrupted AIS, but intact nodal Nav clustering.
(A) Accelerating rotarod test performed on 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. Sptbn4, N = 8; Nes-cre;Sptbn4, N = 7. Data are mean ± SEM, **p=0.0017. (B) Immunostaining of cortical brain sections from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against the β4 spectrin (blue), PanNav channels (green), and AnkG (red). Scale bar, 50 μm. (C) Normalized fluorescence intensity of AnkG and PanNav channel at AIS were measured from cortical brain sections of 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice with a total of 51–70 AIS were measured in each genotype. Data are mean ± SEM, For AnkG, **p=0.0079; PanNav channel, *p=0.0282. (D) STED images of AnkG at cortical AIS from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. The regions between the yellow lines (as shown in images) were used to generate intensity profile as shown in lower panels. (E) Measurements of cortical AIS AnkG spacing by STED imaging from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. Data are mean ± SEM. Sptbn4, n = 107 spacings; Nes-cre;Sptbn4, n = 96 spacings were measured from 2 mice of each genotype. (F) Immunostaining of corpus callosum from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against PanNav channel (green), and Caspr (red). Scale bar, 10 μm. (G) Immunostaining of corpus callosum from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against β4 spectrin (blue), β1 spectrin (green), and Caspr (red). Scale bar, 10 μm. (H) Immunostaining of corpus callosum from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against Caspr (blue), AnkG (green), and AnkR (red). Scale bar, 10 μm.
Mice lacking β4 spectrin in the central nervous system have impaired motor behavior and disrupted AIS, but intact nodal Nav clustering.
(A) Accelerating rotarod test performed on 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. Sptbn4, N = 8; Nes-cre;Sptbn4, N = 7. Data are mean ± SEM, **p=0.0017. (B) Immunostaining of cortical brain sections from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against the β4 spectrin (blue), PanNav channels (green), and AnkG (red). Scale bar, 50 μm. (C) Normalized fluorescence intensity of AnkG and PanNav channel at AIS were measured from cortical brain sections of 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice with a total of 51–70 AIS were measured in each genotype. Data are mean ± SEM, For AnkG, **p=0.0079; PanNav channel, *p=0.0282. (D) STED images of AnkG at cortical AIS from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. The regions between the yellow lines (as shown in images) were used to generate intensity profile as shown in lower panels. (E) Measurements of cortical AIS AnkG spacing by STED imaging from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. Data are mean ± SEM. Sptbn4, n = 107 spacings; Nes-cre;Sptbn4, n = 96 spacings were measured from 2 mice of each genotype. (F) Immunostaining of corpus callosum from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against PanNav channel (green), and Caspr (red). Scale bar, 10 μm. (G) Immunostaining of corpus callosum from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against β4 spectrin (blue), β1 spectrin (green), and Caspr (red). Scale bar, 10 μm. (H) Immunostaining of corpus callosum from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against Caspr (blue), AnkG (green), and AnkR (red). Scale bar, 10 μm.
β1 spectrin is found at the AIS of some β4 spectrin-deficient neurons
β1 spectrin is expressed in motor and sensory cortex (layers II-V) at very high levels in some neurons (β1-high), but at low levels in most neurons (β1-low). Among the β1-high neurons, most are Parvalbumin-positive (PV(+)) interneurons where β1 spectrin colocalizes with AnkR (Figure 2A–C). In control Sptbn4 mice we did not detect AIS β1 spectrin in β1-low neurons, and only very rarely was it found at the AIS of β1-high neurons (Figure 2D,E). Remarkably, in Nes-Cre;Sptbn4 mice we found increased levels of AIS β1 spectrin in the majority of β1-high neurons (where somatic expression remained high; Figure 2D, arrow, 2E), but not at the AIS of β1-low neurons (Figure 2D, arrowheads, 2E). Despite the presence of AIS β1 spectrin in β1-high neurons, AIS Nav channels were still significantly reduced (Figure 2F) and the density of AIS Nav channels was comparable between β1-high and β1-low neurons (Figure 2G).
Figure 2.
β1 spectrin is localized at the AIS of parvalbumin-positive neurons in β4 spectrin deficient mice.
(A) Immunostaining of brain cortical sections from 3 month-old Sptb mice using antibodies against the AnkR (blue), β1 spectrin (green), and parvalbumin (PV, red). Scale bar, 50 μm. (B) The percentage of PV-positive neurons labeled with high β1 spectrin in 3 month-old Sptb mice cortex. N = 3 animals, with total 166 neurons counted. (C) The percentage of high β1 spectrin signal in cortical neurons labeled with PV or AnkR in 3 month-old Sptb mice. N = 3 animals, with total 231 and 251 neurons counted, respectively. (D) Immunostaining of brain cortical sections from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against β4 spectrin (blue), β1 spectrin (green), and AnkG (red). AIS of high and low β1 spectrin expression neurons are indicated by arrows and arrowheads, respectively. Scale bar, 25 μm. (E) The percentage of neurons with AIS β1 spectrin in β1 spectrin low and β1 spectrin high 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice in each genotype. For Sptbn4 mice, 122 and 125 β1 spectrin low/high neurons were counted, respectively; for Nes-cre; Sptbn4 mice, 122 and 120 β1 spectrin low/high neurons were counted, respectively. For β1 spectrin (low) population, p=0.1162; for β1 spectrin (high) population, ***p=1.14E-06. (F) Normalized fluorescence intensity of AnkG and PanNav channel at AIS from β1 spectrin (high) cortical neurons measured in 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice with a total of 50–63 AIS were measured in each neuron type per genotype. Data are mean ± SEM, For AnkG, p=0.0829; PanNav channel, *p=0.018. (G) The average changes of percentage of fluorescence intensity of AnkG and PanNav channel in β1 spectrin low and β1 spectrin high neurons in 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice.
(A) Accelerating rotarod test performed on 3 month-old Sptb and Nes-cre;Sptb mice. Sptb, N = 9; Nes-cre;Sptbn4, N = 8. Data are mean ± SEM, *p=0.0276. (B) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using antibodies against the parvalbumin (PV, blue), PanNav channel (green) and AnkG (red). AIS of PV-expressing neurons are indicated by arrows. Scale bar, 25 μm. (C–D) Normalized fluorescence intensity of AnkG and PanNav at AIS in PV-positive (PV+) and negative (PV-) neurons were measured from cortical brain sections of 3 month-old Sptb and Nes-cre;Sptb mice. N = 3 mice with a total of 43–44 AIS were measured in each neuron type per genotype. Data are mean ± SEM. For AnkG in PV(-) and PV(+) neurons, p=0.1395 and p=0.3505, respectively; For PanNav in PV(-) and PV(+) neurons, p=0.1813 and p=0.1812, respectively. (E) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using antibodies against the parvalbumin (red) and β4 spectrin (green). AIS of PV-expressing neurons are indicated by arrows. Scale bar, 25 μm. (F) Normalized fluorescence intensity of β4 spectrin at AIS in PV-positive (PV+) and negative (PV-) neurons measured in cortical brain sections of 3 month-old Sptb and Nes-cre;Sptb mice. N = 3 mice in each genotype, with a total of 57–69 AIS were measured in each neuron type per genotype. Data are mean ± SEM. For β4 spectrin in PV(-) and PV(+) neurons, p=0.5775 and p=0.4268, respectively.
β1 spectrin is localized at the AIS of parvalbumin-positive neurons in β4 spectrin deficient mice.
(A) Immunostaining of brain cortical sections from 3 month-old Sptb mice using antibodies against the AnkR (blue), β1 spectrin (green), and parvalbumin (PV, red). Scale bar, 50 μm. (B) The percentage of PV-positive neurons labeled with high β1 spectrin in 3 month-old Sptb mice cortex. N = 3 animals, with total 166 neurons counted. (C) The percentage of high β1 spectrin signal in cortical neurons labeled with PV or AnkR in 3 month-old Sptb mice. N = 3 animals, with total 231 and 251 neurons counted, respectively. (D) Immunostaining of brain cortical sections from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against β4 spectrin (blue), β1 spectrin (green), and AnkG (red). AIS of high and low β1 spectrin expression neurons are indicated by arrows and arrowheads, respectively. Scale bar, 25 μm. (E) The percentage of neurons with AIS β1 spectrin in β1 spectrin low and β1 spectrin high 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice in each genotype. For Sptbn4 mice, 122 and 125 β1 spectrin low/high neurons were counted, respectively; for Nes-cre; Sptbn4 mice, 122 and 120 β1 spectrin low/high neurons were counted, respectively. For β1 spectrin (low) population, p=0.1162; for β1 spectrin (high) population, ***p=1.14E-06. (F) Normalized fluorescence intensity of AnkG and PanNav channel at AIS from β1 spectrin (high) cortical neurons measured in 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice with a total of 50–63 AIS were measured in each neuron type per genotype. Data are mean ± SEM, For AnkG, p=0.0829; PanNav channel, *p=0.018. (G) The average changes of percentage of fluorescence intensity of AnkG and PanNav channel in β1 spectrin low and β1 spectrin high neurons in 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice.
Mice lacking β1 spectrin in the central nervous system show normal motor performance and AIS structure.
(A) Accelerating rotarod test performed on 3 month-old Sptb and Nes-cre;Sptb mice. Sptb, N = 9; Nes-cre;Sptbn4, N = 8. Data are mean ± SEM, *p=0.0276. (B) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using antibodies against the parvalbumin (PV, blue), PanNav channel (green) and AnkG (red). AIS of PV-expressing neurons are indicated by arrows. Scale bar, 25 μm. (C–D) Normalized fluorescence intensity of AnkG and PanNav at AIS in PV-positive (PV+) and negative (PV-) neurons were measured from cortical brain sections of 3 month-old Sptb and Nes-cre;Sptb mice. N = 3 mice with a total of 43–44 AIS were measured in each neuron type per genotype. Data are mean ± SEM. For AnkG in PV(-) and PV(+) neurons, p=0.1395 and p=0.3505, respectively; For PanNav in PV(-) and PV(+) neurons, p=0.1813 and p=0.1812, respectively. (E) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using antibodies against the parvalbumin (red) and β4 spectrin (green). AIS of PV-expressing neurons are indicated by arrows. Scale bar, 25 μm. (F) Normalized fluorescence intensity of β4 spectrin at AIS in PV-positive (PV+) and negative (PV-) neurons measured in cortical brain sections of 3 month-old Sptb and Nes-cre;Sptb mice. N = 3 mice in each genotype, with a total of 57–69 AIS were measured in each neuron type per genotype. Data are mean ± SEM. For β4 spectrin in PV(-) and PV(+) neurons, p=0.5775 and p=0.4268, respectively.
Loss of β1 spectrin does not affect AIS structure or function
β1 spectrin is expressed at high levels in PV+ cells (Figure 2A–C). However, the normal function of neuronal β1 spectrin is unknown. To determine if β1 spectrin plays important roles in the nervous system we constructed Nes-Cre;Sptb mice. β1 spectrin-deficient mice had no discernable behavioral abnormalities and performed well on the rotarod (Figure 2—figure supplement 1A). β1 spectrin-deficient mice also had normal AIS (Figure 2—figure supplement 1B), with appropriate levels of AnkG, Nav channels, and β4 spectrin in PV(+) and PV(-) neurons (Figure 2—figure supplement 1C–F). Thus, like at nodes of Ranvier (Liu et al., 2020), β1 spectrin appears not to play critical roles in AIS structure or function when β4 spectrin is present.
Figure 2—figure supplement 1.
Mice lacking β1 spectrin in the central nervous system show normal motor performance and AIS structure.
(A) Accelerating rotarod test performed on 3 month-old Sptb and Nes-cre;Sptb mice. Sptb, N = 9; Nes-cre;Sptbn4, N = 8. Data are mean ± SEM, *p=0.0276. (B) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using antibodies against the parvalbumin (PV, blue), PanNav channel (green) and AnkG (red). AIS of PV-expressing neurons are indicated by arrows. Scale bar, 25 μm. (C–D) Normalized fluorescence intensity of AnkG and PanNav at AIS in PV-positive (PV+) and negative (PV-) neurons were measured from cortical brain sections of 3 month-old Sptb and Nes-cre;Sptb mice. N = 3 mice with a total of 43–44 AIS were measured in each neuron type per genotype. Data are mean ± SEM. For AnkG in PV(-) and PV(+) neurons, p=0.1395 and p=0.3505, respectively; For PanNav in PV(-) and PV(+) neurons, p=0.1813 and p=0.1812, respectively. (E) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using antibodies against the parvalbumin (red) and β4 spectrin (green). AIS of PV-expressing neurons are indicated by arrows. Scale bar, 25 μm. (F) Normalized fluorescence intensity of β4 spectrin at AIS in PV-positive (PV+) and negative (PV-) neurons measured in cortical brain sections of 3 month-old Sptb and Nes-cre;Sptb mice. N = 3 mice in each genotype, with a total of 57–69 AIS were measured in each neuron type per genotype. Data are mean ± SEM. For β4 spectrin in PV(-) and PV(+) neurons, p=0.5775 and p=0.4268, respectively.
AnkR cannot compensate for AnkG at AIS
How can β1 spectrin compensate for loss of β4 spectrin at nodes, but not AIS? Since nodal Na+ channel clustering can be rescued in β4 spectrin-deficient mice by β1 spectrin and AnkR (Figure 1F–H; Liu et al., 2020), we first determined if AnkR is found at cortical neuron AIS. We found that AnkR is not located at AIS of control Sptbn4 cortical neurons despite its robust expression in β1-high neurons (Figures 2C and 3A, arrows, 3B). Furthermore, but in contrast to Nes-Cre;Sptbn4 nodes of Ranvier, we found no AIS AnkR in Nes-Cre;Sptbn4 mice; even cortical neurons expressing high levels of AnkR did not have AnkR at the AIS (Figure 3B). Thus, AIS β1 spectrin cannot compensate for loss of β4 spectrin since it lacks its preferential binding partner AnkR (Ho et al., 2014).
Figure 3.
AnkyrinR fails to target to the AIS.
(A) Immunostaining of brain cortical sections from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against β4 spectrin (blue), AnkR (green), and AnkG (red). AIS of high AnkR expression neurons are indicated by arrows. Scale bar, 25 μm. (B) The percentage of neurons with AnkR in the AIS in two subpopulations (AnkR low/high) of 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice in each genotype. For Sptbn4 mice, 150 and 129 AnkR low/high neurons were counted; for Nes-cre; Sptbn4 mice, 127 and 128 AnkR low/high neurons were counted. For AnkR (low) population, p=0.3739; for AnkR (high), p=0.9497. (C) Domain structure and design of AnkG-270kDa-GFP, AnkR-GFP, and AnkR/G chimera-GFP expression constructs. (D) Immunostaining of cultured rat hippocampal neurons at DIV10 after transfected with AnkG-270kDa-GFP, AnkR-GFP, or AnkR/G chimera-GFP expression plasmids. Antibodies were used against β4 spectrin (red), GFP (green), and the somatodendritic marker MAP2 (blue). AIS are indicated by arrows. Scale bar, 50 μm. (E) Quantification of the ratio of GFP signal intensity at AIS versus proximal dendrite in AnkG-270kDa-GFP, AnkR-GFP, or AnkR/G chimera-GFP transfected cultured hippocampal neurons. N = 3 batches of cultured neurons for each transfected plasmids, with total 43–49 neurons were measured for each plasmid. Data are mean ± SEM. For AnkG-270kDa-GFP versus AnkR-GFP, ***p=0.0002; for AnkR-GFP versus AnkR/G chimera-GFP, ***p=0.0002.
AnkyrinR fails to target to the AIS.
(A) Immunostaining of brain cortical sections from 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice using antibodies against β4 spectrin (blue), AnkR (green), and AnkG (red). AIS of high AnkR expression neurons are indicated by arrows. Scale bar, 25 μm. (B) The percentage of neurons with AnkR in the AIS in two subpopulations (AnkR low/high) of 3 month-old Sptbn4 and Nes-cre;Sptbn4 mice. N = 3 mice in each genotype. For Sptbn4 mice, 150 and 129 AnkR low/high neurons were counted; for Nes-cre; Sptbn4 mice, 127 and 128 AnkR low/high neurons were counted. For AnkR (low) population, p=0.3739; for AnkR (high), p=0.9497. (C) Domain structure and design of AnkG-270kDa-GFP, AnkR-GFP, and AnkR/G chimera-GFP expression constructs. (D) Immunostaining of cultured rat hippocampal neurons at DIV10 after transfected with AnkG-270kDa-GFP, AnkR-GFP, or AnkR/G chimera-GFP expression plasmids. Antibodies were used against β4 spectrin (red), GFP (green), and the somatodendritic marker MAP2 (blue). AIS are indicated by arrows. Scale bar, 50 μm. (E) Quantification of the ratio of GFP signal intensity at AIS versus proximal dendrite in AnkG-270kDa-GFP, AnkR-GFP, or AnkR/G chimera-GFP transfected cultured hippocampal neurons. N = 3 batches of cultured neurons for each transfected plasmids, with total 43–49 neurons were measured for each plasmid. Data are mean ± SEM. For AnkG-270kDa-GFP versus AnkR-GFP, ***p=0.0002; for AnkR-GFP versus AnkR/G chimera-GFP, ***p=0.0002.Why does AnkR fail to be recruited to the AIS of Nes-Cre;Sptbn4 mice when it can be recruited to nodes of Ranvier? To address this question we examined the AIS targeting of GFP-tagged AnkG and AnkR in cultured hippocampal neurons. Ankyrin proteins consist of a membrane binding domain (MBD), a spectrin-binding domain (SBD), and a regulatory domain (RD) (Figure 3C). AnkG also contains a giant exon (GE) that can result in 270 and 480 kDa splice variants (Jenkins et al., 2015). Transfection of AnkG-270kDa-GFP or AnkR-GFP into hippocampal neurons revealed that only AnkG-270kDa-GFP is targeted to the AIS (Figure 3D,E). However, introduction of the GE into AnkR (AnkR/G chimera-GFP) was sufficient for it to be targeted to the AIS (Figure 3D,E). Thus, AnkR is not found at the AIS of Nes-Cre;Sptbn4 mice since AnkR lacks the critical GE domain necessary for AIS localization.
Loss of β1 and β4 spectrin disrupts AIS and nodal nav channel clustering and causes seizures
Human pathogenic variants of β4 spectrin cause severe neurologic dysfunction (Knierim et al., 2017; Wang et al., 2018). However, DRG sensory neuron physiology is intact, most likely due to partial compensation by β1 spectrin. To further determine if β1 spectrin contributes to nervous system function in the context of β4 spectrin-deficient neurons, we generated mice lacking both β1 and β4 spectrin. We found that Nes-Cre;Sptb mice performed worse on the rotarod than Nes-Cre;Sptb, Nes-Cre;Sptbn4, or Sptb (p<0.0001; Figures 1A and 4A, Figure 2—figure supplement 1A, and Video 1). We next performed EEG recordings on 4 Nes-Cre;Sptb and 3 Sptb mice aged 1.5–3 months over prolonged periods (15–121 hr). Control mice displayed rare to infrequent spike activity but no evidence of seizures (Figure 4B). In β1/β4 spectrin-deficient mice, we detected very frequent interictal cortical spike discharges (299–792/hour; Figure 4C), and frequent spontaneous generalized spike-wave seizures (49–154/hour; Figure 4D) in both male and female mice. These brief (0.5–2 s) stereotyped seizure discharges occurred only during behavioral arrest. Immunostaining for AnkG and PanNav showed profound disruption of cortical AIS (Figure 4E–F). However, we did not observe increased neuronal cell death or neurodegeneration as indicated by antibodies against active caspase-3 or βAPP (not shown). Analysis of nodes of Ranvier in the corpus callosum showed that as in peripheral sensory neurons, the number of nodes with Nav channels gradually decreased over time (Figure 4G–H). Thus, the worsened behavioral and functional phenotypes in β1/β4 spectrin-deficient mice reflect disruption of both AIS and nodes of Ranvier and show the importance of these excitable domains for proper nervous system function.
Figure 4.
Mice lacking both β1 and β4 spectrin have severe motor impairment, epileptic activity, disrupted AIS, and gradual loss of nodal Nav channel clustering.
(A) Accelerating rotarod test performed on 3 month-old Sptb and Nes-cre;Sptb mice, with N = 7 animals tested per genotype. Data are mean ± SEM, ***p=5.78E-06. (B) Video EEG monitoring of awake and behaving 3 month-old mice showed generalized seizure discharges in Nes-cre;Sptb mice that were not detected in Sptb littermates. (C–D) Quantification of interictal-spikes/hr and seizures/hr in Sptb and Nes-cre;Sptb mice. N = 3 and 4 for Sptb and Nes-cre;Sptb mice, respectively. Data are mean ± SEM. For interictal-spikes/hr, *p=0.0194; for seizures/hr, **p=0.0085. (E) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using PanNav (green) and AnkG (red) antibodies. Scale bar, 50 μm. (F) Normalized fluorescence intensity for AnkG and PanNav at AIS in PV(-) and PV(+) neurons in cortex from 3 month old Sptb and Nes-cre;Sptb mice. N = 3 mice with a total of 37–50 AIS measured in each neuron type per genotype. Data are mean ± SEM. For AnkG in PV(-) and PV(+) neurons, *p=0.0152 and *p=0.0135, respectively; for PanNav in PV(-) and PV(+) neurons, *p=0.0159 and **p=0.0073, respectively. (G) Immunostaining of corpus callosum from 3 and 6 month-old Sptb and Nes-cre;Sptb mice using PanNav (green) and Caspr (red) antibodies. Arrows indicate intact nodal Nav clusters, whereas arrowheads indicate nodes devoid of Nav channels. Scale bar, 10 μm. (H) Quantification of the percentage of corpus callosum nodes labeled for Nav channels in Sptb and Nes-cre;Sptb mice at the indicated ages. Data are mean ± SEM. N = 3 animals with a total of 345–377 nodes counted in each genotype per age. For 3 month-old, *p=0.0152; 6 month-old, ***p=0.0009.
Video 1.
6 month-old Sptb and Nes-cre;Sptb.
Mice lacking β1 and β4-spectrin in the central nervous system showed motor impairments.
Mice lacking both β1 and β4 spectrin have severe motor impairment, epileptic activity, disrupted AIS, and gradual loss of nodal Nav channel clustering.
(A) Accelerating rotarod test performed on 3 month-old Sptb and Nes-cre;Sptb mice, with N = 7 animals tested per genotype. Data are mean ± SEM, ***p=5.78E-06. (B) Video EEG monitoring of awake and behaving 3 month-old mice showed generalized seizure discharges in Nes-cre;Sptb mice that were not detected in Sptb littermates. (C–D) Quantification of interictal-spikes/hr and seizures/hr in Sptb and Nes-cre;Sptb mice. N = 3 and 4 for Sptb and Nes-cre;Sptb mice, respectively. Data are mean ± SEM. For interictal-spikes/hr, *p=0.0194; for seizures/hr, **p=0.0085. (E) Immunostaining of brain cortical sections from 3 month-old Sptb and Nes-cre;Sptb mice using PanNav (green) and AnkG (red) antibodies. Scale bar, 50 μm. (F) Normalized fluorescence intensity for AnkG and PanNav at AIS in PV(-) and PV(+) neurons in cortex from 3 month old Sptb and Nes-cre;Sptb mice. N = 3 mice with a total of 37–50 AIS measured in each neuron type per genotype. Data are mean ± SEM. For AnkG in PV(-) and PV(+) neurons, *p=0.0152 and *p=0.0135, respectively; for PanNav in PV(-) and PV(+) neurons, *p=0.0159 and **p=0.0073, respectively. (G) Immunostaining of corpus callosum from 3 and 6 month-old Sptb and Nes-cre;Sptb mice using PanNav (green) and Caspr (red) antibodies. Arrows indicate intact nodal Nav clusters, whereas arrowheads indicate nodes devoid of Nav channels. Scale bar, 10 μm. (H) Quantification of the percentage of corpus callosum nodes labeled for Nav channels in Sptb and Nes-cre;Sptb mice at the indicated ages. Data are mean ± SEM. N = 3 animals with a total of 345–377 nodes counted in each genotype per age. For 3 month-old, *p=0.0152; 6 month-old, ***p=0.0009.
6 month-old Sptb and Nes-cre;Sptb.
Mice lacking β1 and β4-spectrin in the central nervous system showed motor impairments.
Discussion
β spectrins, together with α2 spectrin, form a periodic cytoskeleton in axons that is thought to confer flexibility and to protect axons from mechanical injury (Xu et al., 2013). In support of this idea, mouse sensory neurons lacking α2 spectrin degenerate (Huang et al., 2017a), mice lacking CNS β2 spectrin have extensive axon degeneration (Lorenzo et al., 2019), and loss of β3 spectrin causes cerebellar Purkinje neuron degeneration and spinocerebellar ataxia type 5 (SCA5) (Ikeda et al., 2006). Interestingly, we found no CNS pathology in β1 spectrin-deficient mice, suggesting that this spectrin is dispensable. β spectrins may also be restricted to or enriched at precise subcellular domains like AIS, paranodal junctions, and nodes of Ranvier, suggesting that their roles extend beyond protecting axons from mechanical injury (Liu and Rasband, 2019). Consistent with this idea, mice lacking β2 spectrin in sensory neuron axons do not degenerate, but instead have Kv1 K+ channels that move into paranodal regions formerly occupied by β2 spectrin (Zhang et al., 2013). β spectrins can also serve as a signaling platform. In cardiomyocytes, β4 spectrin regulates membrane excitability through coordinating CAMK2-mediated modification to Nav 1.5 channels for proper subcellular localization (Hund et al., 2010). This β4 spectrin-mediated signaling platform is dissociated under stress and further induces protective gene expression by STAT3 (Unudurthi et al., 2018). It will be interesting to determine whether β4 spectrin plays similar roles in the nervous system. For example, β4 spectrin-mediated signaling may influence downstream transcriptional regulation for axon regeneration after spectrin proteolysis by calpains.Previous efforts to define the function of β4 spectrin in the nervous system relied on mice with mutations resulting in truncated forms of the protein (Komada and Soriano, 2002; Yang et al., 2004). Although these studies reported disrupted AIS and nodes of Ranvier, they did not examine possible contributions from other β spectrins (e.g. β1 spectrin). In addition, these studies could not determine if nodes were affected because of a disrupted AIS. In this work, the availability of Sptb and Sptbn4 mice made it possible for us to further define the functions of β1 and β4 spectrin.At nodes, β1 and β4 spectrin function to stabilize and maintain AnkG and Nav channels, and loss of these nodal spectrins leads to the eventual reduction in clustered Nav channels, and axonal injury (Liu et al., 2020). Here, we show that loss of β4 spectrin and the failure of β1 spectrin to compensate for its loss, causes AIS proteins to be far less stable than nodal proteins. This observation helps explain the phenotypes of human pathogenic SPTBN4 variants (Wang et al., 2018). We speculate that the stability of nodal proteins compared to AIS proteins, even in the absence of β1 and β4 spectrin, depends on the flanking paranodal domains where the myelin sheath attaches to the axon. These paranodal axonal domains are enriched with an α2/β2 spectrin cytoskeleton that functions as an independent mechanism to cluster AnkG, β4 spectrin, and Nav channels in CNS axons (Amor et al., 2017). Thus, nodal proteins may be stabilized and maintained in the plasma membrane by both nodal and paranodal cytoskeletons, while AIS proteins rely mainly on β4 spectrin. One recent report indicated that β2 spectrin may also be found at AIS of hippocampal neurons in culture (Lazarov et al., 2018). However, even if β2 spectrin is present at AIS in vivo, it cannot compensate for loss of β4 spectrin.Our experiments revealed that β1 spectrin cannot compensate for AIS β4 spectrin, even in PV(+) cells expressing very high levels of AnkR and β1 spectrin. This is because β1 spectrin is the preferential binding partner for AnkR (Ho et al., 2014), and AnkR cannot be recruited to AIS. AIS require AnkG for their assembly and to cluster AIS Nav channels (Zhou et al., 1998); AnkG also recruits β4 spectrin to AIS (Yang et al., 2007). The enrichment of AnkG at AIS depends on the domain encoded by its giant exon (Jenkins et al., 2015). Our studies support this conclusion since AnkR/AnkG chimeras can be recruited to the AIS. AnkG’s giant exon participates in interactions with β4 spectrin (Jenkins et al., 2015), EB1/3 (Leterrier et al., 2011) and NDEL1 (Kuijpers et al., 2016). Together with these proteins, giant AnkG stabilizes the AIS cytoskeleton and regulates polarized trafficking. Giant AnkG also interacts with GABARAP to stabilize GABA receptors in the somatodendritic domain of neurons (Nelson et al., 2018).In summary, our results show that although AIS are thought to be the evolutionary precursors to nodes of Ranvier (Hill et al., 2008), they lack the molecular flexibility of nodes in that they require AnkG and β4 spectrin, while nodes can assemble from both AnkG/β4 spectrin and AnkR/β1 spectrin. We speculate that this difference is a consequence of myelin. Specifically, the difference between the intrinsic mechanisms of AIS assembly (Galiano et al., 2012) and the multiple glia-dependent (extrinsic) mechanisms of node assembly.
Materials and methods
Animals
Sptb and Sptbn4 mice were generated as described previously (Unudurthi et al., 2018; Liu et al., 2020). Both Sptb and Sptbn4 mice were maintained on a mixed C57BL/6 and 129/sv background. Nestin-cre (Nes-cre) mice were purchased from the Jackson laboratory (Stock No:003771). Both male and female mice were used in our studies. All experiments comply with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Baylor College of Medicine Institutional Animal Care and Use Committee.
Antibodies
The following mouse monoclonal primary antibodies were purchased from the UC Davis/NIH NeuroMab facility: AnkG (106/36; RRID:AB_10673030), AnkG (106/65; RRID:AB_10675130), PanNav (N419/78; RRID:AB_2493099), β1 spectrin (N385/21; RRID:AB_2315815), Parvalbumin (L114/3; RRID:AB_2651167), AnkR (N388A/10, RRID:AB_2491109). Other antibodies were sourced as follows: mouse anti-PanNav (Sigma-Aldrich K58/35; RRID:AB_477552), chicken anti-MAP2 (Encor cat. CPCA-MAP2; RRID:AB_2138173), rat anti-GFP (Biolegend cat. 338002; RRID:AB_1279414), chicken anti-Pan-Neurofascin (R and D Systems cat. AF3235; RRID:AB_10890736), rabbit anti-βAPP (Thermo Fisher Scientific, RRID:AB_2533902), rabbit anti-Parvalbumin (Novus, RRID:AB_791498), rabbit anti-active Caspase3 (R and D Systems, RRID:AB_2243952). The following antibodies were described previously: rabbit anti-βIV Spectrin SD antibodies (Yoshimura et al., 2016); rabbit anti-AnkR (Ho et al., 2014); rabbit anti-Caspr (RRID:AB_2572297; Rasband et al., 1999). Secondary antibodies were purchased from Thermo Fisher Scientific and Jackson ImmunoResearch Laboratories.
DNA constructs
The full-length rat 270 kDa AnkG-GFP has been described (Zhang and Bennett, 1998). The Flag-tagged full-length human AnkR (Flag-AnkR) was generated from the Ank1 isoform 1 (NM_020476.2 CDS) as described previously (Ho et al., 2014). The construct pEGFP-N1-AnkR was made with GeneArt Seamless Cloning and Assembly Kit (Thermo Fisher Scientific, cat. No. A13288). The primers for amplifying full-length AnkR from Flag-AnkR are forward: ATCTCGAGATGCCCTATTCTGTGG, and reverse: AGCTTGAGGGGGTTGGGTGTCGA. The primers for amplifying pEGFP-N1 are forward: CCAACCCCCTCAAGCTTCGAATTCTG, and reverse: TAGGGCATCTCGAGATCTGAGTCC. To generate pEGFP-N1-AnkR/G chimera, we first generate pEGFP-N1-AnkR (MBD-SBD)-AnkG (GE-270-RD) construct. pEGFP-N1-full length AnkR was cut with restriction enzymes EcoRI and Acl1 and ligated with two fragments, AnkR SBD C-terminal half and AnkG GE-270-RD, using GeneArt Seamless Cloning and Assembly Kit (Thermo Fisher Scientific, cat. No. A13288). The primers for amplifying AnkR SBD C-terminal half from pEGFP-N1-AnkR are forward: CCCCTGGTACAGGCAACGTTCCCGGAGAATG, and reverse: ACTGTTTTGTATCGCAGGGCCAG. The primers for amplifying AnkG GE270-RD from rat 270 kDa AnkG-GFP are forward: TGCGATACAAAACAGTTGAACGGAG, and reverse: GTACCGTCGACTGCAGAATTCGGTGGGCTTTCTTCTC. After generating pEGFP-N1-AnkR (MBD-SBD)-AnkG (GE-270-RD) construct, we constructed pEGFP-N1-AnkR (MBD-SBD)-AnkG (GE-270)-AnkR (RD) (i.e., AnkR/G chimera), by amplifying DNA fragment encoding AnkR (RD) by PCR using Flag-AnkR as template and introduced into the EcoRV-EcoRI sites of the pEGFP-N1-AnkR (MBD-SBD)-AnkG (GE-270-RD) construct. The primers for amplifying AnkR (RD) are forward: TCCGATATCAGCATTCTCAGTGAGTCC, and reverse: TAGAATTCGGGGGTTGGGTGTCGAGGTG.
Hippocampal neuron culture and transfection
Hippocampi were isolated and dissociated from E18.5 Sprague Dawley rat embryos. Neurons were plated on poly-D-Lysine and laminin-coated glass coverslips, and cultured in Neurobasal medium containing 1% Glutamax, 1% Penicillin/Streptomycin and 2% B27 supplement in a 5% CO2 incubator. At DIV7, DNA constructs were transfected into cultured neurons using Lipofectamine 2000; after 2 days, neurons were fixed by 4% PFA and proceed to immunostaining. Above reagents were sourced from Thermo Fisher Scientific.
Behavioral testing and electroencephalogram (EEG) recording
For accelerating rotarod test, mice were conditioned on rotating rod (Ugo Basile) with steady 5 rpm for 5 min. After 1 hr break, mice were placed on accelerated rotarod starting with 4 rpm to 40 rpm in 5 min. Latency to fall were recorded and averaged from 3 trials, which with 30 min breaks between trials. For EEG recording, mice were anesthetized with isoflurane (2.0–4% in oxygen, Patterson Veterinary Vaporizer), and silver wire electrodes (0.005″ diameter) soldered to a connector were surgically implanted bilaterally into the subdural space over frontal and parietal cortex. Mice were allowed to recover for 14 days before recording. Simultaneous video-EEG and behavioral monitoring (Labchart 8.0, ADI Systems) was performed during 24 hr sessions in adult (aged >6 weeks) mice of either sex. EEG was recorded while mice moved freely in the test cages. All EEG signals were amplified by a g.BSAMP biosignal amplifier (Austria), digitized by PowerLab with a 0.3 Hz high-pass and 60 Hz low-pass filter (ADInstruments, Dunedin, New Zealand) and acquired via Labchart 8.0 (ADInstruments). EEGs were reviewed by two trained observers.
Immunofluorescence and stimulated emission depletion (STED) microscopy
Procedures of mice tissue collection and preparation for immunostaining were described previously (Liu et al., 2020). Immunofluorescence images were captured by Axio-imager Z1 microscope or Axio-observer Z1 microscope fitted with an AxioCam digital camera, and collected by Zen software. All of these apparatus were sourced from Carl Zeiss MicroImaging. For STED microscopy, tissue sections were prepared through regular procedures except mounting using ProLong Diamond Antifade Mountant (Thermo Fisher Scientific, P36965). Imaging was performed on Leica TCS SP8X STED3x super-resolution microscope system (Leica) with 592 nm pulsed excitation laser, a pulsed 775 nm STED laser, and a 100X oil immersion objective lens (N.A. 1.4). Pixel size were around 17–30 nm among images. Deconvolution of image was performed by default LIGHTNING settings in LAS X Software (Leica). Measurements of fluorescence intensity and linear intensity profile were performed using FIJI (National Institutes of Health) and Zen (Carl Zeiss MicroImaging).
Statistical analysis
Unpaired, two-tailed Student’s t-test was performed for statistical analysis unless otherwise indicated. Data were collected and processed randomly and analyzed using GraphPad Prism and Microsoft Excel. No statistical methods or power analysis were used to predetermine sample sizes, but our sample sizes are similar to those reported previously (Susuki et al., 2013). Data distribution was assumed to be normal. Experimenters were blinded to genotype in the following experiments: all behavioral experiments comparing Sptb and Nes-cre; Sptb mice, all behavioral experiments comparing Sptbn4 and Nes-cre; Sptbn4 mice, all analyses of AnkG spacing at AIS, all analyses of AnkG, Nav channel and GFP fluorescence intensity, and all analyses of EEG recordings. Experimenters were not blinded to genotype in the behavioral tests comparing Sptb and Nes-cre; Sptb mice due to obvious motor impairments. No data points were excluded.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:The current study addressed the difference in molecular mechanisms underlying the node and axon initial segment. This study further showed the requirement of β spectrins in localizing Na+ channel to the axon initial segment.Decision letter after peer review:Thank you for submitting your article "β spectrin-dependent and domain specific mechanisms for Na+ channel clustering" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by Kang Shen as the Reviewing Editor and Olga Boudker as the Senior Editor The following individual involved in a review of your submission has agreed to reveal their identity: Vann Bennett (Reviewer #2).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, we are asking editors to accept without delay manuscripts, like yours, that they judge can stand as eLife papers without additional data, even if they feel that they would make the manuscript stronger. Thus the revisions requested below only address clarity and presentation.Summary:Both reviewers agree that this manuscript are of high quality and is in principle appropriate for publication as a Research Advance in eLife. The reviewers agree that the manuscript provides new data concerning the role of β spectrins at the axon initial segment (AIS). Previously, the authors demonstrated a hierarchy of spectrin cytoskeletal proteins in maintaining nodal Na+ channel clustering (Liu et al., 2020). β4 and β1 spectrins functionally compensate with one another, sequestering their appropriate binding partners – AnkG and AnkR respectively at the nodes of Ranvier. In the current manuscript by Liu et al., the authors show that this hierarchy/compensation is absent at the AIS, and that this is due to the lack of the targeting domain in AnkR to the AIS. Combining both in vivo and in vitro data, the manuscript provides compelling, high quality and rigorous data to illustrate the β4 spectrin-dependent role at the AIS, as well as the striking difference in the mechanism for Na+ channel clustering between nodes of Ranvier and the AIS.Essential revisions:The reviewers also found that there are several points that can be improved by including additional discussion.1) The discussion of localization of β1 spectrin and AnkyrinR in a subset of neurons should note that both of these proteins are present predominantly in the cell body, both in wildtype and β4 spectrin null neurons. While some β1 staining can be detected in the β4 knockouts, this is minimal in comparison to the cell body.2) The Introduction is a single paragraph, and could be expanded.3) The specialized function of β4 spectrin in recruiting CamKinase2 (missing in other β spectrins) should be mentioned. Similarly, discussion of specialized roles of giant AnkyrinG (ex-interactions with GABARAP, Nudel, EB proteins, and as a signaling platform) could help place the findings in perspective.4) Inclusion of seizure data for individual β1 and β4 spectrin knockout animals will help to interpret results of the double knockout. If you already have these data, it would be appropriate to add them. Otherwise, you might consider to remove this data point.Essential revisions:The reviewers also found that there are several points that can be improved by including additional discussion.1) The discussion of localization of β1 spectrin and AnkyrinR in a subset of neurons should note that both of these proteins are present predominantly in the cell body, both in wildtype and β4 spectrin null neurons. While some β1 staining can be detected in the β4 knockouts, this is minimal in comparison to the cell body.We revised the text as follows: “Remarkably, in Nes-Cre;Sptbn4 mice we found increased levels of AIS β1 spectrin in the majority of β1-high neurons (where somatic expression remained high; Figure 2D, arrow, E), but not at the AIS of β1-low neurons (Figure 2D, arrowheads, E).”2) The Introduction is a single paragraph, and could be expanded.We now include another introductory paragraph at the very beginning of the Introduction as follows:“Clustered ion channels at axon initial segments (AIS) and nodes of Ranvier are essential for proper nervous system function. […] Using conditional knockout mice, we previously showed that loss of β4 spectrin from…”3) The specialized function of β4 spectrin in recruiting CamKinase2 (missing in other β spectrins) should be mentioned. Similarly, discussion of specialized roles of giant AnkyrinG (ex-interactions with GABARAP, Nudel, EB proteins, and as a signaling platform) could help place the findings in perspective.We revised the Discussion to include the suggested material as follows:“β spectrins can also serve as a signaling platform. In cardiomyocytes, β4 spectrin regulates membrane excitability through coordinating CAMK2-mediated modification to Nav 1.5 channels for proper subcellular localization (Hund et al., 2010). […] For example, β4 spectrin-mediated signaling may influence downstream transcriptional regulation for axon regeneration after spectrin proteolysis by calpains.”“AnkG’s giant exon participates in interactions with β4 spectrin (Jenkins et al., 2015), EB1/3 (Leterrier et al., 2011) and NDEL1 (Kuijpers et al., 2016). […] Giant AnkG also interacts with GABARAP to stabilize GABA receptors in the somatodendritic domain of neurons (Nelson et al., 2018).”4) Inclusion of seizure data for individual β1 and β4 spectrin knockout animals will help to interpret results of the double knockout. If you already have these data, it would be appropriate to add them. Otherwise, you might consider to remove this data point.We agree with the reviewers’ comment that seizure data for individual β1 and β4 conditional knockout mice would be very valuable. However, we did not perform EEG recordings from β1 conditional knockout mice since they had no phenotype whatsoever and brain morphology was completely normal. We did perform EEG recordings from 3 pairs of 6 month-old β4 conditional knockout mice (and control littermates). In these experiments we observed abnormal spike activity in both control and β4 conditional knockout mice, but seizures were not detected. In consultation with Dr. Jeffrey Noebels, who is an expert on mouse EEG recordings and who did this work, we decided not to include the β4 conditional knockout mice and only include the β1/β4 conditional knockout mice. We do not know how to explain the abnormal spike activity observed in the control mice. We concluded that new cohorts of conditional knockout and control mice would need to be prepared and the experiments performed again. This would require at least an additional 6 months. Because of the strong seizure phenotype in the β1/β4 conditional knockout mice, we strongly prefer to include these data found in Figure 4A-D.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Gene (Mus musculus)
Sptb
https://www.ncbi.nlm.nih.gov/gene/20741
Gene ID: 20741
Gene (M. musculus)
Sptbn4
https://www.ncbi.nlm.nih.gov/gene/80297
Gene ID: 80297
Genetic reagent (M. musculus)
Nestin-cre
The Jackson Laboratory
Stock No:003771
Genetic reagent (M. musculus)
Sptbflox/flox
PMID:32052742
Genetic reagent (M. musculus)
Sptbn4flox/flox
PMID:30226828
Antibody
Anti-Ankyrin G (Mouse monoclonal)
Neuromab
Clone: N106/36; RRID:AB_10673030
IF (1:500)
Antibody
Anti-Ankyrin G (Mouse monoclonal)
Neuromab
Clone N106/65; RRID:AB_10675130
IF (1:100) for STED
Antibody
Anti-Ankyrin R (Mouse monoclonal)
Neuromab
Clone N380/A10; RRID:AB_2491109
IF (1:500)
Antibody
Anti-Parvalbumin (Mouse monoclonal)
Neuromab
Clone L114/3; RRID:AB_2651167
IF (1:500)
Antibody
Anti-PanNav (Mouse monoclonal)
Neuromab
Clone: N419/78; RRID:AB_2493099
IF (1:300)
Antibody
Anti-PanNav (Mouse monoclonal)
Sigma-Aldrich
Clone: K58/35; RRID:AB_477552
IF (1:300)
Antibody
Anti-β1 spectrin (Mouse monoclonal)
Neuromab
Clone: N385/21; RRID:AB_2315815
IF (1:500)
Antibody
Anti-β4 spectrin SD antibody (Rabbit polyclonal)
PMID:28123356
IF (1:500) WB (1:1000)
Antibody
Anti-Ankyrin R (Rabbit polyclonal)
PMID:25362473
IF (1:500)
Antibody
Anti-Caspr (Rabbit polyclonal)
PMID:10460258
RRID:AB_2572297
IF (1:500)
Antibody
Anti-Pan Neurofascin (Chicken polyclonal)
R and D Systems
Cat.#: AF3235; RRID:AB_10890736
IF (1:500)
Antibody
Anti-MAP2 (Chicken polyclonal)
Encor
Cat.#: CPCA-MAP2; RRID:AB_2138173
IF (1:500)
Antibody
Anti-GFP (Rat monoclonal)
Biolegend
Cat.#: 338002; RRID:AB_1279414
IF (1:500)
Antibody
Anti-Parvalbumin (Rabbit polyclonal)
Novus
RRID:AB_791498
IF (1:500)
Antibody
Anti-active Caspase 3 (Rabbit polyclonal)
R and D Systems
RRID:AB_2243952
IF (1:500)
Antibody
Anti-βAPP (Rabbit polyclonal)
Thermo Fisher Scientific
RRID:AB_2533902
IF (1:1000)
Sequence-based reagent
Genotyping primer for Sptbn4flox/flox mouse (sense)
PMID:30226828
5’-GAGCTGCATAAGTTCTTCAGCGATGC-3’
Sequence-based reagent
Genotyping primer for Sptbn4flox/flox mouse (anti-sense)
PMID:30226828
5’-ACCCCATCTCAACTGGCTTTCTTGG-3’
Sequence-based reagent
Genotyping primer for Sptbflox/flox mouse (sense)
PMID:32052742
5’- ACAGAGACAGATGGCCGAAC-3‘
Sequence-based reagent
Genotyping primer for Sptbflox/flox mouse (anti-sense)
Authors: Laura F Gumy; Eugene A Katrukha; Ilya Grigoriev; Dick Jaarsma; Lukas C Kapitein; Anna Akhmanova; Casper C Hoogenraad Journal: Neuron Date: 2017-04-19 Impact factor: 17.173
Authors: Damaris N Lorenzo; Alexandra Badea; Ruobo Zhou; Peter J Mohler; Xiaowei Zhuang; Vann Bennett Journal: Proc Natl Acad Sci U S A Date: 2019-06-17 Impact factor: 11.205
Authors: Sathya D Unudurthi; Drew Nassal; Amara Greer-Short; Nehal Patel; Taylor Howard; Xianyao Xu; Birce Onal; Tony Satroplus; Deborah Hong; Cemantha Lane; Alyssa Dalic; Sara N Koenig; Adam C Lehnig; Lisa A Baer; Hassan Musa; Kristin I Stanford; Sakima Smith; Peter J Mohler; Thomas J Hund Journal: J Clin Invest Date: 2018-11-12 Impact factor: 14.808
Authors: Veronique Amor; Chuansheng Zhang; Anna Vainshtein; Ao Zhang; Daniel R Zollinger; Yael Eshed-Eisenbach; Peter J Brophy; Matthew N Rasband; Elior Peles Journal: Elife Date: 2017-01-30 Impact factor: 8.140
Authors: A D Nelson; R N Caballero-Florán; J C Rodríguez Díaz; J M Hull; Y Yuan; J Li; K Chen; K K Walder; L F Lopez-Santiago; V Bennett; M G McInnis; L L Isom; C Wang; M Zhang; K S Jones; P M Jenkins Journal: Mol Psychiatry Date: 2018-11-30 Impact factor: 15.992
Authors: Chih-Chuan Wang; Xilma R Ortiz-González; Sabrina W Yum; Sara M Gill; Amy White; Erin Kelter; Laurie H Seaver; Sansan Lee; Graham Wiley; Patrick M Gaffney; Klaas J Wierenga; Matthew N Rasband Journal: Am J Hum Genet Date: 2018-05-31 Impact factor: 11.043
Authors: Sharon R Stevens; Colleen M Longley; Yuki Ogawa; Lindsay H Teliska; Anithachristy S Arumanayagam; Supna Nair; Juan A Oses-Prieto; Alma L Burlingame; Matthew D Cykowski; Mingshan Xue; Matthew N Rasband Journal: Elife Date: 2021-06-28 Impact factor: 8.140
Authors: Chuansheng Zhang; Abhijeet Joshi; Yanhong Liu; Ozlem Sert; Seth G Haddix; Lindsay H Teliska; Anne Rasband; George G Rodney; Matthew N Rasband Journal: Curr Biol Date: 2021-07-20 Impact factor: 10.900