Literature DB >> 32416856

Reverse transcription recombinase-aided amplification assay combined with a lateral flow dipstick for detection of avian infectious bronchitis virus.

Wenjing Wang1, Chunguang Wang2, Peng Zhang2, Shanshan Yao2, Jingru Liu2, Xianghe Zhai2, Tie Zhang3.   

Abstract

The study was conducted to develop a specific, simple, and sensitive method for diagnosis of avian infectious bronchitis virus (IBV). In this experiment, the selected downstream primer was labeled with biotin and the 5' end of RAA probe was labeled with FAM by reverse transcription recombinase-aided amplification (RT-RAA) combined with lateral flow dipstick (LFD). A RT-RAA-LFD assay that could be used for detection of IBV was established after optimization of RT-RAA reaction time, reaction temperature, and primer concentration. This method did not need reverse transcription of IBV template under isothermal condition (37°C), the amplification of target gene fragments could be completed within only 24 min, and the amplification products could be visually observed and determined by LFD within 3 min. The specificity test demonstrated that there was no cross reaction with the nucleic acids of other similar common pathogens. The lowest detectable limit for IBV was 102 copies/μL, and this method was 100 times more sensitive than conventional PCR (104 copies/μL), as verified by sensitivity test. The results showed that RT-RAA-LFD assay with strong specificity and high sensitivity was simple and easy to operate, and could be used for rapid detection of IBV in clinical diagnosis.
Copyright © 2019 The Author(s). Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  avian infectious bronchitis virus; lateral flow dipstick; reverse transcription recombinase-aided amplification; sensitivity; specificity

Mesh:

Substances:

Year:  2019        PMID: 32416856      PMCID: PMC7199787          DOI: 10.3382/ps/pez559

Source DB:  PubMed          Journal:  Poult Sci        ISSN: 0032-5791            Impact factor:   4.014


INTRODUCTION

Avian infectious bronchitis (IB) is a viral respiratory disease in chickens caused by avian infectious bronchitis virus (IBV) (Cook and Heijden, 2010). Infectious bronchitis virus is an enveloped, non-segmented, single-stranded, positive-sense RNA virus belonging to the genus Gammacoronavirus of the family Coronaviridae (Cheng et al., 2018; Haji-Abdolvahab et al., 2019). Infectious bronchitis virus genome is unstable and prone to point mutation, deletion, insertion, etc., which leads to continuous isolation of gene mutants. In addition, there are many serotypes of IBV, and the cross-protection between different serotypes or genotypes is very weak (Leghari et al., 2016), which makes the immune control of this disease constantly challenged (Faruku et al., 2015). Therefore, although the disease has been reported for more than 60 yr, its prevention and control is still not good (Cook et al., 2012). The incidence of IBV is high, broilers infected with this virus will grow slowly and feed conversion ratio (FCR) will decline, and if laying hens are infected with IBV, it can lead to the decline of egg production and egg quality, so IB is one of the main infectious diseases detrimental to China's poultry industry. IB is characterized by respiratory signs, kidney lesions, and proventriculus lesions (Zhao et al., 2014). The respiratory signs include coughing, sneezing, gasping, and tracheal rales, and there may be gray feces for some diseased chickens (Wu et al., 1998). Necropsy showed catarrhal and hemorrhagic inflammatory lesions of the trachea. Chickens of all ages can be infected with IBV, which is mainly found in respiratory epithelial cells, digestive tract, and other tissues such as kidney, fallopian tube, and testes (Cavanagh, 2007). With clinical symptoms and pathological features similar to those of Newcastle disease (ND), avian influenza (AI), and infectious laryngotracheitis (ILT), IB is easy to be misdiagnosed (Giovanni et al., 2017). The current methods for detection of IBV are conventional virus isolation (CVI), reverse transcription-polymerase chain reaction-agarose gel electrophoresis (RT-PCR-AGE), enzyme-linked immunosorbent assay (ELISA), and loop-mediated isothermal amplification (LAMP). However, these methods often require expensive devices and professional operators, making it very inconvenient for veterinarians at the grass roots level in many regions. Reverse transcription recombinase-aided amplification (RT-RAA), following the principle of recombinase polymerase amplification (RPA), is employed for simulating the enzymatic process of DNA replication in vivo, and amplifying the DNA template. Using this technique, the reverse transcription of RNA and DNA amplification can be completed in a short time at a constant temperature of about 37 to 39°C. At the same time, the probes were labeled with 6-carboxyfluorescein (FAM) and primers were labeled with biotin in the experiment to form double-labeled amplification product that could be visually observed and determined by lateral flow dipstick (LFD) with FAM antibody test line and biotin antibody control line. This method with high specificity and sensitivity was easy and convenient to use, and thus had broad application prospects in clinical diagnosis (Kim and Easley, 2011).

MATERIALS AND METHODS

Materials

Infectious bronchitis virus standard strain (AV1511) and infectious laryngotracheitis virus (ILTV) strain Wanggang (AV195) were purchased from China Institute of Veterinary Drug Control, and avian influenza virus (AIV) and Newcastle disease virus (NDV) were preserved after clinical detection in our laboratory. Virus genomic DNA/RNA extraction kit was bought from Tiangen Biotech Co., Ltd.; RT-RAA nucleic acid amplification kit was bought from Qitian Biotechnology Co., Ltd.; LFD (with FAM antibody test line and biotin antibody control line) was bought from Ustar Biotechnologies Co., Ltd.; T-Vector Pmd20 plasmid was bought from Takara Biomedical Technology Co., Ltd.; primers and probes were synthesized and labeled by Sangon Biotech Co., Ltd.

Methods

Design and Screening of Primers

According to the requirements of RT-RAA nucleic acid amplification kit, 4 pairs of primers were designed by comparison with the sequences of IBV N gene (GenBank: EF602441.1) and IBV S2 gene (GenBank: EF602461.1) (Table 1). Primers 1 to 3 were designed according to the sequence of IBV N gene, and primer 4 was designed according to the sequence of IBV S2 gene. RNA of IBV was extracted as a template. Reaction system: Reaction buffer 25 μL; upstream and downstream primers (10 μM) 2.1 μL each; template 1 μL; purified water 17.3 μL; magnesium acetate 2.5 μL. After 30 min reaction at 39°C, electrophoresis in 2% agarose gels was used to test RT-RAA reaction products, and a pair of primers from which single and clear band as big as the target segment was amplified, were selected. The selected downstream primer was labeled with biotin at its 5′ end. The selected primers were compared with the gene sequence, and the probes were designed and labeled based on the requirements of kit. Probe sequence: 5′-GTCACAACAGCGTGAGTTAGCCACGCAAAAG /idSp/ATTAATGAGTGTGTTA-3′. The probe was modified with a FAM fluorophore at its 5′ end, there was a single-base gap at a position 31 bp from the 5′ end, which was modified with tetrahydrofuran residue, and the 3′ end was blocked by phosphorylation. The labeled primers and probes were used in follow-on experiment.
Table 1

Selection of primers for RT-RAA reactions.

PrimersSequences (5′-3′)Gene location
IBV-1-FTCCGTTGGGATTTTATTCCTCTGAATCGTG468 to 498
IBV-1-RTACTGGTCTGGTATAGCACATGGTTGGGTC683 to 703
IBV-2-FAGTATCTGGCATCGCCTCATTTCTTTCTAACC238 to 270
IBV-2-RCCTACCACGATTCAGAGGAATAAAATCCCAACG502 to 535
IBV-3-FGCCGATTTTGTAAACGTACCATTCCACCAG684 to 711
IBV-3-RAACACGCCCATCCTTAATACCTTCCTCATT814 to 844
IBV-4-FCGTCTTATAACTGGTAGATTGTCATCACTC989 to 1019
IBV-4-RATTACCACAAAAGGAGTACCTAGTAGACTG1142 to 1172
Selection of primers for RT-RAA reactions.

Establishment of RT-RAA-LFD Assay

Reaction system: Reaction buffer 25 μL; upstream and downstream primers (10 μM) 2.1 μL each; probe 0.6 μL; template 1 μL; purified water 16.7 μL; magnesium acetate 2.5 μL. For the negative control, purified water was used instead of template. After 25 min reaction at 39°C, 10 μL of RT-RAA products were transferred to the test area of dipstick, the dipstick was inserted into a 2 mL centrifuge tube with 100 μL of buffer, and the results were observed after 3 min. Dipstick criteria: It was positive when 2 red bands appeared, one in the quality control area and the other in the test area, and positive results showed that nucleic acid fragments to be detected were contained in the sample; it was negative if there was a red band in the quality control area while no red band was found in the test area, and negative results showed that no nucleic acid fragment for detection was contained in the sample.

Optimization of Reaction Conditions

Optimization of reaction temperature: 33, 35, 37, 39, and 41°C were selected as reaction temperatures, respectively. Optimization of reaction time: At the optimal temperature of 37°C, 16, 18, 20, 22 and 24 min were selected as reaction time, respectively. Optimization of primer and probe concentration: At the optimized temperature and reaction time, primer concentration and probe concentrations were optimized on the basis of 10,000, 5,000, 2,500, 1,250, 625 nmol/L. Criteria for the best reaction conditions: Clear and obvious quality control line, shortest reaction time, lowest primer or probe concentration.

Specificity Test

The genomes of ILTV, NDV, and AIV were extracted by the virus genomic DNA/RNA extraction kit. RNA of IBV, NDV, and AIV and DNA of ILTV were used as templates, and the specificity of RT-RAA-LFD was verified by RT-RAA reaction and LFD assay.

Sensitivity Test

Preparation of recombinant plasmids: The template cDNA was obtained by reverse transcription of IBV genomic RNA, and primer was IBV-4-F/IBV-4-R. It was the optimal primer obtained by screening, the primer length was modified according to the requirements of conventional PCR, and sequence was F:5′-CGTCTTATAACTGGTAGATTG-3′, R:5′-ATTACCACAAAAGGAGTACCT-3′. 50 μL reaction system: 2 × Taq Mix 25 μL; cDNA template 2 μL; upstream and downstream primers (10 μM) 1 μL each; replenished with 21 μL of ddH2O. Reaction system: It was predenaturalized at 94°C for 5 min; denaturalized at 94°C for 45 s; annealed at 56°C for 45 s; extended at 72°C for 60 s, a total of 35 cycles of amplification; extended at 72°C for 10 min, and then stored at 4°C. The purified target fragment was ligated to pMD20 plasmid after gel extraction of PCR products. The standard plasmid was constructed after purification and screening, and the DNA copy number in the standard plasmid was calculated after the nucleic acid content was determined. The standard plasmid constructed was diluted to a concentration gradient of 100 to 107 copies/μL, and the sensitivity of conventional PCR assay, RT-RAA-LFD assay, and RFQ-PCR assay to IBV was compared. Conventional PCR system (25 μL): 2 × Gflex PCR Buffer (Mg2+, dNTP plus) 12.5 μL; upstream and downstream primers (10 μM) 0.5 μL each; Tks Gflex DNA polymerase (1.25 units/μL) 0.5 μL; template 1 μL; the final volume was made up to 25 μL with ddH2 O. Reaction system: It was predenaturalized at 94°C for 1 min; denaturalized at 98°C for 10 s; annealed at 55°C for 15 s; extended at 68°C for 30 s, a total of 30 cycles; finally extended at 68°C for 5 min. RFQ-PCR system (25 μL) (primers the same as those in conventional PCR): TB Green Premix DimerEraser (2X) 12 μL; upstream and downstream primers (10 μM) 0.75 μL each; template 2 μL; the final volume was made up to 25 μL with ddH2 O. Reaction system: It was predenaturalized at 95°C for 30 s; denaturalized at 95°C for 5 s; annealed at 55°C for 30 s; extended at 72°C for 30 s, a total of 40 cycles. Reverse transcription recombinase-aided amplification reaction system was based on the optimized reaction conditions, and the template in the reaction system was standard plasmid with a concentration gradient of 100 to 107 copies/μL.

Clinical Sample Test

A total of 57 suspected IBV samples in clinical diagnosis were tested by RT-RAA-LFD assay and conventional PCR assay, and the coincidence rate of the 2 assays was compared.

RESULTS

RT-RAA Primer Screening

Four pairs of primers were designed in accordance with the requirements of RT-RAA nucleic acid amplification. After the products were amplified by RT-RAA nucleic acid amplification kit, they were screened by 2% agarose electrophoresis. The results showed that only IBV-4-F/IBV-4-R amplified a single and clear band of the expected size (target segment 153 bp). Therefore, IBV-4-F/IBV4-R was selected as the primer for the follow-on experiment. The results are shown in Figure 1.
Figure 1

Reverse transcription recombinase-aided amplification primer screening. M: marker, 1: IBV-1-F/IBV-1-R, 2: IBV-2-F/IBV-2-R, 3: IBV-3-F/IBV-3-R, 4: IBV-4-F/IBV-4-R.

Reverse transcription recombinase-aided amplification primer screening. M: marker, 1: IBV-1-F/IBV-1-R, 2: IBV-2-F/IBV-2-R, 3: IBV-3-F/IBV-3-R, 4: IBV-4-F/IBV-4-R.

Optimal Reaction Conditions

The reaction time, temperature, and primer concentration were optimized in this experiment. There were optimal reaction conditions when quality control line was clear, reaction time was the shortest, and primer concentration was the lowest. Finally, the optimal reaction conditions were determined as follows: reaction time 24 min; reaction temperature 37°C; primer concentration 1,250 nmol/L (Figures Figure 2, Figure 3, Figure 4).
Figure 2

Optimization of reaction time.

Figure 3

Optimization of reaction temperature.

Figure 4

Optimization of primer and probe concentrations.

Optimization of reaction time. Optimization of reaction temperature. Optimization of primer and probe concentrations.

Specificity Test

With the RNA of IBV, NDV, AIV and the DNA of ILTV as templates, the products were amplified in RT-RAA reaction system, and by LFD assay, only the RT-RAA product of IBV showed both test line and quality control line on dipstick. However, the products of other viruses and negative control could only show quality control line, which indicated that the specificity of RT-RAA-LFD assay was good, and this method was tenable. The results are shown in Figure 5.
Figure 5

Specificity test by RT-RAA-LFD.

Specificity test by RT-RAA-LFD.

Sensitivity Test

The standard plasmid was diluted by 10-fold gradient, and the sensitivity of conventional PCR, RFQ-PCR and RT-RAA-LFD was compared based on the concentration of 100 to 107 copies/μL. The results showed that the lowest detectable limit (LDL) was 104 copies/μL for conventional PCR, 101 copies/μL for RFQ-PCR, and 102 copies/μL for RT-RAA-LFD. The sensitivity of RT-RAA-LFD assay was 100 times higher than that of conventional PCR assay, but lower than that of RFQ-PCR assay (Figures Figure 6, Figure 7, Figure 8).
Figure 6

Sensitivity of conventional PCR assay. M: marker, 1: 107 copies/μL, 2: 106 copies/μL, 3: 105 copies/μL, 4: 104 copies/μL, 5: 103 copies/μL, 6: 102 copies/μL, 7: 101 copies/μL, 8: 10° copies/μL, 9: negative control.

Figure 7

Sensitivity of RFQ-PCR assay. 7: 106 copies/μL, 6: 105 copies/μL, 5: 104 copies/μL, 4: 103 copies/μL, 3: 102 copies/μL, 2: 101 copies/μL, 1: 10° copies/μL, 0: negative control.

Figure 8

Sensitivity of RT-RAA-LFD assay. 1: 106 copies/μL, 2: 105 copies/μL, 3: 104 copies/μL, 4: 103 copies/μL, 5: 102 copies/μL, 6: 101 copies/μL, 7: 10° copies/μL, 8: negative control.

Sensitivity of conventional PCR assay. M: marker, 1: 107 copies/μL, 2: 106 copies/μL, 3: 105 copies/μL, 4: 104 copies/μL, 5: 103 copies/μL, 6: 102 copies/μL, 7: 101 copies/μL, 8: 10° copies/μL, 9: negative control. Sensitivity of RFQ-PCR assay. 7: 106 copies/μL, 6: 105 copies/μL, 5: 104 copies/μL, 4: 103 copies/μL, 3: 102 copies/μL, 2: 101 copies/μL, 1: 10° copies/μL, 0: negative control. Sensitivity of RT-RAA-LFD assay. 1: 106 copies/μL, 2: 105 copies/μL, 3: 104 copies/μL, 4: 103 copies/μL, 5: 102 copies/μL, 6: 101 copies/μL, 7: 10° copies/μL, 8: negative control.

Clinical Sample Test

A total of 57 suspected IB samples from chickens with clinical respiratory symptoms were detected, of which 48 were positive and 9 were negative by RT-RAA-LFD, 43 were positive and 15 were negative by conventional PCR. The detection rate of RT-RAA-LFD assay was higher than that of conventional PCR, which indicated that the RT-RAA-LFD assay established in this study could be used for detection of IBV.

DISCUSSION

IB is responsible for substantial economic loss within the poultry industry, so it is very important to explore a specific, convenient, and sensitive detection method to better prevent and control IB. The clinical symptoms and pathological changes of IB are similar to those of ND and ILT, so it is easy to be misdiagnosed, which brings some difficulties to clinical diagnosis. Conventional virus isolation (CVI) is the most classical and reliable method for the diagnosis of IB, but it has the disadvantages of long period and high technical requirements. Serological diagnosis is also a common technique in the actual detection of IB, but most of the commercial IBV antibody kits are coated with whole virions, having a strong cross-reaction with local strains of different serotypes, as a result, the application of commercial IBV antibody detection kit is limited (Lin et al., 1991). Conventional PCR and RFQ-PCR are sensitive and specific in nucleic acid diagnosis, but they still have the shortcomings of long period, carcinogen EB pollution and need for expensive instruments (Zhang et al., 2018). Reverse transcription recombinase-aided amplification is a rapid, specific, sensitive, and reliable technique for isothermal gene amplification (Daher et al., 2016). The whole reaction is simple, rapid, and does not require high temperature cycling, so it is particularly suitable for use in non-laboratory testing sites with a large number of samples (Piepenburg et al., 2006). In this experiment, RT-RAA was combined with LFD to detect IBV. After screening the primers, the downstream primer was labeled with biotin, and the designed probe was modified with a FAM fluorophore at its 5′ end. A single-base gap at a position 30 bp from the 5′ end was modified with tetrahydrofuran residue, the 3′ end was blocked by phosphorylation, and a compatible probe was helpful to improve the specificity of RT-RAA reaction. Notably, the RT-RAA kit completed reverse transcription and DNA amplification in 1 step, saving detection time and reagents. Finally, the double-labeled products amplified by RT-RAA could be detected directly by LFD and visually observed. Reaction could be completed by this technique at a constant temperature of 37°C, amplification did not need complex instruments, and amplification products could be visually detected by LFD. It was proved that the specificity of RT-RAA was good, and the sensitivity of this method was slightly lower than that of RFQ-PCR, but 100 times higher than that of conventional PCR.

CONCLUSION

The RT-RAA-LFD assay had good specificity for detection of IBV and there was no cross reaction with the nucleic acids of other similar avian pathogens. It was highly sensitive, and its LDL was 102 copies/μL, which was 100 times higher than that of conventional PCR (104 copies/μL). The operation was simple, and results could be visually observed and determined by LFD within 3 min after 20 min reaction under isothermal condition (37°C), so it is very suitable for clinical veterinary and grass-roots laboratories.
  14 in total

1.  Isothermal DNA amplification in bioanalysis: strategies and applications.

Authors:  Joonyul Kim; Christopher J Easley
Journal:  Bioanalysis       Date:  2011-01       Impact factor: 2.681

2.  Pathogenicity differences between QX-like and Mass-type infectious bronchitis viruses.

Authors:  Jinlong Cheng; Caiyun Huo; Jing Zhao; Tong Liu; Xiao Li; Shihong Yan; Zhujun Wang; Yanxin Hu; Guozhong Zhang
Journal:  Vet Microbiol       Date:  2017-11-21       Impact factor: 3.293

3.  A new typing method for the avian infectious bronchitis virus using polymerase chain reaction and restriction enzyme fragment length polymorphism.

Authors:  Z Lin; A Kato; Y Kudou; S Ueda
Journal:  Arch Virol       Date:  1991       Impact factor: 2.574

4.  Establishment and application of real-time fluorescence-based quantitative PCR for detection of infectious laryngotracheitis virus using SYBR Green I.

Authors:  Tie Zhang; Jian Chen; Chunguang Wang; Xianghe Zhai; Shilei Zhang
Journal:  Poult Sci       Date:  2018-11-01       Impact factor: 3.352

5.  DNA detection using recombination proteins.

Authors:  Olaf Piepenburg; Colin H Williams; Derek L Stemple; Niall A Armes
Journal:  PLoS Biol       Date:  2006-07       Impact factor: 8.029

Review 6.  Recombinase Polymerase Amplification for Diagnostic Applications.

Authors:  Rana K Daher; Gale Stewart; Maurice Boissinot; Michel G Bergeron
Journal:  Clin Chem       Date:  2016-05-09       Impact factor: 8.327

7.  Think globally, act locally: Phylodynamic reconstruction of infectious bronchitis virus (IBV) QX genotype (GI-19 lineage) reveals different population dynamics and spreading patterns when evaluated on different epidemiological scales.

Authors:  Giovanni Franzo; Paola Massi; Claudia Maria Tucciarone; Ilaria Barbieri; Giovanni Tosi; Laura Fiorentini; Massimo Ciccozzi; Antonio Lavazza; Mattia Cecchinato; Ana Moreno
Journal:  PLoS One       Date:  2017-09-07       Impact factor: 3.240

8.  Full-length genome sequencing analysis of avian infectious bronchitis virus isolate associated with nephropathogenic infection.

Authors:  R A Leghari; B Fan; H Wang; J Bai; L Zhang; S H Abro; P Jiang
Journal:  Poult Sci       Date:  2016-08-26       Impact factor: 3.352

9.  Molecular characterization of an infectious bronchitis virus strain isolated from northern China in 2012.

Authors:  Ye Zhao; Xiao-yu Liu; Jin-long Cheng; Yan-ping Wu; Guo-zhong Zhang
Journal:  Arch Virol       Date:  2014-08-29       Impact factor: 2.574

10.  Antigenic and immunogenic characterization of infectious bronchitis virus strains isolated in China between 1986 and 1995.

Authors:  Z Q Wu; Q W Yang; C Fu; X Y Zhao; J Ignjatovic
Journal:  Avian Pathol       Date:  1998       Impact factor: 3.378

View more
  5 in total

1.  Establishment of reverse transcription recombinase-aided amplification-lateral-flow dipstick and real-time fluorescence-based reverse transcription recombinase-aided amplification methods for detection of the Newcastle disease virus in chickens.

Authors:  Wenjing Wang; Chunguang Wang; Yun Bai; Peng Zhang; Shanshan Yao; Jingru Liu; Tie Zhang
Journal:  Poult Sci       Date:  2020-04-15       Impact factor: 3.352

Review 2.  Trends in MERS-CoV, SARS-CoV, and SARS-CoV-2 (COVID-19) Diagnosis Strategies: A Patent Review.

Authors:  José Adão Carvalho Nascimento Junior; Anamaria Mendonça Santos; Ana Maria Santos Oliveira; Adriana Gibara Guimarães; Lucindo José Quintans-Júnior; Henrique Douglas Melo Coutinho; Natália Martins; Lysandro Pinto Borges; Mairim Russo Serafini
Journal:  Front Public Health       Date:  2020-10-27

3.  Development and Application of RAA Nucleic Acid Test Strip Assay and Double RAA Gel Electrophoresis Detection Methods for ASFV and CSFV.

Authors:  Keke Wu; Yuanyuan Zhang; Sen Zeng; Xiaodi Liu; Yuwan Li; Xiaowen Li; Wenxian Chen; Zhaoyao Li; Yuwei Qin; Jinding Chen; Shuangqi Fan
Journal:  Front Mol Biosci       Date:  2022-01-31

4.  Development of Recombinase Aided Amplification Combined With Disposable Nucleic Acid Test Strip for Rapid Detection of Porcine Circovirus Type 2.

Authors:  Wenxian Chen; Jindai Fan; Zhaoyao Li; Yuanyuan Zhang; Yuwei Qin; Keke Wu; Xiaowen Li; Yuwan Li; Shuangqi Fan; Mingqiu Zhao
Journal:  Front Vet Sci       Date:  2021-06-25

5.  Development and Application of a Reverse-Transcription Recombinase-Aided Amplification Assay for Porcine Epidemic Diarrhea Virus.

Authors:  Xiuhong Wu; Yuanjia Liu; Liguo Gao; Zhuanqiang Yan; Qiqi Zhao; Feng Chen; Qingmei Xie; Xinheng Zhang
Journal:  Viruses       Date:  2022-03-12       Impact factor: 5.048

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.