Literature DB >> 32361322

Interpret with caution: An evaluation of the commercial AusDiagnostics versus in-house developed assays for the detection of SARS-CoV-2 virus.

H Rahman1, I Carter1, K Basile2, L Donovan1, S Kumar1, T Tran1, D Ko1, S Alderson1, T Sivaruban1, J-S Eden3, R Rockett4, M V O'Sullivan5, V Sintchenko5, S C-A Chen5, S Maddocks1, D E Dwyer5, J Kok4.   

Abstract

INTRODUCTION: There is limited data on the analytical performance of commercial nucleic acid tests (NATs) for laboratory confirmation of COVID-19 infection.
METHODS: Nasopharyngeal, combined nose and throat swabs, nasopharyngeal aspirates and sputum was collected from persons with suspected SARS-CoV-2 infection, serial dilutions of SARS-CoV-2 viral cultures and synthetic positive controls (gBlocks, Integrated DNA Technologies) were tested using i) AusDiagnostics assay (AusDiagnostics Pty Ltd); ii) in-house developed assays targeting the E and RdRp genes; iii) multiplex PCR assay targeting endemic respiratory viruses. Discrepant SARS-CoV-2 results were resolved by testing the N, ORF1b, ORF1ab and M genes.
RESULTS: Of 52 clinical samples collected from 50 persons tested, respiratory viruses were detected in 22 samples (42 %), including SARS CoV-2 (n = 5), rhinovirus (n = 7), enterovirus (n = 5), influenza B (n = 4), hMPV (n = 5), influenza A (n = 2), PIV-2 (n = 1), RSV (n = 2), CoV-NL63 (n = 1) and CoV-229E (n = 1). SARS-CoV-2 was detected in four additional samples by the AusDiagnostics assay. Using the in-house assays as the "gold standard", the sensitivity, specificity, positive and negative predictive values of the AusDiagnostics assay was 100 %, 92.16 %, 55.56 % and 100 % respectively. The Ct values of the real-time in-house-developed PCR assay targeting the E gene was significantly lower than the corresponding RdRp gene assay when applied to clinical samples, viral culture and positive controls (mean 21.75 vs 28.1, p = 0.0031).
CONCLUSIONS: The AusDiagnostics assay is not specific for the detection SARS-CoV-2. Any positive results should be confirmed using another NAT or sequencing. The case definition used to investigate persons with suspected COVID-19 infection is not specific.
Copyright © 2020 Elsevier B.V. All rights reserved.

Entities:  

Keywords:  Covid-19; NAT; SARS-CoV-2

Mesh:

Year:  2020        PMID: 32361322      PMCID: PMC7195305          DOI: 10.1016/j.jcv.2020.104374

Source DB:  PubMed          Journal:  J Clin Virol        ISSN: 1386-6532            Impact factor:   3.168


Introduction

On 31 December 2019, the Chinese Center for Disease Control and Prevention reported to the World Health Organization (WHO) a series of patients with pneumonia of uncertain aetiology in Wuhan city, Hubei province, China [1]. The pathogen responsible for this outbreak was subsequently identified as a novel group 2B betacoronavirus, designated as Severe acute respiratory syndrome coronavirus-2 (SARS CoV-2). It shares approximately79 % homology to the Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) and 50 % with Middle East respiratory syndrome coronavirus (MERS-CoV) and is most closely related to two bat-derived SARS-like coronaviruses [2]. Rapid escalation of case numbers has ensued; as of 7 April 2020, 1, 279,722 cases of COVID-19 infections have been confirmed worldwide. COVID-19 was declared a pandemic on 11 March 2020 by the WHO [WHO, COVID-19 Situation Report-78]. The first case of SARS-CoV-2 in Australia was confirmed on 24 January 2020 in Victoria, and as of 7 April 2020, there have been a total of 5844 cases confirmed in Australia with New South Wales accounting for 2734 infections. (Department of Health, Australia). Expeditious and accurate laboratory diagnosis of persons with COVID-19 infection followed by appropriate infection control measures is key to preventing further spread of infection, particularly in the absence of effective antiviral therapy. The genetic sequence of SARS-CoV-2 was released on 10 January 2020, and the WHO subsequently recommended several assays for the detection of SARS-CoV-2 [3]. Within NSW, the Centre for Infectious Diseases and Microbiology Laboratory Services, in the NSW Health Pathology-Institute of Clinical Pathology and Medical Research, was designated as the public health laboratory responsible for specific testing of SARS-CoV-2 during the earliest phase of the outbreak. During this initial phase, commercial assays were not available in Australia. However, on 31 January 2020, a commercial assay for the specific detection of SARS-CoV-2 (AusDiagnostics Pty Ltd, Mascot, NSW, Australia) was announced [4]. We evaluated this assay’s performance against real-time PCR (RT-PCR) assays using SARS-CoV-2 gene targets recommended by the WHO [5].

Methods

Clinical samples

Samples were collected from persons with suspected SARS-CoV-2 infection according to the case definition outlined in the Communicable Diseases Network Australia (CDNA) National Guidelines for Public Health Units for managing COVID-19. A suspect case was defined as meeting both clinical criteria, fever ≥ 38 °C or history of fever or acute respiratory infection (e.g. cough, shortness of breath, sore throat) and epidemiology criteria which includes international travel in the 14 days prior to symptom onset to a country known to have cases of COVID-19 or close contact with a confirmed or probable case. This case definition continues to be updated and is (available at: https://www1.health.gov.au/internet/main/publishing.nsf/Content/cdna-song-novel-coronavirus.htm). Upper respiratory tract (URT) samples [including nasopharyngeal swabs (NPS), combined nose and throat swabs (NTS) and nasopharyngeal aspirates (NPA)] were collected under appropriate infection control measures, placed in 1−3 mL of viral or universal transport media, transferred to the laboratory and tested within 12 h of specimen receipt. As aerosol generating procedures (collection of induced sputum, tracheal aspirates, or bronchoalveolar lavage) were not performed in patients not requiring invasive ventilatory support, sputum was the only lower respiratory tract (LRT) sample available for testing. Serial sampling of the URT and/or LRT was performed in patients with confirmed SARS-CoV-2 infection. The specimen types, collection, and processing used in this study were in accordance with those recommended by the AusDiagnostics Assay package insert.

SARS-CoV-2 culture and positive controls

Viral cultures using Vero E6 cells were performed on samples where SARS-CoV-2 nucleic acid was detected. Cells were inspected daily for cytopathic effects, and when observed, this was confirmed by nucleic acid testing (NAT) of cell culture supernatant, using the ORF1b target. Serial dilutions of a patient’s SARS-CoV-2 cell culture supernatant (neat to 10−7) and synthetic positive control (neat and 10-9, gBlocks gene fragments covering E, RdRp and N genes, Integrated DNA Technologies, Coralville, Iowa, USA) were also tested by NAT as outlined below.

Nucleic acid extraction, amplification and detection

RNA extraction was performed using the BioRobot EZ1 and EZ1 Virus Mini Kit v2.0 (Qiagen, Valencia, CA, USA) according to the manufacturers’ instructions, using 200 u L of specimen. Nucleic acid amplification and detection was then performed using the methods outlined below. From January 22 to January 31, 2020, SARS-CoV-2 was detected using an in-house developed gel-based NAT targeting the E gene as described by Corman et al. [6] as primers but not probes were available. From 1 February 2020 onwards, SARS-CoV-2 detection was performed using RT-PCR assays targeting both the E and RdRp genes. The RdRp gene P2 probe is specific for SARS-CoV-2 and does not detect SARS-CoV [7]. Specimens collected prior to 31 January 2020 previously tested using the gel-based NAT were retrospectively tested using the same RT-PCR assays. Samples were also tested using the AusDiagnostics assay (Coronavirus Typing version 01) a research use only assay, which is a RT-PCR assay that distinguishes between SARS-CoV-2 and other endemic coronaviruses (HKU-1, OC43, 229E and NL63), SARS-CoV and MERS-CoV. Data analysis is performed using proprietary software (RealTime_PCR v7.7) with positive, negative or inhibited results provided following interpretation. Typically, a positive result satisfies pre-defined criterion for cycle threshold (Ct) and melting temperature (Tm) for the amplified gene target. Where discrepant AusDiagnostics assay results were encountered (relative to the in-house assays targeting the E and/or RdRp genes), the cycling and melt curves of each sample were manually examined, followed by further testing of four other WHO recommended targets (the N, ORF1b, ORF1ab and M genes) [5] for discrepant analysis, with the definitive result determined by the consensus of the assays. In addition to SARS-CoV-2-specific testing, all samples were also tested using an in-house multiplex respiratory virus panel, which detects influenza A, influenza B, respiratory syncytial virus [RSV], parainfluenza viruses [PIV] 1−3, human adenovirus and human metapneumovirus [hMPV], as previously described [8].The primers and probes, mastermix composition and cycling conditions used in the in-house assays specifically detecting SARS-CoV-2 are outlined in Table 4.
Table 4

Primers and probes used in the in-house assays specifically detecting SARS-CoV-2, mastermix composition and cycling conditions.

E_ Sarbeco_F1forward primerACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_E2 reverse primerATATTGCAGCAGTACGCACACA
E_Sarbeco_P1 probeFAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1
RdRp_ SARSr-F forward primerGTGARATGGTCATGTGTGGCGG
RdRp_SARSr_reverse primerCARATGTTAAASACACTATTAGCATA
RdRp_SARS-P2 probe*FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1
N gene forwardCACATTGGCACCCGCAATC
N gene reverseGAGGAACGAGAAGAGGCTTG
N gene probeFAM-ACTTCCTCAAGGAACAACATTGCCA-BHQ1
ORF1ab forwardCCCTGTGGGTTTTACACTTAA
ORF1ab reverseACGATTGTGCATCAGCTGA
ORF1ab probeFAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1
ORF1b forwardCATGGTGGACAGCCTTTGTTAC
ORF1b reverseTCGCGTGGTTTGCCAAGAT
ORF1b probeFAM- AATGTGAATGCGTCATCATCTGAAGCA-BHQ1
M gene forwardCAAGGACCTGCCTAAAGAAATCAC
M gene reverseACGCTGCGAAGCTCCCAAT
M gene probeFAM- TGTTGCTACATCACGAACGCTTTC-BHQ1

*Specific for SARS CoV-2 that does not detect SARS-CoV.

Reaction volume 20 μL+5 μL template. We run at 16 μL+ 4 u L volumes (economy).

Genome sequencing

Three full-length sequences of the SARS-CoV-2 genome from clinical samples and/or viral cultures were obtained by amplicon-based Illumina sequencing (with and without enrichment using the Illumina Pan Viral Kit), and submitted to GISAID, accession IDs: EPI_ISL_407893, 408976 and 408977.

Results

The median age of the persons under investigation was 31.5 years of age (range 0–84) and 30 were males (58 %). Samples were collected from the URT and LRT (sputa) from adults. Nine of 50 (18 %) persons were children (<16 years old), with six providing NTS or NPS, and three providing NPA. Of the 52 specimens tested, respiratory viruses were detected in 22 (42 %) samples, including SARS-CoV-2 (n = 5), rhinovirus (n = 7), enterovirus (n = 5), influenza B (n = 4), hMPV (n = 5), influenza A (n = 2), PIV-2 (n = 1), RSV (n = 2), CoV-NL63 (n = 1) and CoV-229E (n = 1). Coinfections were detected in four samples (one sample each of SARS-CoV-2 plus enterovirus, rhinovirus plus PIV-2, RSV plus rhinovirus, and rhinovirus plus enterovirus).

AusDiagnostics versus in-house developed assays

SARS−COV-2 was detected in nine samples by the AusDiagnostics assay, but this was only confirmed by in-house assays targeting E, RdRp genes in five samples. In the remaining four samples, the E, RdRp, N, ORF1b, ORF1ab and M gene results were negative, and these were deemed as false positive results. Using the in-house assays as the “gold standard”, the sensitivity, specificity, positive and negative predictive values of the AusDiagnostics assay 100 %, 92.16 %, 55.56 % and 100 % respectively. Further interrogation of the cycling and melt curves of the false positive samples revealed a relatively flat, non-sigmoidal amplification curve (Fig. 1 ). By manual interpretation, the results of such amplification curves would have been called negative, despite the melt curves suggesting a positive test result.
Fig. 1

Example of a false positive AusDiagnostics assay result showing a flat, non-sigmoidal amplification curve.

Example of a false positive AusDiagnostics assay result showing a flat, non-sigmoidal amplification curve. Of note, no other coronaviruses (HKU-1, OC43, 229E, NL63, SARS-CoV and MERS-CoV) were detected by the AusDiagnostics assay in these four samples. However, the AusDiagnostics assay detected other coronaviruses (NL63 and 229E) in two other samples. The results of testing by the in-house and AusDiagnostics assays are shown in Table 1, Table 2, Table 3 .
Table 1

Results of samples testing positive for SARS-CoV-2 on AusDiagnostics assay.

Age (yrs)SexDays since symptom onsetSampleOther respiratory virusAusDiagnostics RUO 2019-nCoVE-geneRdRp-geneN-geneORF1b-geneORF1ab geneM-gene
Take-off cycleCtCtCtCtCtCt
53M9NPSND20.7630.1434.11ND4031.46ND
44M3NTSND8.4221.4824.7627.2124.1921.8527.47
21F2NTSND13.9925.7228.4632.0928.5825.7932.19
35M7NTSND19.6830.1431.3837.8134.534040
44M8SputumND15.3924.2627.2834.6829.3626.6530.02
40M6NTSND25.16NDNDNDNDNDND
43F4NTSND24.3NDNDNDNDNDND
11mM2NPAND14.66NDNDNDNDNDND
44M13NPSND24.83NDNDNDNDNDND

ND – not detected, NTS – combined nose and throat swab, NPS – nasopharyngeal swab, NPA – nasopharyngeal aspirate.

Table 2

Results of cell culture titres supernatant and Synthetic positive Control (gBlock (E, RdRp, & N gene) titres.

AusDiagnostics
In-house
Take-off Cycle
Temp
E-geneRdRp-gene
RUO 2019-nCoVSPIKERUO 2019-nCoVSPIKECtCt
Cell Culture NEATNDNDNDNDNDND
Cell Culture -1NDNDNDND15.9819.95
Cell Culture -2NDNDNDND19.8323.89
Cell Culture -3NDNDNDND23.2127.66
Cell Culture -413.8912.5785.9481.825.8130.36
Cell Culture -518.1912.6385.9181.827.7533.38
Cell Culture -621.7112.7985.9481.8ND35.21
Cell Culture -7ND14.3ND81.8NDND
gBlock -3ND13.36ND81.811.934.35
gBlock -4ND13.06ND81.815.2333.03
gBlock -5ND13.02ND81.818.6ND
gBlock -6ND13.01ND81.821.57ND
gBlock -7ND13.18ND81.823.84ND
gBlock -8ND13.16ND81.8NDND
gBlock -9ND13.01ND81.8NDND
H2OND12.85ND81.8NDND
AUSD RESP CONTROLND13.43ND81.8NDND
Table 3

Summary of other results for clinical samples.

Age (yrs)SexDays since symptom onsetSampleOther respiratory virusAus Diagnostics RUO 2019-nCoV Take-off cycleE-gene CtRdRp-gene Ct
36F0NTSNDNDNDND
11F0NTSNDNDNDND
61F0NPSInfluenza BNDNDND
30M5NPANDNDNDND
4M2NPANDNDNDND
32F2NPSNDNDNDND
33M5NPAInfluenza BNDNDND
28M11NTSNDNDNDND
21F8NPSNDNDNDND
24M4NTSRhinovirus & EnterovirusNDNDND
2M3NPSInfluenza A & RhinovirusNDNDND
21M1NTSNDNDNDND
52M7NPSNDNDNDND
29F4NPSNDNDNDND
29F3NPSNDNDNDND
23F2NPSNDNDNDND
19MNANTSNDNDNDND
2M3NPAhMPVNDNDND
84M0NPSEnterovirusNDNDND
36F5NTSNDNDNDND
22M5NPSEnterovirusNDNDND
74F0NTSNDNDNDND
1M0NTSInfluenza BNDNDND
8M0NTShMPVNDNDND
62M??NTSNDNDNDND
500NTSRhinovirus & PIV-2NDNDND
22M1NTSNDNDNDND
22M5NTSRhinovirusNDNDND
33M0NTSRhinovirusNDNDND
9F5NTShMPVNDNDND
25F5NTSNDNDNDND
43M1NTSNDNDNDND
39M7NTSRSV and EnterovirusNDNDND
32F3NPSInfluenza B & EnterovirusNDNDND
25F1NTSNDNDNDND
25F2NTSRhinovirusNDNDND
33MNANTSRhinovirusNDNDND
50M3NTSInfluenza ANDNDND
5F7NTSNDNDNDND
38M1NPSRSVNDNDND
36M2NPShMPVNDNDND
40M5NTSCoV-229ENDNDND
44M4NPShMPV & CoV-NL63NDNDND

ND – not detected, NTS – combined nose and throat swab, NPS – nasopharyngeal swab, NPA – nasopharyngeal aspirate, hMPV – human metapneumovirus, CoV – corona virus, PIV-2 – parainfluenza virus 2, RSV – respiratory syncytial virus.

Results of samples testing positive for SARS-CoV-2 on AusDiagnostics assay. ND – not detected, NTS – combined nose and throat swab, NPS – nasopharyngeal swab, NPA – nasopharyngeal aspirate. Results of cell culture titres supernatant and Synthetic positive Control (gBlock (E, RdRp, & N gene) titres. Summary of other results for clinical samples. ND – not detected, NTS – combined nose and throat swab, NPS – nasopharyngeal swab, NPA – nasopharyngeal aspirate, hMPVhuman metapneumovirus, CoVcorona virus, PIV-2 – parainfluenza virus 2, RSVrespiratory syncytial virus. Primers and probes used in the in-house assays specifically detecting SARS-CoV-2, mastermix composition and cycling conditions. *Specific for SARS CoV-2 that does not detect SARS-CoV. Reaction volume 20 μL+5 μL template. We run at 16 μL+ 4 u L volumes (economy).

Analytical sensitivity of E versus RdRp gene assays

In all clinical samples and serial dilutions of a SARS-CoV-2 culture isolate and gBlock positive synthetic controls tested, the Ct values of the in-house RT-PCR assay targeting the E Gene was significantly lower than the corresponding RdRp gene assay (mean 21.75 vs 28.10, p = 0.0031 by Mann Whitney test) (Fig. 2 ).
Fig. 2

Comparison of cycle threshold values of the E gene versus RdRp gene for the detection of SARS-CoV-2..

E gene mean Ct value = 21.75, RdRp mean Ct value = 28.1, p = 0.0031.

Comparison of cycle threshold values of the E gene versus RdRp gene for the detection of SARS-CoV-2.. E gene mean Ct value = 21.75, RdRp mean Ct value = 28.1, p = 0.0031.

Discussion

Our experience highlights important considerations for laboratory preparedness in the early phase of the COVID-19 epidemic. Laboratory confirmation of SARS CoV-2 infection is important for individual patient care and public health management to limit the spread of infection by quarantine (which may include their close contacts). In this regard, the clinical laboratory is vital in providing accurate and timely diagnostics to confirm or exclude infection. As SARS-CoV-2 was rapidly identified as the causative pathogen of the cases of pneumonia of unknown aetiology in Wuhan, laboratories had to quickly develop and evaluate the analytical performance of diagnostic NATs. Several assays targeting different regions of the SARS-CoV-2 genome has been proposed [3], but there are limited data on the analytical performance of these assays. In the early phases of the outbreak, no commercial assays were available for testing within Australia. Assays detecting SARS-CoV-2, whether in-house developed or commercial, should be thoroughly evaluated to ensure they are fit for purpose. The initial NAT in each laboratory may also be limited by the availability of testing reagents, as evidenced in our laboratory initially using a gel-based assay targeting the E gene in the absence of probes. Following probe procurement, the NAT was changed to RT-PCR assays and initial samples tested using gel-based assay were re-tested using RT-PCR. This is the preferred method as viral loads (and hence viral kinetics) may be determined in a semi-quantitative fashion by correlating the Ct values of positive tests. In the present study, the Ct values of the E gene assay were consistently lower than the corresponding values in the RdRp assay in SARS-CoV-2 positive clinical samples, serial dilutions of SARS-CoV-2 cultures and synthetic positive controls, highlighting the superior sensitivity of the E gene assay as a screening test. In the early phases of the outbreak, it was suggested that laboratories use a pan-coronavirus NAT followed by sequencing of amplicons from non-conserved regions for characterization and confirmation of SARS-CoV-2, or amplification and detection of SARS-CoV-2 specific sequences without further sequencing [3]. The use of sequencing (although valuable for confirmation of NAT) in the diagnostic algorithm increases laboratory turnaround times and may not be ideal when there are substantial numbers of specimens that require testing. Furthermore, although sequencing may be used to confirm the diagnostic accuracy of newly developed tests for novel pathogens, this technology may not be readily available in all diagnostic laboratories. The use of sequencing can assist with investigation of cases with no clear links at a local level and sharing of sequencing data to platforms such as GISAID can contribute to the understanding of the viral evolution. The optimal type of respiratory sample that should be collected to confirm or exclude SARS-CoV-2 needs to be determined. In our study, four patients were diagnosed with SARS-CoV-2 infection. One patient had SARS-CoV-2 detectable from his LRT (sputum) but not URT sample on day eight of infection following symptom onset. This discrepant result may reflect differences in sampling quality or progression of infection from the URT to the LRT, and supports the recommendations to test LRT samples where available [PHLN], similar to our previous experience with A(H1N1)pdm09 infection [9]. The detection of SARS-CoV-2 in LRT samples is suggestive of active viral replication within the LRT, particularly in patients with deteriorating respiratory function and abnormal radiological imaging. Together with Ct values, this may be useful in guiding the clinical management of such patients. The significance of viral co-infection in COVID-19 disease on clinical outcomes is unknown. Other samples where SARS-CoV-2 have been detected by NATs include saliva, stool, rectal swabs and urine [CCDC, To]. This study has several limitations. Non-respiratory tract samples were unavailable for testing. There is emerging evidence that there may be prolonged viral shedding in stools from persons with COVID-19 infection, similar to those infected with SARS-CoV [10,11]. The specific gene target(s) of the AusDiagnostics assay are not known, so we were not able to determine the exact reason for the reduced analytical specificity. The respiratory multiplex assay used in this study is an in-house assay that does not include other endemic coronaviruses such as NL-63, OC43, 229E and HKU-1 so we were unable to verify the results of non-SARS-CoV-2 coronaviruses tested using the AusDiagnostics assay. In conclusion, we determined that the commercial AusDiagnostics assay was less reliable than an in-house RT-PCR using WHO recommended gene targets for the detection of SARS-CoV-2. Assay validation and verification are required to ensure that commercial assays used to detect SARS-CoV-2 are fit for purpose. Further data are awaited regarding the use of assays with different SARS-CoV-2 targets, viral loads and kinetics to better guide individual patient management and infection control measures. The optimal testing algorithm to detect SARS-CoV-2 for diagnostic pathology providers and public health reference laboratories will depend on their healthcare systems, laboratory capacity and capability, particularly with the anticipated substantial increase in testing demands as the epidemic progresses and revised case definitions broaden the indications for testing.

Disclosure

The kits for the AusDiagnostics assay were supplied to the laboratory by AusDiagnostics Pty Ltd free of charge, no funding was provided for this study. All work including study design, execution, analysis, write up and editing was undertaken independently by the authors listed.

CRediT authorship contribution statement

H. Rahman: Conceptualization, Methodology, Validation, Formal analysis, Data curation, Writing - original draft, Writing - review & editing, Visualization. I. Carter: Conceptualization, Methodology, Validation, Formal analysis, Resources, Data curation, Project administration. K. Basile: Validation, Formal analysis, Data curation, Writing - original draft, Writing - review & editing, Visualization. L. Donovan: Investigation. S. Kumar: Investigation. T. Tran: Investigation. D. Ko: Investigation. S. Alderson: Investigation. T. Sivaruban: Investigation. J.-S. Eden: Investigation. R. Rockett: Investigation. M.V. O’Sullivan: Writing - review & editing, Supervision. V. Sintchenko: Writing - review & editing, Supervision. S.C-A. Chen: Writing - review & editing, Supervision. S. Maddocks: Writing - review & editing, Supervision. D.E. Dwyer: Writing - review & editing, Supervision. J. Kok: Conceptualization, Methodology, Validation, Formal analysis, Writing - original draft, Writing - review & editing, Supervision, Project administration.
  7 in total

1.  Rapid-test sensitivity for novel swine-origin influenza A (H1N1) virus in humans.

Authors:  Christopher C Blyth; Jonathan R Iredell; Dominic E Dwyer
Journal:  N Engl J Med       Date:  2009-11-18       Impact factor: 91.245

2.  Persistent shedding of viable SARS-CoV in urine and stool of SARS patients during the convalescent phase.

Authors:  D Xu; Z Zhang; L Jin; F Chu; Y Mao; H Wang; M Liu; M Wang; L Zhang; G F Gao; F S Wang
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2005-03       Impact factor: 3.267

3.  Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding.

Authors:  Roujian Lu; Xiang Zhao; Juan Li; Peihua Niu; Bo Yang; Honglong Wu; Wenling Wang; Hao Song; Baoying Huang; Na Zhu; Yuhai Bi; Xuejun Ma; Faxian Zhan; Liang Wang; Tao Hu; Hong Zhou; Zhenhong Hu; Weimin Zhou; Li Zhao; Jing Chen; Yao Meng; Ji Wang; Yang Lin; Jianying Yuan; Zhihao Xie; Jinmin Ma; William J Liu; Dayan Wang; Wenbo Xu; Edward C Holmes; George F Gao; Guizhen Wu; Weijun Chen; Weifeng Shi; Wenjie Tan
Journal:  Lancet       Date:  2020-01-30       Impact factor: 79.321

4.  Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR.

Authors:  Victor M Corman; Olfert Landt; Marco Kaiser; Richard Molenkamp; Adam Meijer; Daniel Kw Chu; Tobias Bleicker; Sebastian Brünink; Julia Schneider; Marie Luisa Schmidt; Daphne Gjc Mulders; Bart L Haagmans; Bas van der Veer; Sharon van den Brink; Lisa Wijsman; Gabriel Goderski; Jean-Louis Romette; Joanna Ellis; Maria Zambon; Malik Peiris; Herman Goossens; Chantal Reusken; Marion Pg Koopmans; Christian Drosten
Journal:  Euro Surveill       Date:  2020-01

5.  Pandemic clinical case definitions are non-specific: multiple respiratory viruses circulating in the early phases of the 2009 influenza pandemic in New South Wales, Australia.

Authors:  Vigneswary Mala Ratnamohan; Janette Taylor; Frank Zeng; Kenneth McPhie; Christopher C Blyth; Sheena Adamson; Jen Kok; Dominic E Dwyer
Journal:  Virol J       Date:  2014-06-18       Impact factor: 4.099

6.  A Novel Coronavirus from Patients with Pneumonia in China, 2019.

Authors:  Na Zhu; Dingyu Zhang; Wenling Wang; Xingwang Li; Bo Yang; Jingdong Song; Xiang Zhao; Baoying Huang; Weifeng Shi; Roujian Lu; Peihua Niu; Faxian Zhan; Xuejun Ma; Dayan Wang; Wenbo Xu; Guizhen Wu; George F Gao; Wenjie Tan
Journal:  N Engl J Med       Date:  2020-01-24       Impact factor: 91.245

7.  Molecular and serological investigation of 2019-nCoV infected patients: implication of multiple shedding routes.

Authors:  Wei Zhang; Rong-Hui Du; Bei Li; Xiao-Shuang Zheng; Xing-Lou Yang; Ben Hu; Yan-Yi Wang; Geng-Fu Xiao; Bing Yan; Zheng-Li Shi; Peng Zhou
Journal:  Emerg Microbes Infect       Date:  2020-02-17       Impact factor: 7.163

  7 in total
  15 in total

Review 1.  The estimation of diagnostic accuracy of tests for COVID-19: A scoping review.

Authors:  Dierdre B Axell-House; Richa Lavingia; Megan Rafferty; Eva Clark; E Susan Amirian; Elizabeth Y Chiao
Journal:  J Infect       Date:  2020-08-31       Impact factor: 6.072

Review 2.  Laboratory diagnosis of severe acute respiratory syndrome coronavirus 2.

Authors:  T Gulholm; K Basile; J Kok; S C-A Chen; W Rawlinson
Journal:  Pathology       Date:  2020-10-08       Impact factor: 5.306

3.  Evaluation of three commercial assays for SARS-CoV-2 molecular detection in upper respiratory tract samples.

Authors:  Flora Marzia Liotti; Giulia Menchinelli; Brunella Posteraro; Paola Cattani; Simona Marchetti; Grazia Angela Morandotti; Maurizio Sanguinetti
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2020-09-04       Impact factor: 3.267

4.  Resource-efficient internally controlled in-house real-time PCR detection of SARS-CoV-2.

Authors:  Janine Michel; Markus Neumann; Eva Krause; Thomas Rinner; Therese Muzeniek; Marica Grossegesse; Georg Hille; Franziska Schwarz; Andreas Puyskens; Sophie Förster; Barbara Biere; Daniel Bourquain; Cristina Domingo; Annika Brinkmann; Lars Schaade; Livia Schrick; Andreas Nitsche
Journal:  Virol J       Date:  2021-06-02       Impact factor: 4.099

5.  Transmission of SARS-CoV-2 in Australian educational settings: a prospective cohort study.

Authors:  Kristine Macartney; Helen E Quinn; Alexis J Pillsbury; Archana Koirala; Lucy Deng; Noni Winkler; Anthea L Katelaris; Matthew V N O'Sullivan; Craig Dalton; Nicholas Wood
Journal:  Lancet Child Adolesc Health       Date:  2020-08-03

6.  Pitfalls in SARS-CoV-2 PCR diagnostics.

Authors:  Kerstin Wernike; Markus Keller; Franz J Conraths; Thomas C Mettenleiter; Martin H Groschup; Martin Beer
Journal:  Transbound Emerg Dis       Date:  2020-07-05       Impact factor: 4.521

Review 7.  How should a positive PCR test result for COVID-19 in an asymptomatic individual be interpreted and managed?

Authors:  C Esteve; F X Catherine; P Chavanet; M Blot; L Piroth
Journal:  Med Mal Infect       Date:  2020-10-03       Impact factor: 2.152

8.  Accuracy amidst ambiguity: false positive SARS-CoV-2 nucleic acid tests when COVID-19 prevalence is low.

Authors:  K Basile; S Maddocks; J Kok; D E Dwyer
Journal:  Pathology       Date:  2020-09-30       Impact factor: 5.306

9.  The Antibody Response to SARS-CoV-2 Infection.

Authors:  Linda Hueston; Jen Kok; Ayla Guibone; Damien McDonald; George Hone; James Goodwin; Ian Carter; Kerri Basile; Indy Sandaradura; Susan Maddocks; Vitali Sintchenko; Nicole Gilroy; Sharon Chen; Dominic E Dwyer; Matthew V N O'Sullivan
Journal:  Open Forum Infect Dis       Date:  2020-08-27       Impact factor: 3.835

Review 10.  Diagnosing COVID-19 in the Emergency Department: A Scoping Review of Clinical Examinations, Laboratory Tests, Imaging Accuracy, and Biases.

Authors:  Christopher R Carpenter; Philip A Mudd; Colin P West; Erin Wilber; Scott T Wilber
Journal:  Acad Emerg Med       Date:  2020-07-26       Impact factor: 5.221

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.