| Literature DB >> 32411003 |
Xiaohong Chen1,2, Shuang Li3, Dan Li1,2, Muxia Li1,2, Ziren Su2, Xiaoping Lai2, Changlin Zhou4, Shaodan Chen1, Shunxian Li5, Xiaobing Yang1, Jiyan Su1, Yunjian Zhang3.
Abstract
Triple-negative breast cancer (TNBC) is an aggressive disease with worst prognosis than other subtypes of breast cancer. Owing to the lack of hormone receptors and HER2 expression on TNBC cells, patients do not have targeted therapy options available with other breast cancer subtypes. Extensive efforts have been made to identify novel therapeutics against TNBC. Interestingly, recent studies had shown that plant-derived natural products could modulate the autophagy and induce the breast cancer cells death. Seed of Brucea javanica has been used as an important traditional Chinese medicine against cancers. In the present study, the anti-breast cancer potential of ethanol crude extracts from B. javanica seed (BJE) was explored. Data demonstrated that BJE could inhibit the TNBC cell line MDA-MB-231 proliferation and induced apoptosis. In the cells exposed to BJE, protein expressions of UNC-51-like kinase-1 (ULK1) and Beclin-1 and the ratio of light chain 3 II/I (LC3 II/I) were reduced, while the expression of p62 was increased, indicating an inhibition on autophagy. Moreover, BJE promoted the phosphorylation of mammalian target of rapamycin (mTOR), phosphatidylinositol 3-kinase (PI3K), and Akt in MDA-MB-231. BJE also suppressed the MDA-MB-231 tumor growth in vivo. Coincide with the results in vitro, autophagy in the tumor tissue was weakened as indicated by decreased ratio of LC 3 II/I and Beclin-1 accompanied by enhanced phosphorylation of mTOR, which confirmed that autophagy restraint via the PI3K/Akt/mTOR signaling pathway contributes to the suppression by BJE. Notably, no noticeable toxicity in non-targeted organs was found, including small intestine, liver, and kidney. Taken together, this study revealed anti-breast cancer activity of BJE based on autophagy restraint, highlighting its clinical importance as a novel natural agent against TNBC.Entities:
Keywords: Brucea javanica; PI3K/Akt/mTOR; autophagy; toxicity; triple-negative breast cancer (TNBC)
Year: 2020 PMID: 32411003 PMCID: PMC7201043 DOI: 10.3389/fphar.2020.00606
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primers for RT-qPCR.
| Gene name | Primer | Product length | |
|---|---|---|---|
| Sense | AACATGAGCGAGTTGGTCAAG | 127 | |
| Antisense | GCTCGTAGATGTCCGCGAT | ||
| Sense | TCCAGGCTCGGCTTGGTGAA | 130 | |
| Antisense | TGTCCTGCCAGTGCCTTCTTTG | ||
| Sense | TGGGCCATCAATCGGAAACTCA | 129 | |
| Antisense | TGCAGCCACAGGACGAAACAG | ||
| Sense | TATGACAACAGCCTCAAGAT | 104 | |
| Antisense | AGTCCTTCCACGATACCA | ||
Figure 1HPLC chromatogram. (A) BJE. (B) Brusatol, C26H32O11, retention time = 33.332 min.
Figure 2Cytotoxicity of BJE on MDA-MB-231. (A) Cell viability, n=6. (B) Cell morphology observation by light microscope. (C) Apoptosis by flowcytometry, n=3. Data was presented as mean ± SD. **p < 0.01 vs Control group.
Figure 3BJE inhibited autophagy in MDA-MB-231 cells. (A) Protein expressions of LC 3, p62, Beclin-1, and ULK1. (B) Phosphorylation of mTOR, Akt, and PI3K in MDA-MB-231 cells. n = 3, data was presented as mean ± SD. *p < 0.05 and **p < 0.01 vs. control group.
Figure 4BJE suppressed MDA-MB-231 tumor growth in vivo. (A) Representative pictures of tumor. (B) Tumor weight. (C) Tumor volume. n=5–6, data was presented as mean ± SD. **p < 0.01 vs. Model group.
Figure 5HE staining of the small intestine, liver and kidney (200×, n=5–6).
Figure 6BJE restrained autophagy in the MDA-MB-231-xenograft murine breast cancer model. (A) Protein expressions of LC 3 II/I, p62, Beclin-1, and ULK1 in tumor tissue. (B) Phosphorylation of mTOR, Akt, and PI3K in tumor tissue. (C) mRNA levels of LC 3, ATG13 and ATG5 in tumor tissue. n=5–6, data was presented as mean ± SD. *p < 0.05 and **p < 0.01 vs. Model group.