Literature DB >> 32368088

Exosomal lncRNA RAMP2-AS1 Derived from Chondrosarcoma Cells Promotes Angiogenesis Through miR-2355-5p/VEGFR2 Axis.

Cheng Cheng1, Zhicai Zhang1, Fuli Cheng2, Zengwu Shao1.   

Abstract

OBJECTIVE: Exosomes derived from cancer cells can alter the microenvironment and enhance cancer malignancy through the regulation of peripheral cell functions. The present study focused on the crosstalk between chondrosarcoma cells and human umbilical vein endothelial cells (HUVECs) mediated by exosomes derived from chondrosarcoma cells and aimed to explore the potential molecular mechanism.
MATERIALS AND METHODS: Chondrosarcoma cell-derived exosomes were isolated and characterized. Cell proliferation assay, tube formation assay and transwell migration assay were performed to characterize the effects of exosomes on HUVECs. The lncRNA microarray was used to select differentially expressed lncRNAs in HUVECs treated with or without exosomes. Serum samples of patients with chondrosarcoma were collected to analyze the correlation between the RAMP2-AS1 level and the clinicopathological features. Online databases were used to predict the target microRNA of RAMP2-AS1. Dual luciferase reporter assay, Western blotting and qRT-PCR assays were performed to verify the interactions among RAMP2-AS1, miR-2355-5p and VEGFR2. Rescue experiments were conducted to validate the existence of the RAMP2-AS1/miR-2355-5p/VEGFR2 axis.
RESULTS: The exosomes secreted by chondrosarcoma cells could enhance HUVECs proliferation, migration and tube formation. LncRNA microarray analysis revealed that exosomes carried lncRNA RAMP2-AS1, and further verification showed that the level of RAMP2-AS1 was increased in the serum of chondrosarcoma patients and was closely related to local invasiveness, distant metastasis and poor prognosis. Subsequent experiments demonstrated that RAMP2-AS1 knockdown could partly abrogate the promoting effects on angiogenesis induced by exosomes derived from chondrosarcoma cells. Moreover, dual luciferase reporter assay and rescue experiments suggested that the RAMP2-AS1/miR-2355-5p/VEGFR2 axis was responsible for exosome-induced angiogenesis of HUVECs.
CONCLUSION: Chondrosarcoma cell-derived exosomes carry lncRNA RAMP2-AS1, which acts as a ceRNA of miR-2355-5p to regulate VEGFR2 expression, thereby positively regulating the angiogenic ability of HUVECs. Thus, exosomal RAMP2-AS1 has the potential as a novel biomarker and therapeutic target for chondrosarcoma.
© 2020 Cheng et al.

Entities:  

Keywords:  HUVEC; angiogenesis; chondrosarcoma; exosome; lncRNA

Year:  2020        PMID: 32368088      PMCID: PMC7182451          DOI: 10.2147/OTT.S244652

Source DB:  PubMed          Journal:  Onco Targets Ther        ISSN: 1178-6930            Impact factor:   4.147


Introduction

Chondrosarcoma is a common primary malignant bone tumor, accounting for approximately 20% of the malignant bone tumors. Most of the patients are 30–60 years old, and the incidence in males is higher than that in females.1 Chondrosarcoma often involves the scapula, rib, long tubular bone and pelvis.2 Chondrosarcoma is not sensitive to radiotherapy and chemotherapy and has a high tendency of distant metastasis, leading to a poor prognosis.3 The lack of effective adjuvant therapy highlights the importance of developing new therapeutic strategies. Angiogenesis is a critical hallmark of cancer progression. Tumor-induced angiogenesis not only provides nutrition for tumor cells but can also trigger the metastatic spread of tumor cells to distant organs.4 Therefore, the regulation of angiogenesis has become an attractive target for antitumor therapy. Tumor angiogenesis is regulated by vascular endothelial growth factor (VEGF), angiopoietin (Ang), transforming growth factor (TGF), tumor necrosis factor (TNF), interleukin and fibroblast growth factor (FGF),5 of which VEGFA and its receptor (vascular endothelial growth factor receptor, VEGFR) are the most essential modulators of angiogenesis.6 VEGFA can induce endothelial cell proliferation, vascular tube formation and increase vascular permeability by binding to VEGFR.7 VEGFR is a transmembrane protein receptor family that includes VEGFR1, VEGFR2 and VEGFR3. VEGFR2 is located in endothelial cells and is the central receptor regulating angiogenesis.8 The high expression level of VEGFR2 on the surface of vascular endothelial cells provides more binding sites for VEGFA, thus enhancing tumor angiogenesis. Exosomes are vesicles with lipid bilayer molecular structures that are secreted by almost all cells and function by carrying biomolecules including lipids, proteins, DNAs, mRNAs, and non-coding RNAs to participate in local or systemic intercellular communication.9 Recent studies have shown that cancer cell-derived exosomes play a significant role in tumor growth, invasion, angiogenesis, local inflammation, and immune remodeling.10,11 As the main information molecules in exosomes, non-coding RNAs are primary mediators of the functions of exosomes.12 However, the role of chondrosarcoma cell-derived exosomes in the progression of chondrosarcoma remains unelucidated. Long non-coding RNAs (lncRNAs), which are a subset of non-coding RNAs with more than 200 bases, have been indicated to regulate protein expression through various pathways to modify the physiological functions of cells. Recently, it has been proven that lncRNAs can regulate tumor angiogenesis by modulating the expression of related factors. For example, silencing lncRNA SRRM2-AS exerts suppressive effects on angiogenesis in nasopharyngeal carcinoma by activating the MYLK-mediated cGMP-PKG pathway,13 which prompted us to wonder whether lncRNAs also assume a role in angiogenesis in chondrosarcoma. Moreover, since lncRNA can be carried by exosomes, then whether exosomes secreted by chondrosarcoma cells package a specific lncRNA that plays a crucial part in the regulation of angiogenesis. In this study, we selected human umbilical vein endothelial cells (HUVECs) as the vascular model of in vitro experiments because HUVECs are relatively easy to obtain and have the most important characteristics and properties of vascular endothelial cells. We demonstrated that exosomes derived from chondrosarcoma cells could promote the proliferation, migration, and tube formation of HUVECs. Through lncRNA microarray analysis, we identified lncRNA RAMP2-AS1 in exosomes as a vital regulator of angiogenesis. Chondrosarcoma-derived exosomes transport RAMP2-AS1 into HUVECs, competitively bind miR-2355-5p, and further promote the expression of VEGFR2, eventually leading to angiogenesis. Additionally, elevated serum RAMP2-AS1 levels were correlated with advanced and metastatic characteristics and poor prognosis of chondrosarcoma patients, suggesting that RAMP2-AS1 in exosomes as a novel therapeutic target of chondrosarcoma.

Materials and Methods

Clinical Samples

Forty-five chondrosarcoma patients who underwent surgical resection at the Department of Tumor Orthopedics of Wuhan Union Hospital and Zhengzhou Orthopaedics Hospital from 2014 to 2015 were selected. Chondrosarcoma tissues and blood samples were collected. The clinical and pathological information was recorded, and all patients were followed up after diagnosis until October 2019 after diagnosis. The stage of chondrosarcoma was according to the Enneking staging criteria. None of the patients received radiotherapy, chemotherapy or other adjuvant treatment after the diagnosis was confirmed. In addition, thirty healthy volunteers participated in this study as the control group. All patients and healthy volunteers signed the informed consent forms, and the Clinical Ethics Committee of Tongji Medical College and the Clinical Ethics Committee of Zhengzhou Orthopaedics Hospital approved the study.

Cell Culture

The human chondrosarcoma cell line SW1353 was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). SW1353 cells were cultured in DMEM/F12 medium (Gibco, CA, USA) containing 10% exosome-free serum (System Biosciences, CA, USA) and 1% penicillin-streptomycin (Biosharp, Beijing, China). Primary HUVECs were purchased from Cyagen Biosciences (Suzhou, China) and cultured in the complete culture medium of HUVECs (Cyagen Biosciences, Suzhou, China). The culture conditions were 37°C, 5% CO2 and 99% relative humidity.

Isolation and Identification of Exosomes

Cell culture medium was collected and centrifuged at 2000×g for 10 minutes. The supernatant was collected and filtered with a 0.22 μm filter to remove cell fragments. The obtained filtrate was centrifuged at 12,000×g for 45 minutes to remove large vesicles. Then, the supernatant was collected and filtered by a 0.45 μm filter. The filtrate was ultracentrifuged at 110,000×g for 70 minutes. Removed the supernatant, resuspended in 10 mL precooled PBS and ultracentrifuged at 110,000×g for another 70 minutes. The supernatant was removed and resuspended in 1 mL precooled PBS to obtain the exosome sample. The shape of the exosomes was observed under a transmission electron microscope (HT7800, Hitachi, Tokyo, Japan). The Nanoparticle tracking analysis was performed by Flow NanoAnalyzer (Xiamen, China). The exosome markers CD63, TSG101 and HSP90 were detected by Western blot.

Exosome Labeling

To track the internalization of exosomes by recipient cells, we labeled exosomes with the PKH26 Red Fluorescent Cell Linker Kit (Sigma-Aldrich, MO, USA) according to the manufacturer’s protocol. Briefly, 2μL PKH26 solution was added to 100μg exosomes and incubated for 15 minutes at room temperature. Then the mixture was added to 18mL PBS and centrifuged at 120,000g for 2 hours at 4°C. The supernatant was removed, and the pellet was resuspended in 20mL PBS and centrifuged at 120,000g for another 2 hours at 4°C. The PKH26-labeled exosomes were resuspended in 200μL PBS and then added to the cells. After incubation for 24 h, the cells were washed twice with PBS and fixed in polyformaldehyde for 10 minutes, and internalization of the exosomes was observed by a fluorescence microscope (Olympus, Tokyo, Japan).

Cell Transfection

Small interfering RNA targeting RAMP2-AS1 (si-RAMP2-AS1) and negative control (si-NC), miR-2355-5p mimics, inhibitors and negative controls (miR-NC and inhibitors control) were synthesized by GenePharma (Shanghai, China). VEGFR2 overexpression was achieved by transfecting with the pcDNA3.1-VEGFR2 plasmid (GenePharma). In short, on the day before the cell transfection, cells were seeded in 6-well plates at 1×105 cells per well. On the following day, transfection was performed when the confluence of cells reached approximately 70%. The final concentrations of plasmid and miRNA/siRNA were 2.0μg/mL and 50nM, respectively. Transfections were conducted with Lipofectamine 3000 reagent (Invitrogen, CA, USA) accordance with the manufacturer’s guidelines. Transfection efficiency was determined by qRT-PCR and Western blot assays.

Western Blot

Cells or exosomes were lysed with RIPA lysis buffer containing cocktail protease inhibitor (Beyotime, Shanghai, China) to extract total protein. The protein concentration was determined by the BCA method, and then equal amounts of protein lysates were fractionated using 8% SDS-PAGE and transferred onto PVDF membranes. Membranes were blocked with 5% non-fat milk for 2 hours, and incubated with the following primary antibodies overnight at 4°C: anti-CD63 (1:500, ab134045, Abcam), anti-TSG101 (1:500, ab125011, Abcam), anti-HSP90 (1:500, ab13492, Abcam), anti-VEGFR2 (1:500, ab39256, Abcam), and anti-GAPDH (1:500, ab181602, Abcam). After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody at room temperature for 1 hour to develop blots. Blots were detected and recorded by and ECL device (Bio-Rad Laboratories, CA, USA).

qRT-PCR

Total RNA was extracted by TRIzol reagent and used to synthesize cDNA with the One-Step RT-PCR Kit (ThermoFisher Scientific, Shanghai, China). The cDNA samples were used for qRT-PCR analysis by using the SYBR Primer-Script RT-PCR kit (Takara, Shiga, Japan) with a CFX96 Touch quantitative PCR system (Bio-Rad Laboratories, CA, USA). The amplify conditions were: denaturation at 95°C for 10 minutes, and at 95°C for another 10 seconds, for a total of 40 cycles, and in the end, at 60°C for 30 seconds. Three replicates were performed for each specimen, and GAPDH served as internal references. The ΔΔCt method was utilized for quantification. The sequence information of primers is listed in Table 1.
Table 1

The Primers Used in This Study

PrimersSequence (5ʹ-3ʹ)
RAMP2-AS1 ForwardGAACTCAGGCCAGATTTACAAG
RAMP2-AS1 ReverseTTGGGTCCTACAGCAACCAT
VEGFR2 ForwardGTGATTGCCATGTTCTTCTGGC
VEGFR2 ReverseTTCATCTGGATCCATGACGA
GAPDH ForwardCAAGGCTGAGAACGGGAAG
GAPDH ReverseTGAAGACGCCAGTGGACTC
miR-2355-5p ForwardATTGTCCTTGCTGTTTGGAGAT
miR-2355-5p ReverseGCGAGCACAGAATTAATACGAC
U6 ForwardCGCTTCGGCAGCACATATAC
U6 ReverseTTCACGAATTTGCGTGTCAT
The Primers Used in This Study

Cell Proliferation Assay

Cell proliferation assay was performed with Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan). Briefly, cells were plated on 96-well plates with 5×103 cells per well. After the indicated times, removed the medium and added 100 μL serum-free medium and 10 μL CCK-8 solution into each well. The absorbance at 450 nm was measured by a microplate reader (ThermoFisher Scientific) after 2 hours incubation at 37°C.

Migration Assay

The migration assay was conducted with the 8-μm pore transwell chamber (BD Falcon, NJ, USA). Approximately 1×104 cells were resuspended in 200 μL serum-free medium and added to the upper chamber, and 500 μL complete medium was placed into the lower chamber. Twenty-four hours later, cells that did not pass through the polycarbonate membrane were wiped off, and chambers were fixed with polyformaldehyde for 15 minutes followed by staining in 0.1% crystal violet solution for several minutes. The migrated cells were observed and counted by an inverted microscope (Olympus, Tokyo, Japan).

Tube Formation Assay

Approximately 2×104 HUVECs were seeded on 96-well plates, which were precoated with 60 μL Matrigel (BD Falcon, NJ, USA). After 24 hours in normal cell culture conditions, tube formation was imaged by an inverted microscope, and tube branch length was quantified by ImageJ v6.0 software.

LncRNA Microarray Analysis

We conducted lncRNAs microarray analysis of HUVECs treated with or without exosomes derived from SW1353 cells by utilizing Arraystar Human LncRNA Microarray V5.0 (Agilent Technology, CA, USA). Initially, we exacted total RNA from HUVECs by using TRIzol reagent, and the purity and quantity of RNA were determined by NanoDrop 2000. Then, the cDNA was synthesized and labeled with biotin. The labeled probe was hybridized with high-density microarray under standard conditions. After hybridization, the fluorescence intensity of microarray was scanned by GenePix-4000B scanner, and the results were converted into digital ones for preservation. Agilent Feature Extraction Software was used to analyze the original data. Significantly differentially expressed lncRNAs with fold change > 2.0 and p < 0.05 were selected.

Luciferase Reporter Assay

The wild type (WT) RAMP2-AS1 or VEGFR2 3′-UTR vectors which contained miR-2355-5p specific binding sites, and vectors which contained mutant (Mut) miR-1184 binding sites were constructed by GenePharma (Shanghai, China). Cells were seeded in 24-well plates, and Lipofectamine 3000 reagent was utilized for cell co-transfection. After 24 hours, the luciferase activity was measured by the Dual-Luciferase Reporter Assay System (Promega, WI, USA).

Statistical Analysis

GraphPad Prism 7.0 software was used for all data analyses in this study. Student’s t-test and ANOVA were used to analyze differences between two groups or more than two groups, respectively. The chi-square test was used to analyze the correlations between the lncRNA RAMP2-AS1 expression level and clinicopathological features. Overall survival curves were analyzed by the Log rank test. Data are represented as the mean ± SD. P-value <0.05 was considered statistically significant.

Results

Exosomes Derived from Chondrosarcoma Cells Promote Angiogenesis of HUVECs

We isolated extracellular vesicles by ultracentrifugation and then characterized them by TEM analysis and NTA analysis. The TEM analysis showed that the vesicles had typical morphological characteristics of exosomes, the diameter of the vesicles was between 30 and 150 nm, and the vesicles exhibited a spherical-shaped appearance (Figure 1A). The NTA analysis demonstrated that the peak size range was 60–100 nm and the mean size was 75.50 nm. The proportion of vesicle in the size range of 30–150 nm is 98.65% (Figure 1B). Western blot analysis showed that the extracellular vesicles expressed the exosomal marker molecules CD63, TSG101 and HSP90 (Figure 1C). Therefore, we concluded that we have successfully isolated SW1353 cell-derived exosomes (Exo/SW1353).
Figure 1

Exo/SW1353 promotes angiogenesis of HUVECs. (A) Transmission electron microscopy image of Exo/SW1353. (B) Nanoparticle tracking analysis to measure the size distribution of Exo/SW1353. (C) Western blot analysis of the expression of exosomal markers CD63, TSG101 and HSP90. (D) PKH26 labeled Exo/SW1353 was internalized by HUVECs. (E) Cell proliferation was detected in HUVECs treated with or without Exo/SW1353. (F) Tube formation ability of HUVECs treated with or without Exo/SW1353. (G) Transwell migration assay was used to determine the migration capacity of HUVECs treated with or without Exo/SW1353. *P<0.05.

Exo/SW1353 promotes angiogenesis of HUVECs. (A) Transmission electron microscopy image of Exo/SW1353. (B) Nanoparticle tracking analysis to measure the size distribution of Exo/SW1353. (C) Western blot analysis of the expression of exosomal markers CD63, TSG101 and HSP90. (D) PKH26 labeled Exo/SW1353 was internalized by HUVECs. (E) Cell proliferation was detected in HUVECs treated with or without Exo/SW1353. (F) Tube formation ability of HUVECs treated with or without Exo/SW1353. (G) Transwell migration assay was used to determine the migration capacity of HUVECs treated with or without Exo/SW1353. *P<0.05. In general, cancer cell-derived exosomes affect the biological functions of recipient cells by releasing functional molecules after they have been internalized by the recipient cells. Initially, we tracked exosomes and found that PKH26 labeled Exo/SW1353 could be better internalized by HUVECs (Figure 1D). Subsequent cell proliferation assay confirmed that Exo/SW1353 could enhance the proliferation activity of HUVECs (Figure 1E). Moreover, transwell migration and tube formation assay indicated that migration and tube formation capacities of HUVECs were improved after incubated with exosomes (Figure 1F and G). These results illustrated that SW1353 cell-derived exosomes could promote angiogenesis of HUVECs.

Exo/SW1353 Transport lncRNA RAMP2-AS1 to HUVECs and Improve the Angiogenic Capacity of HUVECs

In addition to microRNAs, abundant lncRNAs are also carried by exosomes and transferred into recipient cells to exert regulatory functions. To identify the key lncRNAs that mediate the promotion of angiogenesis by Exo/SW1353, we performed lncRNA microarray analysis on HUVECs with or without Exo/SW1353 incubation and determined that lncRNA RAMP2-AS1 with the most significant expression difference (Figure 2A). Through qRT-PCR verification, we observed that the expression level of RAMP2-AS1 was significantly increased in HUVECs treated with Exo/SW1353 compared with untreated cells (Figure 2B). Additionally, we found that knockdown of RAMP2-AS1 in SW1353 cells efficiently decreased RAMP2-AS1 levels not only in Exo/SW1353 but also in the recipient HUVECs (Figure 2C). Taken together, these data demonstrated that Exo/SW1353 carried lncRNA RAMP2-AS1 and transferred it into HUVECs.
Figure 2

Exosomal lncRNA RAMP2-AS1 improves angiogenesis of HUVECs and serum RAMP2-AS1 level is associated with clinical characters of chondrosarcoma. (A) The heatmap represented the differential expression of lncRNAs as determined by lncRNA microarray analysis in HUVECs treated with or without Exo/SW1353. Red indicates relatively higher expression, and green indicates relatively lower expression. (B) qRT-PCR analysis of RAMP2-AS1 level in HUVECs treated with or without Exo/SW1353. (C) Suppression efficiency of RAMP2-AS1 knockdown in SW1353 cells, Exo/SW1353 and HUVECs treated with Exo/SW1353. (D) RAMP2-AS1 knockdown abolished the promotion effects of Exo/SW1353 on migration and tube formation ability of HUVECs. (E) RAMP2-AS1 knockdown reversed the proliferative effect of Exo/SW1353 on HUVECs. (F) Relative RAMP2-AS1 levels in serum of chondrosarcoma patients and healthy volunteers. (G) Relative RAMP2-AS1 levels in serum of T1 stage and T2 stage chondrosarcoma patients. (H) Relative RAMP2-AS1 levels in serum of M0 stage and M1 stage chondrosarcoma patients. (I) Patients with high RAMP2-AS1 level had poorer prognosis. *P<0.05.

Exosomal lncRNA RAMP2-AS1 improves angiogenesis of HUVECs and serum RAMP2-AS1 level is associated with clinical characters of chondrosarcoma. (A) The heatmap represented the differential expression of lncRNAs as determined by lncRNA microarray analysis in HUVECs treated with or without Exo/SW1353. Red indicates relatively higher expression, and green indicates relatively lower expression. (B) qRT-PCR analysis of RAMP2-AS1 level in HUVECs treated with or without Exo/SW1353. (C) Suppression efficiency of RAMP2-AS1 knockdown in SW1353 cells, Exo/SW1353 and HUVECs treated with Exo/SW1353. (D) RAMP2-AS1 knockdown abolished the promotion effects of Exo/SW1353 on migration and tube formation ability of HUVECs. (E) RAMP2-AS1 knockdown reversed the proliferative effect of Exo/SW1353 on HUVECs. (F) Relative RAMP2-AS1 levels in serum of chondrosarcoma patients and healthy volunteers. (G) Relative RAMP2-AS1 levels in serum of T1 stage and T2 stage chondrosarcoma patients. (H) Relative RAMP2-AS1 levels in serum of M0 stage and M1 stage chondrosarcoma patients. (I) Patients with high RAMP2-AS1 level had poorer prognosis. *P<0.05. To further verify that the pro-angiogenic effect of Exo/SW1353 is RAMP2-AS1-dependent, we silenced RAMP2-AS1 expression in Exo/SW1353 treated HUVECs. The results of the cell proliferation assay, migration assay and tube formation assay proved that inhibition of RAMP2-AS1 in HUVECs could impair the pro-angiogenic effect of Exo/SW1353 (Figure 2D and E). Collectively, exosomal RAMP2-AS1 was responsible for the pro-angiogenic effect of Exo/SW1353.

Elevated lncRNA RAMP2-AS1 Is Associated with the Progression and Poor Prognosis of Chondrosarcoma

Angiogenesis is a significant manifestation of tumor growth and metastasis, so the molecules that affect angiogenesis are often closely related to the prognosis of patients. We collected blood samples from forty-five patients with chondrosarcoma and thirty healthy volunteers. The qRT-PCR results showed that the expression level of RAMP2-AS1 was higher in most chondrosarcoma patients than that in healthy volunteers (Figure 2F). In addition, the level of RAMP2-AS1 in patients with T1 stage chondrosarcoma was lower than that in patients with T2 stage chondrosarcoma (Figure 2G), and the level of RAMP2-AS1 in patients with distant metastasis (M1 stage) was significantly higher than that in patients without distant metastasis (M0 stage) (Figure 2H). To further analyze the correlation between the level of RAMP2-AS1 and prognosis, patients were divided into two groups based on the median expression level of RAMP2-AS1. Kaplan-Meier analysis revealed that chondrosarcoma patients with high RAMP2-AS1 levels had poorer overall survival than patients with low RAMP2-AS1 levels (Figure 2I). Additionally, the level of RAMP2-AS1 was independent of patient age, gender, and anatomical location of the tumor (Table 2). In summary, these data indicated that lncRNA RAMP2-AS1 is a promising biomarker for chondrosarcoma.
Table 2

The Relationship Between RAMP2-AS1 Level and Clinical Characters of Chondrosarcoma

VariablesLow Circulating RAMP2-AS1High Circulating RAMP2-AS1p value
(n=22)n=(23)
Age (years)0.458
 < 5010 (45.45%)13 (56.52%)
 ≥5012 (54.55%)10 (43.48%)
Gender0.609
 Male15 (68.18%)14 (60.87%)
 Female7 (38.82%)9 (39.13%)
Anatomical location0.463
 Limb bone13 (59.09%)16 (69.57%)
 Axial bone9 (40.91%)7 (30.43%)
Ennecking stage0.002
 T1 stage17 (77.27%)7 (30.43%)
 T2 stage5 (22.73%)16 (69.57%)
Distal metastasis<0.001
 Absent20 (90.91%)8 (34.78%)
 Present2 (9.09%)15 (65.22%)
The Relationship Between RAMP2-AS1 Level and Clinical Characters of Chondrosarcoma

LncRNA RAMP2-AS1 Regulates VEGFR2 Expression by Sponging miR-2355-5p in HUVECs

To investigate the potential mechanism of RAMP2-AS1 in angiogenesis, we speculated that RAMP2-AS1 acts as a microRNA sponge to regulate target gene expression. StarBase v3.0 () was used to predict microRNAs that may bind to RAMP2-AS1, and we found that RAMP2-AS1 contains a potential binding site for miR-2355-5p. Then, qRT-PCR results showed that miR-2355-5p expression was reduced after HUVECs were treated with Exo/SW1353, while miR-2355-5p expression was restored after silencing RAMP2-AS1 (Figure 3A). To clarify the role of miR-2355-5p, we transfected miR-2355-5p mimics or inhibitors into HUVECs to regulate miR-2355-5p expression (Figure 3B). The luciferase reporter assay showed that HUVECs co-transfected with miR-2355-5p mimics and vector containing the RAMP2-AS1 wild-type sequence had decreased luciferase reporter activity compared with the cells transfected with vector containing the RAMP2-AS1 mutant sequence (Figure 3C).
Figure 3

Exosomal lncRNA RAMP2-AS1 regulates VEGFR2 expression by sponging miR-2355-5p. (A) The relative expression of miR-2355-5p in HUVECs was measured by qRT-PCR. (B) The transfection efficiency of miR-2355-5p mimics or inhibitors were measured by qRT-PCR. (C) Luciferase reporter assay validated the interaction between RAMP2-AS1 and miR-2355-5p. (D) Venn diagram shows candidate targets that were predicted by four online databases. (E, F) qRT-PCR and Western blot analyzed the relative mRNA level and protein level of VEGFR2 in HUVECs treated with Exo/SW1353 and si-RAMP2-AS1. (G, H) qRT-PCR and Western blot analyzed the relative mRNA level and protein level of VEGFR2 in HUVECs treated with Exo/SW1353 and miR-2355-5p mimics. (I, J) qRT-PCR and Western blot analyzed the relative mRNA level and protein level of VEGFR2 in HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (K) Luciferase reporter assay validated the interaction between VEGFR2 and miR-2355-5p. *P<0.05.

Exosomal lncRNA RAMP2-AS1 regulates VEGFR2 expression by sponging miR-2355-5p. (A) The relative expression of miR-2355-5p in HUVECs was measured by qRT-PCR. (B) The transfection efficiency of miR-2355-5p mimics or inhibitors were measured by qRT-PCR. (C) Luciferase reporter assay validated the interaction between RAMP2-AS1 and miR-2355-5p. (D) Venn diagram shows candidate targets that were predicted by four online databases. (E, F) qRT-PCR and Western blot analyzed the relative mRNA level and protein level of VEGFR2 in HUVECs treated with Exo/SW1353 and si-RAMP2-AS1. (G, H) qRT-PCR and Western blot analyzed the relative mRNA level and protein level of VEGFR2 in HUVECs treated with Exo/SW1353 and miR-2355-5p mimics. (I, J) qRT-PCR and Western blot analyzed the relative mRNA level and protein level of VEGFR2 in HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (K) Luciferase reporter assay validated the interaction between VEGFR2 and miR-2355-5p. *P<0.05. It is well known that microRNA can regulate gene expression by binding to the 3ʹ-UTR of the specific mRNAs. To confirm the targets of miR-2355-5p, we used four online databases TargetScan (), miRTarBase (), miRDB () and miRWalk () to predicted the candidate gene of miR-2355-5p (Figure 3D). Among the 24 overlapping prediction targets, we selected VEGFR2 as the candidate gene. Moreover, the results of qRT-PCR and Western blot showed that the expression of VEGFR2 was repressed after knockdown of RAMP2-AS1 (Figure 3E and F) or overexpression of miR-2355-5p in Exo/SW1353 treated HUVECs (Figure 3G and H). Similarly, knockdown of miR-2355-5p reversed the inhibitory effects of RAMP2-AS1 silencing on the expression of VEGFR2 (Figure 3I and J). The luciferase reporter assay validated the interaction between VEGFR2 and miR-2355-5p (Figure 3K). Taken together, these results confirmed that exosomal RAMP2-AS1 acted as a microRNA sponge by competitively binding miR-2355-5p to regulate the expression of VEGFR2 in HUVECs.

Exosomal lncRNA RAMP2-AS1 Promotes Angiogenesis via Modulation of the miR-2355-5p/VEGFR2 Axis in HUVECs

Based on the above findings, we further explored whether RAMP2-AS1 affects angiogenesis by regulating the miR-2355-5p/VEGFR2 axis. The result of cell proliferation assay indicated that silencing miR-2355-5p could reverse the inhibitory effects on cell proliferation caused by RAMP2-AS1 knockdown in Exo/SW1353 treated HUVECs (Figure 4A). The tube formation assay and transwell migration assay showed that miR-2355-5p inhibitors abrogated the inhibition effects on tube formation ability (Figure 4B–D) and migration ability (Figure 4C–E) induced by RAMP2-AS1 knockdown in Exo/SW1353 treated HUVECs. To determine the involvement of VEGFR2 in the pro-angiogenic role of RAMP2-AS1, VEGFR2 was upregulated by transfecting with VEGFR2 overexpression plasmid (Figure 4F). Subsequently, VEGFR2 overexpression reversed the inhibitory effects of RAMP2-AS1 knockdown on cell proliferation, migration and tube formation in Exo/SW1353 treated HUVECs (Figure 4G–K). Taken together, these results suggested that exosomal lncRNA RAMP2-AS1 promotes angiogenesis via the miR-2355-5p/VEGFR2 pathway in HUVECs.
Figure 4

Exosomal lncRNA RAMP2-AS1 promotes angiogenesis via modulation of miR-2355-5p/VEGFR2 axis. (A) Cell proliferation was detected in HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (B, D) Tube formation assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (C, E) Transwell migration assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (F) The transfection efficiency of VEGFR2 overexpression plasmid was measured by Western blot. (G) Cell proliferation was detected in HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and VEGFR2 overexpression plasmid. (H, J) Tube formation assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and VEGFR2 overexpression plasmid. (I, K) Transwell migration assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and VEGFR2 overexpression plasmid. *P<0.05.

Exosomal lncRNA RAMP2-AS1 promotes angiogenesis via modulation of miR-2355-5p/VEGFR2 axis. (A) Cell proliferation was detected in HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (B, D) Tube formation assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (C, E) Transwell migration assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and miR-2355-5p inhibitors. (F) The transfection efficiency of VEGFR2 overexpression plasmid was measured by Western blot. (G) Cell proliferation was detected in HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and VEGFR2 overexpression plasmid. (H, J) Tube formation assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and VEGFR2 overexpression plasmid. (I, K) Transwell migration assay of HUVECs treated with Exo/SW1353, si-RAMP2-AS1 and VEGFR2 overexpression plasmid. *P<0.05.

Discussion

The exosomes released by cancer cells serve as a communication system by transporting a large number of functional molecules to neighboring recipient cells and remodeling the microenvironment to aggravate tumor progression. Hu et al confirmed that exosomes derived from colorectal cancer cells promote angiogenesis of HUVECs.14 Mao et al revealed that serum exosomes suppress tumor growth by inhibiting angiogenesis.15 As an important molecule carried by exosomes, lncRNAs also play a considerable role in the process of exosomes-mediated intercellular communication.16 In glioma, exosomes that contain lncRNA CCAT2 enhance angiogenesis of endothelial cells,17 and exosomal MALAT1 promotes angiogenesis in ovarian cancer.18 In this study, we chose HUVEC as a substitute for tumor vascular endothelial cell in vitro because HUVEC is convenient to obtain and has the characteristics of tube formation and migration, so. We isolated and identified exosomes derived from chondrosarcoma cells for the first time and demonstrated that Exo/SW1353 could be internalized by HUVECs and enhanced angiogenic capacity. Furthermore, through lncRNA microarray analysis, we confirmed that Exo/SW1353 carried lncRNA RAMP2-AS1 and transported it into HUVECs. Additionally, through the analysis of clinical data, we found that the level of RAMP2-AS1 was elevated in the serum of patients with chondrosarcoma, and the upregulated level of RAMP2-AS1 was positively correlated with the local invasion, distant metastasis and poor prognosis of chondrosarcoma. Recent studies have demonstrated that lncRNAs drive angiogenesis via multiple mechanisms. Zhao et al showed that lncRNA PVT1 promotes angiogenesis by activating the STAT3/VEGFA axis in gastric cancer.19 In cervical cancer, lncRNA CCDST enhances the interaction of MDM2 with oncogenic protein DHX9 and facilitates DHX9 degradation, and eventually leading to the inhibition of angiogenesis.20 Additionally, lncRNAs modulate the expression of specific mRNAs through the ceRNA network, which is also a critical manner to regulate tumor angiogenesis. For example, Sun et al found that LINC00968 reduces angiogenesis by impeding miR-423-5p-mediated PROX1 inhibition in breast cancer.21 Through bioinformatics analysis and functional experiments, we revealed that exosomal RAMP2-AS1 functions as a ceRNA for miR-2355-5p and relieves the suppression of VEGFR2 to regulate angiogenesis. The involvement of angiogenesis in cancer growth and metastasis is an extremely complicated process that is regulated by a series of factors.22 The expression of angiogenic factors, such as VEGFA and VEGFR, is usually increased to promote angiogenesis, thereby changing the balance between angiogenesis and anti-angiogenesis. This process is called the angiogenic switch and is generally triggered by oncogene mutations, stress state and hypoxia.23 VEGFA and VEGFR are the most essential molecules involved in the angiogenic switch. The HIF-1α expression is upregulated in tumor tissues due to hypoxia, and further promotes the expression of VEGFA as a transcription factor. VEGFA can bind to VEGFR1 and VEGFR2 on the endothelial cell surface. Although VEGFR1 has a stronger affinity for VEGFA than VEGFR2, the VEGFR1 activation of downstream signals is too weak, so VEGFR2 is the central receptor that mediates the angiogenesis-promoting effect of VEGFA.24 Recent studies have indicated that VEGFR2 expression is elevated in a variety of cancer tissues and is related to metastasis and poor prognosis. In chondrosarcoma, the expression level of VEGFR2 is associated with malignant phenotypes such as local invasion and distal metastasis.25 Small-scale clinical trials have confirmed that Apatinib, a VEGFR2 targeted inhibitor, has a positive effect on patients with advanced chondrosarcoma, proving that targeted VEGFR2 has excellent potential in the clinical treatment of chondrosarcoma.26 In this study, our data demonstrated that RAMP2-AS1 carried by Exo/SW1353 upregulated the expression of VEGFR2 in HUVECs and eventually promoted angiogenesis. More interestingly, the high level of RAMP2-AS1 was related to the aggressiveness, metastasis and poor prognosis of chondrosarcoma, which also proves that turning on the angiogenic switch is a critical link to promote the malignant progression of chondrosarcoma. In conclusion, this study demonstrated the role of chondrosarcoma cell-derived exosomal lncRNA RAMP2-AS1 in angiogenesis by mediating the miR-2355-5p/VEGFR2 axis. Thus, exosomal lncRNA RAMP2-AS1 has the potential as a novel biomarker and therapeutic target for chondrosarcoma.
  26 in total

1.  A DHX9-lncRNA-MDM2 interaction regulates cell invasion and angiogenesis of cervical cancer.

Authors:  Xiangya Ding; Xuemei Jia; Cong Wang; Jingyun Xu; Shou-Jiang Gao; Chun Lu
Journal:  Cell Death Differ       Date:  2018-12-05       Impact factor: 15.828

Review 2.  Tumor angiogenesis and vascular normalization: alternative therapeutic targets.

Authors:  Claire Viallard; Bruno Larrivée
Journal:  Angiogenesis       Date:  2017-06-28       Impact factor: 9.596

Review 3.  Anti-angiogenic therapy, a new player in the field of sarcoma treatment.

Authors:  Yvonne M H Versleijen-Jonkers; Myrella Vlenterie; Addy C M van de Luijtgaarden; Winette T A van der Graaf
Journal:  Crit Rev Oncol Hematol       Date:  2014-02-15       Impact factor: 6.312

4.  Silencing of long noncoding RNA SRRM2-AS exerts suppressive effects on angiogenesis in nasopharyngeal carcinoma via activating MYLK-mediated cGMP-PKG signaling pathway.

Authors:  Shaoqing Chen; Linrong Lv; Zhengyu Zhan; Xiaolang Wang; Zhenyu You; Xiao Luo; Haoyuan You
Journal:  J Cell Physiol       Date:  2019-11-19       Impact factor: 6.384

Review 5.  The emerging role of exosome and microvesicle- (EMV-) based cancer therapeutics and immunotherapy.

Authors:  Colin Moore; Uchini Kosgodage; Sigrun Lange; Jameel M Inal
Journal:  Int J Cancer       Date:  2017-03-16       Impact factor: 7.396

Review 6.  Role of angiogenesis in tumor growth and metastasis.

Authors:  Judah Folkman
Journal:  Semin Oncol       Date:  2002-12       Impact factor: 4.929

Review 7.  Vascular endothelial growth factor and its receptor system: physiological functions in angiogenesis and pathological roles in various diseases.

Authors:  Masabumi Shibuya
Journal:  J Biochem       Date:  2012-11-21       Impact factor: 3.387

Review 8.  Chondrosarcoma of bone.

Authors:  Lee R Leddy; Robert E Holmes
Journal:  Cancer Treat Res       Date:  2014

9.  Long non-coding RNA LINC00968 reduces cell proliferation and migration and angiogenesis in breast cancer through up-regulation of PROX1 by reducing hsa-miR-423-5p.

Authors:  Xianfu Sun; Tao Huang; Chengjuan Zhang; Shengze Zhang; Yingjie Wang; Qiang Zhang; Zhenzhen Liu
Journal:  Cell Cycle       Date:  2019-06-29       Impact factor: 5.173

10.  Exosomal Metastasis‑Associated Lung Adenocarcinoma Transcript 1 Promotes Angiogenesis and Predicts Poor Prognosis in Epithelial Ovarian Cancer.

Authors:  Jun-Jun Qiu; Xiao-Jing Lin; Xiao-Yan Tang; Ting-Ting Zheng; Ying-Ying Lin; Ke-Qin Hua
Journal:  Int J Biol Sci       Date:  2018-11-01       Impact factor: 6.580

View more
  23 in total

1.  Exosome-transmitted lncRNA PCGEM1 promotes invasive and metastasis in gastric cancer by maintaining the stability of SNAI1.

Authors:  H-Y Piao; S Guo; Y Wang; J Zhang
Journal:  Clin Transl Oncol       Date:  2020-06-09       Impact factor: 3.405

Review 2.  Emerging role of exosomal long non-coding RNAs in lung cancer.

Authors:  Lulu He; Minmin Lin; Jing Shen; Hongyan Qi
Journal:  Mol Biol Rep       Date:  2022-01-27       Impact factor: 2.742

3.  G-MDSCs-Derived Exosomal miRNA-143-3p Promotes Proliferation via Targeting of ITM2B in Lung Cancer.

Authors:  Jian-Hua Zhou; Zhi-Xian Yao; Zhong Zheng; Jun Yang; Rui Wang; Shi-Jie Fu; Xu-Feng Pan; Zhi-Hong Liu; Ke Wu
Journal:  Onco Targets Ther       Date:  2020-09-30       Impact factor: 4.147

4.  ELK1‑mediated upregulation of lncRNA LBX2‑AS1 facilitates cell proliferation and invasion via regulating miR‑491‑5p/S100A11 axis in colorectal cancer.

Authors:  Gang Ma; Weijie Dai; Juan Zhang; Qianjun Li; Biao Gu; Yaqi Song; Xiaozhong Yang
Journal:  Int J Mol Med       Date:  2021-06-03       Impact factor: 4.101

5.  Exosome-derived SNHG16 sponging miR-4500 activates HUVEC angiogenesis by targeting GALNT1 via PI3K/Akt/mTOR pathway in hepatocellular carcinoma.

Authors:  Shuangda Li; Yu Qi; Yiran Huang; Yanru Guo; Tong Huang; Li Jia
Journal:  J Physiol Biochem       Date:  2021-08-23       Impact factor: 4.158

Review 6.  The Biological Roles of Exosomal Long Non-Coding RNAs in Cancers.

Authors:  Miao Da; Hao Jiang; Yangyang Xie; Weili Jin; Shuwen Han
Journal:  Onco Targets Ther       Date:  2021-01-12       Impact factor: 4.147

7.  Identification of key genes in lung adenocarcinoma based on a competing endogenous RNA network.

Authors:  Zikun Song; Yinjiang Zhang; Zheren Chen; Bicheng Zhang
Journal:  Oncol Lett       Date:  2020-11-19       Impact factor: 2.967

8.  LncRNA SNHG11 aggravates cell proliferation and migration in triple-negative breast cancer via sponging miR-2355-5p and targeting CBX5.

Authors:  Lei Yu; Wei Zhang; Peng Wang; Qi Zhang; Aihua Cong; Xiuyuan Yang; Kai Sang
Journal:  Exp Ther Med       Date:  2021-06-18       Impact factor: 2.447

Review 9.  Biological functions and clinical applications of exosomal long non-coding RNAs in cancer.

Authors:  Yali Wang; Mengdi Zhang; Fangfang Zhou
Journal:  J Cell Mol Med       Date:  2020-09-14       Impact factor: 5.310

10.  Deciphering the effects of PYCR1 on cell function and its associated mechanism in hepatocellular carcinoma.

Authors:  Yanzhen Xu; Wenpu Zuo; Xiao Wang; Qinle Zhang; Xiang Gan; Ning Tan; Wenxian Jia; Jiayi Liu; Zhouquan Li; Bo Zhou; Dong Zhao; Zhibin Xie; Yanjun Tan; Shengfeng Zheng; Chengwu Liu; Hongtao Li; Zhijian Chen; Xiaoli Yang; Zhaoquan Huang
Journal:  Int J Biol Sci       Date:  2021-06-01       Impact factor: 6.580

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.