Literature DB >> 32411755

Wogonoside inhibits inflammatory cytokine production in lipopolysaccharide-stimulated macrophage by suppressing the activation of the JNK/c-Jun signaling pathway.

Xiu Yu1,2, Dandan Chen1, Lingwei Wang1, Jie Li1, Khalid Khan1,2, Haihui Chen1, Yutian Liang1, Huanmin Luo3, Chen Qiu1.   

Abstract

BACKGROUND: Mediated by innate immune cells, inflammation is an underlying presence in the pathogenesis of numerous pulmonary diseases. Macrophages play a critical role in mediating the initial response to infection in the lungs. When there is excessive activation of macrophages, hyper-production of inflammatory factors occurs, with inflammation as the ultimate result. Wogonoside, a bioactive flavonoid glycoside, has been reported to alleviate pulmonary inflammation. However, the mechanism underlying the anti-inflammatory effect of wogonoside has not yet been clarified.
METHODS: The productions of nitric oxide (NO) and reactive oxygen species (ROS) were determined using a Griess reagent kit and a DAF-FM DA fluorescent probe, respectively. Moreover, the mRNA levels of inflammatory factors were quantified by qPCR, and the binding ability of c-Jun to promoters of inflammatory factors was performed by ChIP assay. Western blot was employed to detect the protein expression of inflammatory factors and signaling pathway.
RESULTS: In this study, we found that pre-treatment with wogonoside dramatically suppressed lipopolysaccharide (LPS)-induced increase in the protein and mRNA levels of inflammatory factors in macrophages, such as cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS), interleukin (IL)-1β, tumor necrosis factor (TNF)-α, and IL-6. Furthermore, wogonoside profoundly reduced the increase in NO and ROS production and significantly blocked phosphorylation of JNK in LPS-stimulated macrophages. As revealed by Western blot and qPCR analysis, wogonoside mediated the JNK-dependent inhibitory effect. Compared with wogonoside alone, a combination of wogonoside and JNK inhibitor SP600125 provided no extra benefit in suppressing the protein expression and mRNA levels of inflammatory factors in LPS-stimulated macrophages. Additionally, ChIP analysis demonstrated wogonoside to remarkably reduce c-Jun enrichment in COX-2, iNOS, IL-1β, TNF-α, and IL-6 promoters.
CONCLUSIONS: Collectively, our findings showed that wogonoside notably suppresses LPS-stimulated production of inflammatory factors by repressing the activation of the JNK/c-Jun signaling pathway in macrophages. This suggests that wogonoside could serve as a promising therapeutic agent for pulmonary diseases related to macrophage inflammation. 2020 Annals of Translational Medicine. All rights reserved.

Entities:  

Keywords:  Inflammation; JNK/c-Jun signaling pathway; macrophage; wogonoside

Year:  2020        PMID: 32411755      PMCID: PMC7214906          DOI: 10.21037/atm.2020.04.22

Source DB:  PubMed          Journal:  Ann Transl Med        ISSN: 2305-5839


Introduction

Inflammation is an underlying presence in the pathogenesis of various pulmonary diseases, including sepsis, acute lung injury (ALI), chronic obstructive pulmonary disease (COPD), cystic fibrosis, and asthma (1,2). Pulmonary inflammation arises following exposure to pathogens, pollutants, allergens, irritants, and other detrimental microorganisms (3,4). The initial response to infection is mainly mediated by macrophages, which recruit leukocytes to the lung tissues and induce the production of a series of inflammatory factors, such as cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS), interleukin (IL)-1β, tumor necrosis factor (TNF)-α, and IL-6 (5,6). The activation of macrophages is carried out by pattern recognition receptors (PRRs), which recognize extracellular antigens (7,8). After binding to toll-like receptor 4 (TLR4), lipopolysaccharide (LPS) recruits the cytoplasmic adaptor proteins, before activating nuclear factor-κB (NF-κB) and three well-defined mitogen-activated protein kinase (MAPK) signaling pathways (the c-Jun N-terminal kinase (JNK), p38 MAPK, and extracellular signal-regulated kinase 1/2 (ERK1/2) pathways), which ultimately results in inflammation (9,10). After the NF-κB and MAPK signaling pathways are activated, the downstream transcription factor NF-κB and activator protein-1 (AP-1) translocate to the nucleus, and promote pro-inflammatory cytokine expression (11,12). c-Jun is an important member of the AP-1 transcription factor family, whose activation contributes to the expression of associated inflammatory genes in macrophages (13,14). Therefore, therapeutic interventions that target the inflammatory response of macrophages and the activation of associated signaling pathways may provide a novel alternative strategy for managing pulmonary inflammatory diseases. Due to its therapeutic effects and relatively low toxicity, the active component of herbal medicine has received considerable attention (15). The anti-inflammatory, anti-allergic and immunomodulatory effects exerted by flavonoids have been evidenced by a growing number of studies (16,17). Wogonoside, a metabolite of wogonin, is a bioactive flavonoid derived from the root of Scutellaria baicalensis (18). Emerging evidence has shown that wogonoside mitigates spinal cord injury (SCI)-induced inflammation and provides protection against experimental colitis induced by dextran sulfate sodium (DSS) (19,20). Furthermore, wogonoside has been verified to alleviate LPS-induced ALI by blocking the release of the inflammatory cytokines (21,22). However, the mechanism underlying the anti-inflammatory influence of wogonoside remains unclear. This study aimed to uncover more about the effects of wogonoside on LPS-stimulated production of inflammatory factors and to determine its value as a potential therapy for pulmonary diseases.

Methods

Materials

Wogonoside (Wog) was acquired from Biopurify Phytochemicals Ltd. (Sichuan, China). LPS (0111:B4) was acquired from Sigma-Aldrich (Shanghai, China). Griess reagent was supplied by Promega Biotech Co (Madison, WI, USA), and TRIzol reagent was acquired from Invitrogen Co. (Carlsbad, CA, USA). Dichlorofluorescein diacetate (DCFH-DA) was obtained from Solarbio Technology Inc. (Beijing, China). RT SuperMix and Universal SYBR qPCR Master were both supplied by Vazyme Biotech (Nanjing, China). SP600125, brefeldin A, and CCK-8 were obtained from Selleck Chemicals (Houston, USA). An ECL kit and PVDF membrane were purchased from Millipore Company (Shanghai, China). The anti-COX-2 antibody was purchased from Proteintech (Wuhan, China). The anti-IL-1β, anti-phospho-p65, anti-TNF-α, anti-p65, anti-IL-6 antibodies, anti-phospho-MAPK family, and anti-MAPK family antibody samplers were supplied by Cell Signaling Technology, Inc. (Boston, MA, USA). HRP-goat anti-rabbit/mouse IgG antibody, anti-c-Jun, and anti-iNOS antibodies were obtained from Abcam (Cambridge, MA, USA). GAPDH antibody was acquired from TransGen Biotech (Beijing, China). Alexa Fluor 488-labeled and 594-labeled secondary antibodies were purchased from Invitrogen (Shanghai, China).

Cell culture and drug treatments

RAW264.7 cells were purchased from the Shanghai Institute of Cell Biology. The cells were grown in complete DMEM medium containing 10% FBS and 1% antibiotics under an incubator with 5% CO2 at 37 °C, and were treated with wogonoside (25, 50, or 100 µM) or SP600125 (20 µM) 2 h prior to stimulation with 1 µg/mL LPS.

Animal experiments

Six-to-seven-week-old BALB/c mice were supplied by Guangzhou Experimental Animal Center (Guangzhou, China). All mice were kept in cages at 22±1 °C with access to food and water. All of the experiments in this study received approval from the Animal Ethics Committees of Jinan University and were performed according to the recommendations of the Guide for the Care and Use of Laboratory Animals of Jinan University.

Isolation of murine alveolar macrophage (AM)

AMs were obtained from bronchoalveolar lavage fluid (BALF) as previously reported (23). In brief, the mice were anesthetized with pentobarbital sodium, the upper trachea was cannulated, and BALF was collected by washing with sterilized phosphate buffer solution (PBS). The BALF was centrifuged at 800 ×g at 4 °C for 10 min to acquire the sedimented cells. Red blood cells (RBCs) were removed using RBC lysis. Subsequently, the cells were repelleted and resuspended in DMEM medium. One surface antigen (F4/80) and an intracellular antigen (CD68) were used to identify the AM population.

Cell viability assay

The cells were cultured in 96-well plates, before incubation with various concentrations of wogonoside for a period of 24 h. The effect of wogonoside on cell viability was determined with CCK-8 assay, as previously reported (24).

Nitric oxide (NO) assay

RAW264.7 cells (2×105 cells/mL) were cultured in 24-well plates and incubated with either SP600125 at 20 µM or wogonoside at 25, 50, or 100 µM for 2 h, and then exposed to LPS for a further 24 h. Griess reagent was utilized to quantify nitric oxide formation, as previously reported (25).

Reactive oxygen species (ROS) analysis

RAW264.7 cells in 6-well plates at 1×106 cells per well were pre-treated with either wogonoside or SP600125 (at the concentrations mentioned above) for 2 h and subsequently exposed to LPS for 6 h. After incubation with DCFH-DA (2 µM) for 30 min, ROS was determined with the FITC channel using Beckman CytoFLEX FCM (Beckman Coulter, USA) (26).

Western blot analysis

To determine cytokine expression using Western blot, brefeldin A (500 ng/mL) was added for 3 h before protein extraction to block the protein from translocating from the endoplasmic reticulum to the cell outside (27). Total protein was obtained from RAW264.7 cells with lysis buffer containing protease and phosphatase inhibitor. Protein samples were loaded per lane, fractionated by 4–20% gradient SDS-PAGE precast gel and then electrotransferred onto PVDF membranes. Then, the membranes were incubated with the primary and HRP-conjugated second antibody after blocking with 5% skim milk (28). Protein bands were visualized with enhanced ECL reagent and determined using Syngene GNOME XRQ NPC (Syngene, Cambridge, UK).

Quantitative real-time PCR

The cells were seeded in 6-well plates at a density of 1×106 and incubated with either SP600125 or wogonoside at different concentrations for 2 h, before exposure to LPS for 2 or 6 h. Total RNA was extracted from cells with TRIzol reagent. Then, RNA was reverse-transcribed into cDNAs. PCR amplification was carried out with the Bio-Rad CFX Connect using SYBR qPCR Master Mix (29). Primers were obtained from Sangon Biotech (Shanghai, China). The following primer sequences were used in the experiments: COX-2-F: TGAGCAACTATTCCAAACCAGC, COX-2-R: GCACGTAGTCTTCGATCACTATC, iNOS-F: GGCAGCCTGTGAGACCTTTG, iNOS-R: GCATTGGAAGTGAAGCGTTTC, IL-1β-F: CAGAGTTCCCCAACTGGTACATC, IL-1β-R: GGGAAGGCATTAGAAACAGTCC, TNF-α-F: GCTCTGTGAAGGGAATGGGTGTT, TNF-α-R: GTCCAGGTCACTGTCCCAGCATC, IL-6-F: ACTTCCATCCAGTTGCCTTCTTG, IL-6-R: TGTTGGGAGTGGTATCCTCTGTG, GAPDH-F: AGGTCGGTGTGAACGGATTTG, GAPDH-R: TGTAGACCATGTAGTTGAGGTCA

Immunofluorescence analysis

AMs (2×104 cells/mL) were cultured in 48-well plates before incubation with wogonoside for 2 h and exposure to LPS for 6 h. The cells were then washed with PBS, fixed with 4% cold paraformaldehyde for 30 min, permeabilized with 0.1% Triton X-100 for 15 min before blocking with 3% BSA, and incubated with a primary antibody against TNF-α, CD68, or F4/80 overnight. Then, the cells were incubated again with Alexa Fluor 488 or 594-conjugated secondary antibody for 2 h. The samples were observed using an inverted fluorescence microscope (DMi8 manual, Leica, Germany) (26).

ChIP assay

The cells were seeded at a density of 1×107 in a 10 cm-dish, incubated with wogonoside for 2 h, and then exposed to LPS for another 30 min. The cells were fixed with 1% formaldehyde for 10 min at RT and harvested with ChIP lysis buffer (Invitrogen, Carlsbad, CA, USA). Lysed cells were sonicated and lysates were immunoprecipitated with an anti-c-Jun antibody overnight at 4 °C. Protein A/G plus magnetic beads (Invitrogen, Carlsbad, CA) were used to capture the protein-antibody complex for 3 h at 4 °C. After washing, the DNA was purified by phenol-chloroform in the presence of 1 µg glycine after reverse-crosslinking for 12 h at 65 °C and the proteins were removed with proteinase K (30). Immunoprecipitated DNA was analyzed by qPCR. The following primer sequences were used in the experiment: COX-2-F: GAGCAGGGGTCTTGCTGTGTTAC, COX-2-R: CTGTACGTTCTTGGCGTGAATGGAT, iNOS-F: CACCTAACCTCCAGGCCCATGG, iNOS-R: GGCTTGTGTAGCACCCACAACCC, IL-1β-F: GTCCAGGGGGAAATAATGCCCATTTC, IL-1β-R: GGAGAAGCTTGATGGGAATTCTTAGG, TNF-α-F: TCTCCGCTGCCAGGACAGCC, TNF-α-R: TGGGCAAGTAGGACAAAAGGCAGG, IL-6-F: CTGGAGACAGGTGGACAGAAAACC, IL-6-R: CTGAAGGTGGTACGTCTCACTCTG

Statistical analysis

The results in the bar graphs are shown as the mean ± standard error of the mean (SEM), based on at least three independent experiments. All data were analyzed with a one-way ANOVA followed by Dunnett’s multiple comparison test using GraphPad Prism 6.0 software. Image J quantified the average intensity of fluorescence. P<0.05 indicated a statistically significant difference.

Results

Wogonoside inhibited inflammatory cytokine expression in LPS-stimulated macrophages

Immunofluorescence was performed to identify and characterize the primary AM. As shown in , the cells isolated from the mouse lung BALF had high expressions of the macrophage-specific markers F4/80 and CD68. The Western blot analysis showed that following pre-treatment with wogonoside, the expression levels of TNF-α and IL-1β were remarkably decreased in AMs after LPS exposure (). Meanwhile, immunofluorescence analysis also confirmed that wogonoside significantly suppressed TNF-α expression after LPS-induced activation of AMs ().
Figure 1

Wogonoside inhibited inflammatory cytokine expression in LPS-stimulated macrophages. The cells were pre-treated with the indicated concentrations of wogonoside for 2 h before exposure to LPS. The AMs were identified with CD68 and F4/80 using immunofluorescence (A). The protein expressions of IL-1β and TNF-α were determined by Western blot after stimulation with LPS for 6 h (B and C). The expression TNF-α was detected by immunofluorescence after exposure to LPS for 6 h (D). Quantitative analysis of TNF-α fluorescence intensity (E). The time course of LPS-induced inflammatory factor expressions in RAW264.7 cells was measured using Western blot (F). The expressions of COX-2 (G), iNOS (H), IL-1β (I), TNF-α (J), and IL-6 (K) in RAW264.7 cells were determined by Western blot at 6, 12, and 24 h after LPS stimulation. Scale bars, 100 µm. The results are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; *, P<0.05; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; TNF-α, tumor necrosis factor alpha; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; SEM, standard error of the mean.

Wogonoside inhibited inflammatory cytokine expression in LPS-stimulated macrophages. The cells were pre-treated with the indicated concentrations of wogonoside for 2 h before exposure to LPS. The AMs were identified with CD68 and F4/80 using immunofluorescence (A). The protein expressions of IL-1β and TNF-α were determined by Western blot after stimulation with LPS for 6 h (B and C). The expression TNF-α was detected by immunofluorescence after exposure to LPS for 6 h (D). Quantitative analysis of TNF-α fluorescence intensity (E). The time course of LPS-induced inflammatory factor expressions in RAW264.7 cells was measured using Western blot (F). The expressions of COX-2 (G), iNOS (H), IL-1β (I), TNF-α (J), and IL-6 (K) in RAW264.7 cells were determined by Western blot at 6, 12, and 24 h after LPS stimulation. Scale bars, 100 µm. The results are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; *, P<0.05; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; TNF-α, tumor necrosis factor alpha; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; SEM, standard error of the mean. As well as analyzing the effects of wogonoside on AMs, the macrophage cell line RAW264.7 was utilized to further investigate its anti-inflammatory role and mechanism. Before the study, the effect of wogonoside on cell viability was checked at concentrations of 25 to 200 µM. As illustrated in Figure S1A, the highest concentration of wogonoside did not impact cell viability. Wogonoside significantly countered LPS-induced increases in nitric oxide (NO) release and ROS production in a concentration-dependent manner (Figure S1B,C,D). The time course of inflammatory cytokine expression induced by LPS was determined using Western blot. After 6 h, the expressions of IL-6, IL-1β, and TNF-α had been significantly enhanced by the addition of LPS to the culture medium, while after 12 h, iNOS and COX-2 were significantly upregulated (). Meanwhile, wogonoside dramatically inhibited LPS-induced protein expression of IL-1β, iNOS, TNF-α, COX-2, and IL-6 in a concentration-dependent manner (). mRNA levels of the aforementioned inflammatory factors were also remarkably decreased by wogonoside in LPS-exposed RAW264.7 cells. (Figure S2A,B,C,D,E).

Wogonoside inhibited LPS-induced phosphorylation of JNK in macrophages

To further explore how wogonoside decreases the expression of inflammatory factors in LPS-stimulated macrophages, we determined the phosphorylation of p65, p38, ERK, and JNK. As indicated in , the phosphorylation of p65, p38, ERK and JNK were observably increased in a time-dependent manner after LPS stimulation and reached a peak at 30 min. Wogonoside barely affected the phosphorylation of p65 and partially reduced the phosphorylation of p38 and ERK in LPS-exposed RAW264.7 cells (). However, wogonoside dramatically suppressed phosphorylation of JNK in LPS-exposed RAW264.7 cells and AMs ().
Figure 2

Wogonoside inhibited LPS-induced phosphorylation of JNK in macrophages. The cells were incubated with wogonoside (100 µM) for 2 h and then stimulated with LPS. The time course of LPS-induced phosphorylation of p65, p38, ERK, and JNK was determined using Western blot (A). The effect of wogonoside on the phosphorylation of p65 (B), p38 (C), ERK (D), and JNK (E) in RAW264.7 was measured by Western blot at 30 min after LPS stimulation. The effect of wogonoside on JNK phosphorylation in alveolar macrophages was determined using Western blot after exposure to LPS for 30 min (F). The data in the bar graphs are expressed as the mean ± SEM (n≥3). ##, P < 0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; JNK, c-Jun NH2-terminal kinase; ERK, extracellular signal-regulated kinase; SEM, standard error of the mean.

Wogonoside inhibited LPS-induced phosphorylation of JNK in macrophages. The cells were incubated with wogonoside (100 µM) for 2 h and then stimulated with LPS. The time course of LPS-induced phosphorylation of p65, p38, ERK, and JNK was determined using Western blot (A). The effect of wogonoside on the phosphorylation of p65 (B), p38 (C), ERK (D), and JNK (E) in RAW264.7 was measured by Western blot at 30 min after LPS stimulation. The effect of wogonoside on JNK phosphorylation in alveolar macrophages was determined using Western blot after exposure to LPS for 30 min (F). The data in the bar graphs are expressed as the mean ± SEM (n≥3). ##, P < 0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; JNK, c-Jun NH2-terminal kinase; ERK, extracellular signal-regulated kinase; SEM, standard error of the mean.

JNK inhibitor SP600125 suppressed NO release and ROS production in LPS-stimulated macrophages

Due to the difficulty in acquiring a larger number of AMs, further experiments were only conducted using the RAW264.7 cell line. To further explore the potential suppressive effect of wogonoside on LPS-induced increases in NO release and ROS production, which mainly occurs via JNK signaling, a specific inhibitor of JNK, SP600125, was utilized. As shown in , SP600125 alone significantly suppressed the LPS-induced increases in NO release and ROS production. The combination of wogonoside and SP600125 was no more effective at decreasing LPS-stimulated NO release and ROS production than wogonoside alone. However, treatment with wogonoside alone resulted in stronger inhibition of NO compared with SP600125 treatment in LPS-exposed RAW264.7 cells ().
Figure 3

JNK inhibitor SP600125 suppressed NO release and ROS production in LPS-stimulated macrophages. The cells were pretreated with SP600125 (20 µM) or wogonoside (100 µM) for 2 h before LPS exposure. The Griess reagent kit detected the release of NO after stimulation with LPS for 24 h (A). The production of ROS was determined using a DAF-FM DA fluorescent probe at 6 h after LPS stimulation (B). Quantitative analysis of ROS fluorescence intensity (C). The results are shown as the mean ± SEM (n≥3). ##, P < 0.01 vs. control group; **, P<0.01 vs. LPS group. NO, nitric oxide; ROS, reactive oxygen species; LPS, lipopolysaccharide; SEM, standard error of the mean.

JNK inhibitor SP600125 suppressed NO release and ROS production in LPS-stimulated macrophages. The cells were pretreated with SP600125 (20 µM) or wogonoside (100 µM) for 2 h before LPS exposure. The Griess reagent kit detected the release of NO after stimulation with LPS for 24 h (A). The production of ROS was determined using a DAF-FM DA fluorescent probe at 6 h after LPS stimulation (B). Quantitative analysis of ROS fluorescence intensity (C). The results are shown as the mean ± SEM (n≥3). ##, P < 0.01 vs. control group; **, P<0.01 vs. LPS group. NO, nitric oxide; ROS, reactive oxygen species; LPS, lipopolysaccharide; SEM, standard error of the mean.

JNK inhibitor SP600125 suppressed protein expression of inflammatory factors in LPS-stimulated macrophages

We further investigated if wogonoside inhibits LPS-induced pro-inflammatory cytokine expression principally via JNK signaling. As illustrated in , LPS-induced phosphorylation of JNK and iNOS, COX-2, IL-1β, TNF-α, and IL-6 protein expression were significantly decreased after pre-treatment with SP600125 alone. Compared to wogonoside, a combination of wogonoside and SP600125 was found to have a stronger inhibitory effect on JNK phosphorylation in LPS-stimulated RAW264.7 cells. However, there were no significant differences in the suppression of iNOS, COX-2, IL-1β, TNF-α, and IL-6 protein expression between the wogonoside and combined groups. These data indicated that the suppression of JNK activation seen with wogonoside makes a substantial contribution to blocking the expression of the inflammatory factors. Additionally, SP600125 treatment partially suppressed iNOS expression, while wogonoside largely abolished iNOS expression ().
Figure 4

JNK inhibitor SP600125 suppressed the protein expression of the inflammatory factors in LPS-stimulated macrophages. The cells were incubated with SP600125 or wogonoside for 2 h before LPS stimulation. The expressions of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D), IL-6 (E), and the phosphorylation of JNK (F) were determined by Western blot at 6, 12, and 24 h after LPS exposure. The data are shown as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean.

JNK inhibitor SP600125 suppressed the protein expression of the inflammatory factors in LPS-stimulated macrophages. The cells were incubated with SP600125 or wogonoside for 2 h before LPS stimulation. The expressions of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D), IL-6 (E), and the phosphorylation of JNK (F) were determined by Western blot at 6, 12, and 24 h after LPS exposure. The data are shown as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean.

JNK inhibitor SP600125 suppressed mRNA levels of inflammatory factors in LPS-stimulated macrophages

To further confirm the transcriptional inhibitory property of wogonoside, we performed qPCR and found that SP600125 also significantly reduced the LPS-induced mRNA levels of iNOS, COX-2, IL-1β, TNF-α, and IL-6. Consistent with the Western blot analysis above, the inhibitory effect of wogonoside on the mRNA levels of the aforementioned inflammatory cytokines following LPS stimulation was almost equivalent to that of combined wogonoside and SP600125 (). Moreover, in comparison to wogonoside, SP600125 did not significantly suppress the level of iNOS mRNA, which indicated that there might be some other signaling pathways involved in the suppressive influence of wogonoside on iNOS expression and NO release ().
Figure 5

JNK inhibitor SP600125 suppressed mRNA levels of the inflammatory factors in LPS-stimulated macrophage. The cells were treated with SP600125 or wogonoside for 2 h before LPS exposure. The mRNA levels of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D), and IL-6 (E) were quantified by qRT-PCR at 6 h or 2 h after LPS exposure. The data are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean.

JNK inhibitor SP600125 suppressed mRNA levels of the inflammatory factors in LPS-stimulated macrophage. The cells were treated with SP600125 or wogonoside for 2 h before LPS exposure. The mRNA levels of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D), and IL-6 (E) were quantified by qRT-PCR at 6 h or 2 h after LPS exposure. The data are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean.

Wogonoside decreased c-Jun deposition at pro-inflammatory cytokine promoters in LPS-stimulated macrophages

We further explored the effect of wogonoside in suppressing the increase of pro-inflammatory cytokines at the mRNA level following LPS exposure. c-Jun, a JNK substrate, was investigated using ChIP analysis. After 30 min of LPS stimulation, binding between c-Jun and inflammatory factor promoters was significantly increased (). Pre-treatment with wogonoside observably reduced c-Jun enrichment in the promoters of iNOS, COX-2, IL-1β, TNF-α, and IL-6 in LPS-stimulated RAW264.7 cells.
Figure 6

Wogonoside decreased c-Jun deposition at the promoters of pro-inflammatory cytokines in LPS-stimulated macrophages. The cells were incubated with wogonoside for 2 h before LPS stimulation. The c-Jun enrichment in promoters of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D), and IL-6 (E) was performed by ChIP assay at 30 min after LPS exposure. The results are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean.

Wogonoside decreased c-Jun deposition at the promoters of pro-inflammatory cytokines in LPS-stimulated macrophages. The cells were incubated with wogonoside for 2 h before LPS stimulation. The c-Jun enrichment in promoters of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D), and IL-6 (E) was performed by ChIP assay at 30 min after LPS exposure. The results are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean.

Discussion

In this study, we demonstrated that wogonoside significantly hampered the LPS-induced expression of inflammatory factors in AMs and RAW264.7 cells. Furthermore, we found that wogonoside lessened the expression of inflammatory factors by blocking JNK phosphorylation and c-Jun enrichment in pro-inflammatory cytokine promoters. Additionally, when used in combination, wogonoside and SP600125 offered no added benefit in preventing the expression of inflammatory factors. The above results indicate that wogonoside’s inhibitive effect on JNK/c-Jun signaling activation contributed to the suppression of the inflammatory factors produced in LPS-stimulated macrophages. Respiratory tract inflammation is involved in the pathological processes of pulmonary diseases (1). The macrophages in the lung are the first line of defense in immune response against infections (6). According to their response to cytokines, macrophages are categorized as either classically activated (M1 subtype) or alternatively activated (M2 subtype) macrophages. M1 macrophages are typically induced by LPS, interferon (IFN)-γ, and TNF-α, while M2 macrophages are activated by IL-13 and IL-4 (31). Excessive activation of M1 macrophages contributes to the development of inflammatory diseases by upregulating the expression of inflammatory factors (32). Wogonoside has been reported to suppress the release of the pro-inflammatory cytokines IL-6, IL-1β, and TNF-α in the LPS-induced ALI model (21). However, the specific mechanism and targeted cells that exert anti-inflammatory effects in response to wogonoside in pulmonary inflammatory diseases have not yet been established. In our study, we showed that wogonoside reduced the elevation of M1-associated genes and protein expression in LPS-stimulated RAW264.7 cells and AMs (), suggesting that wogonoside suppresses the release of inflammatory factors by hampering M1-like macrophages activation, thus protecting the lung from injury.
Figure S1

Wogonoside inhibited NO release and ROS production in LPS-stimulated macrophages. The cells were pretreated with wogonoside at concentrations of 25 to 100 µM for 24 h with or without LPS. The cell viability was measured with CCK8 assay at 24 h after wogonoside treatment (A). The release of NO was determined by the Griess reagent kit at 24 h after LPS stimulation (B). The production of ROS was determined using a DAF-FM DA fluorescent probe at 6 h after LPS exposure (C). Quantitative analysis of ROS fluorescence intensity (D). The results are shown as the mean ± SEM (n≥3). ##, P < 0.01 vs. control group; *, P<0.05; **, P<0.01 vs. LPS group. NO, nitric oxide; ROS, reactive oxygen species; LPS, lipopolysaccharide; SEM, standard error of the mean.

Figure S2

Wogonoside suppressed mRNA levels of inflammatory factors in LPS-stimulated macrophages. The cells were pretreated wogonoside at concentrations of 25 to 100 µM for 2 h before LPS stimulation. The mRNA levels of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D) and IL-6 (E) were quantified by qRT-PCR at 6 or 2 h after LPS exposure. The results are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean.

The NF-κB signaling pathway has been demonstrated to be closely associated with the inflammatory response (9). Degradation of phosphorylated IκBα increases the phosphorylation of NF-κB p65, triggering the activation of various inflammation-associated genes (26). Recently, Sun’s study revealed that wogonoside inhibited the phosphorylation of NF-κB p65 in lung and colonic tissues (20). Therefore, based on previous research, the effect of wogonoside on NF-κB p65 phosphorylation in macrophages stimulated by LPS was investigated. However, our results showed that wogonoside did not affect LPS-induced NF-κB p65 phosphorylation in macrophages (). One possible explanation for this could be that wogonoside might pause microenvironment-driven NF-κB activation. MAPKs also play a significant role in regulating inflammation (33). Macrophage exposure to LPS has been well-known to activate the p38, ERK1/2, and JNK MAPKs signaling pathways (10). Wogonoside has been reported to inhibit LPS-induced angiogenesis by suppressing MAPK activation (34). Based on previous reports, we next investigated whether wogonoside exhibits an anti-inflammatory effect via the MAPK pathways. Our results demonstrated that wogonoside remarkably suppressed the LPS-stimulated increase of JNK phosphorylation in RAW264.7 cells and AMs (). However, wogonoside had a little effect on the phosphorylation of p38 and ERK (). It is well-known that the upstream of JNK are MAPK kinases 4 (MKK4) and MKK7, which activate JNK via phosphorylation of its threonine and tyrosine residues (35). The activation of MKK4 and MKK7 is mediated via phosphorylation on two serine residues by MAPK kinases kinase (33). Moreover, knockdown of MKK4 has been shown to block the release of IL-6 and TNF-α by inhibiting the phosphorylation of JNK in LPS-stimulated RAW264.7 cells (36). Another study demonstrated that the de-SUMOylation of MKK7 increased inflammatory cytokine production induced by LPS in macrophages by potentiating the phosphorylation of JNK (37). According to the literature mentioned above, we speculated that wogonoside might inhibit JNK phosphorylation by regulating the phosphorylation, SUMOylation or expression of MKK4 and MKK7 in LPS-stimulated macrophages. To further confirm the role of JNK in the anti-inflammatory activity of wogonoside, the JNK inhibitor SP600125 was used. JNK inhibitor SP600125 has been reported to notably reduce IL-6 and TNF-α in BALF from ALI mice (38). In our studies, SP600125 treatment alone significantly reduced NO release and ROS production, and also relieved the augmentation of protein and mRNA levels of inflammatory factors after LPS stimulation. This indicated that inhibition of JNK phosphorylation could exert an anti-inflammatory effect (). Moreover, in comparison to wogonoside, SP600125 treatment alone exhibited stronger inhibition of JNK phosphorylation but weaker inhibition of NO release and iNOS expression (). Meanwhile, wogonoside partially prevented the phosphorylation of p38 and ERK (). Taken together, this indicates that, besides JNK, wogonoside may regulate NO and iNOS production via the p38 and ERK pathways. Compared with wogonoside alone, the combination of wogonoside with SP600125 notably inhibited the phosphorylation of JNK. However, there was no significant difference between wogonoside and a combination of wogonoside with SP600125 in suppressing the increase in the protein and mRNA levels of the inflammatory factors. Our results indicated that wogonoside remarkably suppresses the expression of inflammatory factors mainly via blocking JNK activation. c-Jun, a substrate of JNK, is a critical regulator of the transcription factor AP-1 complex (39). Activation of JNK could phosphorylate c-Jun on residues Ser63 and Ser73 and then inhibit the ubiquitination and degradation of c-Jun (40). Recruitment of c-Jun to specific DNA sequences located in promoters induces the expression of its downstream-regulated inflammatory genes, resulting in the subsequent inflammatory response (13,41). Previous findings have shown that c-Jun deposition at promoters of inflammatory cytokines (PTGS2, IL-6, TNF-α) and chemokines (CCL20, CCL4, CCL3) was significantly increased at 30 min after LPS stimulation in primary monocytes (30). Hsieh’s research found that the binding of the activated c-Jun with the COX-2 promoter led to COX-2 gene transcription (42). According to the above literature, we determined whether wogonoside downregulated the expression of inflammatory factors via the modulation of the c-Jun recruitment to the pro-inflammatory cytokine promoters. ChIP analysis showed that pre-treatment of wogonoside remarkably reduced the binding affinity of c-Jun to promoters of iNOS, COX-2 IL-1β, IL-6, and TNF-α in LPS-stimulated macrophages (). Zhu’s observations that flavonoid compound luteolin decreased IL-6 production by suppressing JNK phosphorylation and AP-1 activation in LPS-induced microglia and had no effect on the binding activity of NF-κB and IL-6 promoters were also partly consistent with those of our studies (43). Our data demonstrated that wogonoside suppressed LPS-induced macrophage inflammatory response mainly through the inhibition of the JNK/c-Jun signaling pathway.

Conclusions

In summary, our results indicate that pre-treatment with wogonoside significantly represses LPS-induced increases in the expression and release of inflammatory factors by macrophages, primarily by inactivating of the JNK/c-Jun signaling pathways. Our findings show that wogonoside is a potential therapeutic agent against macrophage-associated pulmonary diseases. Wogonoside inhibited NO release and ROS production in LPS-stimulated macrophages. The cells were pretreated with wogonoside at concentrations of 25 to 100 µM for 24 h with or without LPS. The cell viability was measured with CCK8 assay at 24 h after wogonoside treatment (A). The release of NO was determined by the Griess reagent kit at 24 h after LPS stimulation (B). The production of ROS was determined using a DAF-FM DA fluorescent probe at 6 h after LPS exposure (C). Quantitative analysis of ROS fluorescence intensity (D). The results are shown as the mean ± SEM (n≥3). ##, P < 0.01 vs. control group; *, P<0.05; **, P<0.01 vs. LPS group. NO, nitric oxide; ROS, reactive oxygen species; LPS, lipopolysaccharide; SEM, standard error of the mean. Wogonoside suppressed mRNA levels of inflammatory factors in LPS-stimulated macrophages. The cells were pretreated wogonoside at concentrations of 25 to 100 µM for 2 h before LPS stimulation. The mRNA levels of COX-2 (A), iNOS (B), IL-1β (C), TNF-α (D) and IL-6 (E) were quantified by qRT-PCR at 6 or 2 h after LPS exposure. The results are expressed as the mean ± SEM (n≥3). ##, P<0.01 vs. control group; **, P<0.01 vs. LPS group. LPS, lipopolysaccharide; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; IL, interleukin; TNF-α, tumor necrosis factor alpha; SEM, standard error of the mean. The article’s supplementary files as
  43 in total

1.  The AP-1 Transcription Factor c-Jun Promotes Arthritis by Regulating Cyclooxygenase-2 and Arginase-1 Expression in Macrophages.

Authors:  Nicole Hannemann; Jutta Jordan; Sushmita Paul; Stephen Reid; Hanns-Wolf Baenkler; Sophia Sonnewald; Tobias Bäuerle; Julio Vera; Georg Schett; Aline Bozec
Journal:  J Immunol       Date:  2017-03-15       Impact factor: 5.422

2.  Wogonoside induces cell cycle arrest and differentiation by affecting expression and subcellular localization of PLSCR1 in AML cells.

Authors:  Yan Chen; Hui Hui; Hao Yang; Kai Zhao; Yansu Qin; Cong Gu; Xiaotang Wang; Na Lu; Qinglong Guo
Journal:  Blood       Date:  2013-03-13       Impact factor: 22.113

Review 3.  Macrophages, immunity, and metabolic disease.

Authors:  Joanne C McNelis; Jerrold M Olefsky
Journal:  Immunity       Date:  2014-07-17       Impact factor: 31.745

4.  Luteolin reduces IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1.

Authors:  Saebyeol Jang; Keith W Kelley; Rodney W Johnson
Journal:  Proc Natl Acad Sci U S A       Date:  2008-05-19       Impact factor: 11.205

5.  The isolation and characterization of murine macrophages.

Authors:  Xia Zhang; Ricardo Goncalves; David M Mosser
Journal:  Curr Protoc Immunol       Date:  2008-11

Review 6.  Macrophages and the Recovery from Acute and Chronic Inflammation.

Authors:  Kajal Hamidzadeh; Stephen M Christensen; Elizabeth Dalby; Prabha Chandrasekaran; David M Mosser
Journal:  Annu Rev Physiol       Date:  2016-12-07       Impact factor: 19.318

7.  Lipopolysaccharide Preconditioning Induces an Anti-inflammatory Phenotype in BV2 Microglia.

Authors:  Yongwei Qin; Xiaolei Sun; Xiaoyi Shao; Ming Xia Hu; Jinrong Feng; Zhan Chen; Jie Sun; Zhou Zhou; Yinong Duan; Chun Cheng
Journal:  Cell Mol Neurobiol       Date:  2016-04-05       Impact factor: 5.046

8.  The oncogenic transcription factor c-Jun regulates glutaminase expression and sensitizes cells to glutaminase-targeted therapy.

Authors:  Michael J Lukey; Kai Su Greene; Jon W Erickson; Kristin F Wilson; Richard A Cerione
Journal:  Nat Commun       Date:  2016-04-18       Impact factor: 14.919

Review 9.  Role of Antioxidants and Natural Products in Inflammation.

Authors:  Palanisamy Arulselvan; Masoumeh Tangestani Fard; Woan Sean Tan; Sivapragasam Gothai; Sharida Fakurazi; Mohd Esa Norhaizan; S Suresh Kumar
Journal:  Oxid Med Cell Longev       Date:  2016-10-10       Impact factor: 6.543

10.  DeSUMOylation of MKK7 kinase by the SUMO2/3 protease SENP3 potentiates lipopolysaccharide-induced inflammatory signaling in macrophages.

Authors:  Yimin Lao; Kai Yang; Zhaojun Wang; Xueqing Sun; Qiang Zou; Xiaoyan Yu; Jinke Cheng; Xuemei Tong; Edward T H Yeh; Jie Yang; Jing Yi
Journal:  J Biol Chem       Date:  2018-01-19       Impact factor: 5.157

View more
  2 in total

1.  [Wogonoside alleviates high glucose-induced dysfunction of retinal microvascular endothelial cells and diabetic retinopathy in rats by up-regulating SIRT1].

Authors:  X Shao; J Yu; W Ni
Journal:  Nan Fang Yi Ke Da Xue Xue Bao       Date:  2022-04-20

2.  Silencing c-Jun inhibits autophagy and abrogates radioresistance in nasopharyngeal carcinoma by activating the PI3K/AKT/mTOR pathway.

Authors:  Yongchu Sun; Kaihua Chen; Guoxiang Lin; Fangzhu Wan; Li Chen; Xiaodong Zhu
Journal:  Ann Transl Med       Date:  2021-07
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.