Epithelial changes of congenital intestinal obstruction in a rat model.

INTRODUCTION: Intestinal atresia is a rare congenital affliction that is often associated with severe bacterial infections despite adequate neonatal surgery. Previous studies have focused on enteric nervous system variations. We hypothesized that epithelial systems (ES) may also be involved in the pathophysiology of postnatal disorders.
MATERIALS AND METHODS: Global gene expression was measured by transcriptomic analysis in a rat model of induced intestinal atresia. The analyses then focused on genes involved in ES (enterocytes and goblet cells). Rat fetus small intestines at various stages of development (ED15, ED17, ED19, and ED21, n = 22), were used as non-operated controls and compared to the upper and lower segments of rat fetus small intestines with an induced atresia (n = 14; ligature at ED18). The pattern of gene expression was then confirmed by histochemistry, electron microscopy, and RT-qPCR.
RESULTS: From ED15 to ED21, the expression of several genes exhibited a physiological increase of ES markers, with a significant increase at the end of gestation. The operated embryos exhibited significantly higher variations of gene expression in the proximal segment than in the distal segment in terms of absorption and the epithelial barrier. An increase in goblet cells and markers was observed in the proximal segment compared to the controls.
CONCLUSION: Fetal intestinal obstruction accelerates maturation in the proximal segment and disrupts the intestinal wall in the distal segment, with a decrease in the number of mucosal cells. Moreover, the epithelial cells underwent significant changes, supporting the notion that intestinal disorders involve more than the ENS.

Introduction

Congenital intestinal atresia is a well-known cause of neonatal obstruction, with an estimated overall incidence of 1:1,500–1:2,000 live births [1, 2]. In jejunoileal atresia, the obstruction is thought to be related to a fetal vascular event secondary to mesenteric ischemia in the second or third trimester of pregnancy [3]. Treatment consists of surgical repair shortly after birth. The main postoperative complications affecting one-third of all cases include intestinal dysmotility and bacterial translocation, which may be life-threatening in severe cases.

The underlying pathophysiology of intestinal motility disorders is considered to be mainly related to enteric nervous system impairment, and most of the recent studies with animal models have focused on enteric nervous system changes [4-6]. Histological assessment of specimens from patients with intestinal atresia has confirmed the presence of an impaired ENS structure in the proximal segment and delayed maturation in the distal segment [7].

The underlying intestinal impairment in the postoperative period is, however, not fully understood. Enteroendocrine cells have recently been implicated in this pathological condition [8]. Altered enteroendocrine development can lead to impaired glucose homeostasis [9]. These results also suggest that other mucosal components such as glandular secretion or absorption may be disrupted in this intestinal obstruction [10]. Epithelial functions include the digestion and absorption of nutrients, the formation of an intestinal barrier against mechanical or biological stresses, and immune protection.

Early intestinal impairments such as childhood enteropathies with severe diarrhea can be associated with epithelial abnormalities [11]. In inflammatory bowel diseases, defects in intestinal barrier function such as a defective mucus layer [12] allow bacteria to come in direct contact with the epithelium, thereby enhancing bacterial invasion. Perturbation of epithelial permeability occurs in the same conditions, although the underlying molecular mechanisms are not fully understood [12]. Such considerations are not available for congenital conditions. Pathological epithelial changes have previously been highlighted in gastroschisis, which is another congenital condition involving intestinal obstruction. Perturbation of epithelial permeability with impairment of nutrient uptake has been found to be involved [13, 14]. Morphological assessment of the gut wall in atresia animal models has revealed a modified histological pattern in the proximal and distal segments close to the obstruction [15]. Other studies, of human samples, have reported the presence of differentiation of the epithelial wall at both sides of the obstruction [16, 17].

The aim of our study was to determine whether the proximal or the distal segment was the most impaired and to analyze the epithelial changes, in light of their suspected involvement in digestion impairment and bacterial translocation. To do so, a transcriptomic analysis was performed to identify changes in gene expression during late normal intestinal development (between ED15 and ED21) and in a rat model of surgically-induced intestinal obstruction (ligature of the small intestine in rat embryos at ED18) [18]. The gene expression pattern was assessed by RT-qPCR, histochemistry, and electron microscopy.

Materials and methods

1. Ethics statement

The experimental protocol was approved by the French animal care and use committee (Comité National de Réflexion Ethique sur l’Expérimentation Animale; reference number 05180.04) and all animal procedures were performed according to the French guidelines for animal protection and welfare.

2. Fetal bowels and intestinal obstruction

Pregnant Wistar rats were purchased from Janvier Labs (Le Genest-Saint-Isle, France). Pregnant rats were deeply anesthetized by inhalation of 3% isoflurane in combination with a mixture of nitrous oxide and oxygen (1:2, V/V). Kinetic control bowels at different developmental stages (ED15, ED17, ED19, and ED21) were obtained after cesarean section and fetus laparotomy.

Intestinal obstruction was surgically induced at day ED18 in fetuses of pregnant Wistar rats [9]. We selected well-exposed fetuses. The fetal abdominal wall was opened, and an intestinal loop was extracted without causing liver or umbilical cord injury. A 10/0 Prolene (Ethicon, France) suture was made around the exposed intestine. The abdominal loop was reintegrated into the abdominal cavity and then closed. During the same procedure, simple laparotomy was performed in other fetuses that were used as sham controls. At day ED21, and to prevent cannibalism, all of the animals were delivered by cesarean section.

The studied fetuses were weighed and measured. Their bowels were collected and measured. The criteria for successful surgery were: (i) a live fetus with a precise gestational age and (ii) macroscopic evidence of intestinal obstruction, i.e., a proximal intestine filled with biliary fluid and dilation of at least 2 cm distinct from a consistently uncolored distal segment. The obstructed bowels were analyzed on both sides of the ligature.

3. RNA isolation

Total RNA was extracted from bowels using QIAzol® Reagent and then treated with DNase I prior to purification using a Qiagen RNeasy Mini Kit according to the manufacturer's instructions (Qiagen, Hilden, Germany). The concentration and the purity of the eluted RNA were analyzed by spectrophotometry using a NanoDrop® ND-2000/2000c (Thermo Fisher Scientific, Waltham, Massachusetts, USA). The RNA quality and integrity were assessed with an Agilent 2100 bioanalyzer using an RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA). Only RNA samples with an RNA integrity number (RIN) greater than 7 were used. The samples were stored at -80 °C until use.

4. Microarray screening and data analysis

An Affymetrix GeneChip® Rat Gene 2.0 Array was used to analyze differential gene expression profiles of the control intestines at various stages of maturation (between ED15 and ED21, n = 16) and the segments proximal and distal to intestinal obstruction (ED21, n = 8). The samples were prepared according to the manufacturer’s instructions and recommendations (Affymetrix, Santa Clara, CA, USA). Briefly, total RNA from each sample was reverse-transcribed, converted into complementary RNA using the standard Affymetrix protocol and hybridized to the Affymetrix GeneChip Rat Gene 2.0 Array at the genomic platform at the Cochin Institute.

Data processing and analysis

Raw Affymetrix data (.cel files) from the arrays were transformed by the Robust Multiarray Analysis (RMA) method using Bioconductor in R software to obtain genome-level expression values. The probe-level raw intensities were background-corrected using RMA, and then quantile normalized and summarized as log-expression values.

Statistical analysis

Normalized scanned probe array data were compared between groups to generate p-values and signal log-ratios (fold changes). The changes in gene expression were analyzed using unsupervised hierarchical clustering (with log-transformed and normalized signal intensity values) and principal component analysis (PCA) to assess the data in terms of technical bias and outlier samples, and to visualize intergroup differences. To identify differentially expressed genes, an analysis of variance (ANOVA) was used for each gene and pairwise Tukey’s post-hoc tests were used for comparisons between groups. Differences were considered significant when p < 0.05.

5. Quantitative real-time PCR

Complementary DNA was obtained by reverse transcription (RT) of the extracted total RNA (0.5 μg) with a QuantiTec Reverse Transcription Kit following the manufacturer's instructions (Qiagen, Hilden, Germany). Two RTs were performed for each RNA sample. All of the cDNA samples were quantified using a Nanodrop ND-2000/2000c spectrophotometer (Thermo, Waltham, Massachusetts, USA) to determine the concentration and purity of each cDNA sample. Primers for the genes of interest and the reference genes were designed using PrimerBlast (NCBI) and Primer3 software, with melting temperatures ranging from 62 °C to 63 °C. The sequences of the forward and the reverse primers used for the real-time PCR amplifications are shown in Table 1. The cDNA was amplified by real-time PCR using a RotorGene SYBR Green PCR Kit (Qiagen, Hilden, Germany) in a total volume of 25 μL consisting of 1x RotorGene SYBR Green MasterMix, 600 nM of each primer, and 80 ng of cDNA. The amplification was carried out using a Rotor-Gene 6000 multiplex system (Corbett Research) with the following qPCR conditions: 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, and then 62 °C for 45 s. Each cDNA sample analysis was performed in duplicate for the genes of interest and in triplicate for the reference genes. Negative (water) controls were included in all of the qPCR runs.

Table 1

Primer sequences for the real-time PCR.

Genes	Primer sequences 5’-3’
	Forward (F)/Reverse (R) primers
TMPRSS15	F:	TGACTGGCTGGTGTCTGCTG
	R:	CGATCGACCACCCGTCTTACT
LCT	F:	CCCAAGGGCTTCATCTGGAGT
	R:	CATGCCACGTCTCCGTTGTC
TFF3	F:	CTGGATAACCCTGCTGCTGGT
	R:	GCCGGGACCATACATTGGCT
HPRT	F:	CTCATGGACTGATTATGGACAGGAC
	R:	GCAGGTCAGCAAAGAACTTATAGCC
TBP	F:	TGGGATTGTACCACAGCTCCA
	R:	CTCATGATGACTGCAGCAAACC

Abbreviations: TMPRSS15: Transmembrane Serine Protease Serine 15, LCT: Lactase, TFF3: Trefoil Factor 3, TBP: TATA box binding protein, HPRT: Hypoxanthine-guanine phosphoribosyltransferase.

The data were analyzed using the corresponding software version 1.7 (Corbett Research). Gene expression was quantified using the relative delta Ct method by comparing the number of cycles of target genes with the internal reference genes (HPRT and TBP). Target gene/reference gene ratios were calculated and expressed as 2-ΔCt. This ratio was then used to evaluate the expression level of the target genes in each sample.

The data were analyzed in duplicates of three independent samples (mean ± SD) of three groups: proximal, distal, and control intestines at ED21. Differences in gene expression were analyzed by quantitative RT-PCR using the Student’s t-test. Differences were considered to be significant at p < 0.05.

6. Optical microscopy

Bowels were collected, oriented, and fixed immediately on ice in 4% paraformaldehyde (PFA) in PBS (phosphate-buffered saline solution, pH 7.4). After 3 hours, the PFA was removed, and the bowels were rinsed with PBS and incubated in 30% (w/v) sucrose in PBS overnight at 4 °C. The samples were frozen by immersion in liquid nitrogen-cooled N-methyl butane. The proximal and distal segments on both sides of the atresia were embedded together from the ligature. Sections with a thickness of 8 μm were cut using a freezing microtome and processed for immunohistochemistry or histology. For histology, the sections were stained with hematoxylin and eosin to visualize the overall morphology.

Sections of intestines were stained with periodic acid-Schiff reaction (PAS) to detect intestinal goblet cells. The number of PAS+ goblet cells was expressed per section.

For morphometry, quantification of the absorption area was calculated using a surface modeling pattern based on measurement of the number of villi, as well as the length and the intestinal diameter. The total absorption area was calculated using the total area of villi. Differences in the area between the proximal and the distal segment were analyzed quantitatively using the Student’s t-test. Differences were considered to be significant at p < 0.05.

7. Transmission electron microscopy (TEM)

The samples were fixed in 2.5% glutaraldehyde in 0.05 mol/L sodium cacodylate buffer, post-fixed in 1% osmium tetroxide, and embedded in epoxy resin. Semi-thin sections (1 μm thickness) were stained with toluidine blue and examined under a light microscope. Areas appropriate for further ultrathin sectioning were then selected and examined using a transmission electron microscope. Ultrathin sections were stained with uranyl acetate and lead citrate, and then examined with an electron microscope (a JEM-1011, JEOL, Tokyo, Japan) at 80 KeV. Each obstructed bowel was compared to a control bowel in order to analyze the epithelium ultrastructures.

Results

1. Analysis of global gene expression

Microarray gene expression was studied on proximal and distal segments of bowel ligatures (n = 4) and on control bowels at different stages of differentiation ED15 (n = 4), ED17 (n = 4), ED19 (n = 4), and E21 (n = 4). Compared to ED21 controls, 3,625 genes were significantly up- or down-regulated in the segment proximal to the ligature (18% of the 20,267 genes) whereas only half of the genes (1,894 genes, 9%) exhibited significant changes in the distal segment (Table 3). The results show that global gene expression was more disrupted in the proximal segment than in the distal segment compared with E21 segment controls (Table 2). Thus, the proximal segments appeared to be more disrupted by the ligature.

Table 3

Morphometric results for the intestinal absorption area.

	E21 proximal (n = 3)		E21 distal (n = 3)		E21 Control (n = 3)
Absorption area data	Mean ± SD	p-value vs. controls	Mean ± SD	p-value vs. controls	Mean ± SD
Measured data
Intestinal diameter (μm)	1,245.5 ± 113.03	0.049	629.13 ± 88.38	0.012	902.97 ± 46.88
Villi length (μm)	299.73 ± 83.51	0.512	214.47 ± 35.62	0.062	267.28 ± 31.98
Villi numbers	37.27 ± 3.91	0.045	18.13 ± 0.81	0.025	22.53 ± 0.50
Calculated data
Villi diameter (μm)	98.15 ± 6.55	0.080	102.40 ± 12.25	0.088	120.19 ± 4.07
Villi area (μm2)	93,400 ± 31,000	0.091	70,700 ± 17,900	0.047	101,000 ± 12,500
Intestinal area (mm2)	38.63 ± 9.74	0.048	14.31 ± 2.79	0.027	21.66 ± 2.7017

Table 2

Significantly up- or down-regulated gene numbers at various stages of development for kinetic controls and in the obstructed bowel.

	Controls E17 vs. E15	Controls E19 vs. 15	Controls E21 vs. E15	Proximal vs. E21 controls	Distal vs. E21 controls
Genes up- or down regulated, p<0.05	3,853	8,666	12,315	3,625	1,894
Genes up-regulated, p<0.05	2,046	3,554	4,338	1,452	743
Genes down-regulated, p<0.05	1,807	5,112	7,977	2,173	1,151

2. Surface area of the small intestine

Morphometry and optical microscopy

Calculation of the bowel absorption area revealed a significant statistical increase in the proximal segment (38.6 mm2 ± 9.7 vs. 21.63 mm2 ± 2.7, p = 0.04) and a decrease in the distal segment (14.3 mm2 ± 2.8 vs. 21.6 mm2 ± 2.7, p = 0.02) (Table 3).

3. Enterocyte cell brush-border membrane transporters and enzymes

Gene expression

A strong increase in gene expression for brush-border membrane transporters and enzymes, in particular for lactase, was observed in the last days of normal fetal development between ED15 and ED21 (S1 Table). No significant differences in gene expression were observed in atretic fetuses in the proximal and the distal segments compared to the ED21 controls.

Lactase gene expression increased significantly in the proximal and the distal segments compared to the ED21 controls based on quantitative real-time PCR (Table 4). Based on quantitative real-time PCR, enterokinase expression (TMPRSS15) increased in the proximal segment (Table 4 and S1 Table).

Table 4

Quantitative real-time PCR results: Gene expression and p-values of selected brush-border membrane enzymes and transporters.

	E21 proximal (n = 3)				E21 distal (n = 3)				E21 Control (n = 3)			p-value
Genes	Mean	±	SD	p-value vs. controls	Mean	±	SD	p-value vs. controls	Mean	±	SD	Proximal vs. Distal
BRUSH BORDER MEMBRANE ENZYMES AND RANSPORTERS
TMPRSS15	8.97	±	11.66	0.254	0.02	±	0.01	0.175	0.01	±	0.01	0.254
LCT	30.56	±	4.48	0.006	37.59	±	11.39	0.018	9.36	±	5.26	0.376

Abbreviations: TMPRSS15: Transmembrane Serine Protease Serine 15, LCT: Lactase,

Electron microscopy

The ED18 enterocytes exhibited both a reduced number and shorter microvilli than the ED21 controls (Fig 1). In the ED21 proximal and distal segments, the length of the microvilli was shorter (Fig 1). The epithelium ultrastructure of the distal segments revealed two types of enterocytes: (1) enterocytes that had a dark cytoplasm and an ovoid nucleus at the basal third and (2) enterocytes that had a clear cytoplasm and a large basal nucleus (Fig 1). These two populations of enterocytes may correspond to two different stages of maturation. Tight junctions between enterocytes were present at ED18 and ED21. They were not modified in the proximal or the distal segment.

Fig 1

The ultrastructure of enterocytes.

Electron microscopy focusing on enterocytes with microvilli on the apical surface of E18 controls (A), E21 controls (B), E21 proximal segment (C), and E21 distal segment (D). N indicates cell nuclei; ✶ indicate immature observed enterocytes and arrows indicate microvilli.

4. Goblet cells and mucins

Histochemistry (PAS)

Goblet cells were present in the epithelium at the ED21 developmental stage but absent at ED18. The number of goblet cells was significantly increased in the proximal segment compared with the ED21 controls (121.3 ± 16.3 vs. 69.7 mm2 ± 13.6; p = 0.01) (Table 5).

Table 5

Goblet cells in the epithelium at ED21.

The number of goblet cells was significantly increased in the proximal segment compared with the ED21 controls.

	E21 proximal (n = 3)		E21 distal (n = 3)		E21 Control (n = 3)	p-value
PAS+ cells per section	Mean ± SD	p-value vs. controls	Mean ± SD	p-value vs. controls	Mean ± SD	Proximal vs. Distal
	121.33 ± 16.29	0.012	69.67 ± 13.65	0.340	78.67 ± 4.62	0.014

As for enterocytes, an increase in gene expression for a number of goblet cell markers was observed in the last days of fetal development between ED15 and ED21 (S1 Table). This increase occurred both for membrane-bound and for secreted mucins. Significant increases in mucins were observed in the proximal segment of atretic fetuses, particularly for the secreted mucin 5b (S1 Table).

No goblet cells were observed at the ED18 developmental stage. The goblet cells of the proximal and the distal segments exhibited similar structures compared to ED21 (Fig 2).

Fig 2

The ultrastructure of goblet cells: A, B, and C represent epithelium with goblet cells indicated by ✶.

A corresponds to E21 controls, B to E21 proximal segment, and C to E21 distal segment.

Discussion

This article documents a new approach to study prenatal epithelial behavior after intestinal obstruction. It confirms the presence of all epithelial intestinal markers at delivery in this rat model. The results show that obstruction affects the proximal and the distal segment, with an overall increase in epithelial maturation and an increase in the number of goblet cells in the proximal segment associated with an increase in mucins secretion and the intestinal area compared to controls. In terms of global gene expression, the effect of the ligature was more pronounced in the proximal segment. Overall accelerated maturation has previously been reported in the same model [8], particularly for endocrine cells. The same observation for epithelial cells appears to be relevant as both share the same bowel location and endodermal embryological cell precursors. In the distal segments, the gene expression pattern was less altered compared to the controls. According to our findings, the proximal segment appeared to be more affected by the ligature, given the significantly higher number of genes that were differentially expressed based on analysis of the global transcriptome. The gene expression profile confirmed the accelerated maturation of this segment, as previously described [7]. This assumption is supported by the mechanical theory in the developmental process [19]. This theory is based on evidence that mechanical stresses induce mechanotransduction pathways that then lead to epithelial cell proliferation and tissue differentiation. The changes in luminal fluid pressure and the interruption of the flow of amniotic fluid induced by the ligature could impact the development of the proximal segment but not that of the distal segment.

Intestinal absorption appears to be enhanced in the proximal segment due to an increase in the secretion of enzymes and an increase in the area. The bowel area has been estimated in the literature based on the external diameter of the bowel [6, 18]. In the present study, a dedicated model was implemented that included the length of the villi in the calculation of this parameter. In terms of the secretion of enzymes, there has been little information to date in the literature. To the best of our knowledge, only one article has examined the epithelium and intestinal atresia [16]. Various markers (enterocytes, endocrine, goblet, and Paneth cells) were described in the proximal and the distal segment of the atresia of human newborns using immunohistochemical techniques. No changes in organization such as perturbation of the balance between proliferation and differentiation, comprising hypertrophy or atrophy, were reported at either side of the atresia.

Gastrointestinal mucins are glycoproteins produced by goblet cells. They comprise the main structural components of the mucus layer. Membrane-bound and secreted mucins play a critical role in regulatory responses against microorganisms [20]. They have been studied extensively in the context of inflammatory bowel disease [21], but there have been very few reports of their involvement in intestinal obstruction (S2 Table). Abnormal mucin secretion can lead to enterocolitis in neonates with intestinal congenital obstruction [22]. Here, a significant increase in goblet cells and associated specialized mucins in the proximal segment may involve a thicker mucus layer as a first line of defense against pathogenic microorganisms [23]. Goblet cells appeared between E19 and E21, after the surgical ligature in our model. In our opinion, the absence of an increase in mucus in the distal segment may be explained by the lack of mechanical or nutritional stimulation. Our results are not in accordance with those of Schaart et al. [16], who found no histological differences between the proximal and distal segments. However, their results need to be interpreted with a degree of caution as they only assessed mucin 2 and TTF3, without providing any details regarding the distance between the sample and the atresia site, and they did not use a quantification method.

The present results support the notion of increased wall thickness and a barrier effect in the proximal segment and less of a barrier in the distal wall. Intestinal defense and permeability may be also influenced by other parameters such as the immune system and inflammation, which were not studied here. No ultrastructural modifications of the tight junctions could be observed, but functional considerations are lacking. Khen et al. [6] reported enhanced permeability at both sides of the atresia using functional studies based on the same rat model. These authors did not find any difference between the two segments in terms of inflammation. The limitation of our study is the lack of functional experiments, particularly for enzyme digestion. It would be interesting to explore the changes in epithelial parameters after surgical treatment of the intestinal obstruction. A study using a rat model has concluded that the enteric nervous system has a high regenerative capacity after anastomoses [24]. Confirmation of this experimental study with human newborns would be complicated due to the very limited availability of postoperative bowel samples, particularly of the distal segment, with potential ethical concerns.

These results support the description of a proximal enhanced maturation segment with an increased absorption area and mucus layer, while the distal segment is not stimulated. Reduction in the number of goblet and Paneth markers and cells has been reported to be significantly associated with bacterial infection in the case of necrotizing enterocolitis in human newborns [25]. In the case of intestinal atresia, it is thought that changes in transcellular transport provide pathophysiological support to gut-derived sepsis in the postoperative period. Hence, our findings are in agreement with the mechanisms of the potential occurrence of bacterial translocation and they suggest involvement of the distal segment after surgical treatment of intestinal atresia in humans.

Conclusion

Intestinal obstruction impairs epithelial gut development, mainly in the proximal segment, and it accelerates maturation. This segment probably undergoes a pathological increase in the intraluminal pressure due to the interrupted flow of amniotic fluid. In contrast, the distal segment of the atretic intestine is not significantly affected, with a decrease in the absorption area and mucus components. Modification of the intestinal barrier may explain bacterial translocations, with consequent severe gut-related sepsis after surgical treatment of intestinal atresia. Further research is needed to confirm these findings and to determine the influence of inflammation and the immune system on epithelial permeability.

Transcriptomic results of epithelial components.

Transcriptome results: fold-changes and p-values for the gene expression of brush-border membrane enzymes, transporters, and mucins expressed in the duodenum and the small intestine of the control fetuses at ED17 vs. ED15, ED19 vs. ED15, ED21 vs. ED15 (n = 4) and ED21 (n = 4) proximal and distal segments compared to the ED21 controls (n = 4).

(XLS)

Click here for additional data file.

Review of the epithelial changes in intestinal atresia.

Abbreviations: TEM: transmission electron microscopy; IHC: immunohistochemistry; HE: hematoxylin and eosin staining; HES: hematoxylin, eosin, Saffron staining; ED: embryonic development.

(XLS)

Click here for additional data file.

2 Jan 2020

PONE-D-19-26433

Epithelial changes of congenital intestinal obstruction in a rat model

PLOS ONE

Dear Dr Ballouhey,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Feb 16 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Shree Ram Singh, Ph. D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

3.  Thank you for including the following funding information within the acknowledgements section of your manuscript; "This work was supported by a grant from the UHC of Limoges, APREL (Appel à projet Recherche Equipes Emergentes et Labellisées, 2013), funded by the ARS Limousin."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Manuscript appears to be well explained and contains all the statistically significant supporting data. It would be good to mention the number of animals used for each group, while explaining materials method (though it has been mentioned later in results). Please, carefully read the manuscript and prefer to avoid using repetitive words (like "impaired" used twice in a single sentence). Also avoid repetitive use of "the" at many places(like "The ratio of the target genes to the reference genes"). Rest seems to be fine.

Reviewer #2: The manuscript entitled “Epithelial changes of congenital intestinal obstruction in a rat model” by Ballouhey et.al has described the effect of surgically induced atresia in rat embryos. Different models of atresia have been reported, however, most of them focused on morphological changes. The authors tried to advance previous reports on morphological changes by taking a gene expression profile-based approach together with morphological examinations. However, in my opinion, the manuscript fails to address the specific scientific hypothesis. The conclusions, and the title of the manuscript are not supported by data.

Major concerns:

1. Overall representation of the manuscripts looks more incoherent. The result sections are very confusing and redundant.

2. Sample size for most of the data are very small (n=3). Previous studies by Fourcade et. al. had used n>10 in the rat model.

3. Table 2; The statistical power of this data is not so convincing considering the small sample size (n=3). It is difficult to assume the gaussian distribution of the data with the small sample size and with high variation. Therefore, I suggest non parametric test for this set of data.

4. Table 3: number of deferentially expressed gene does not make any scene unless the they suggest any biological function or pathway. I suggest a gene ontology analysis of the deferentially expressed gene to better represents the biological changes.

5. Is the gene expression data deposited in any data bank?

6. Figures should be more organized and properly labelled for the clarity of the readers.

Minor concerns

Please provide HPRT and TBP primer sequence in table 1.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

4 Mar 2020

Response to Reviewer 1

Reviewer 1: Manuscript appears to be well explained and contains all the statistically significant supporting data. It would be good to mention the number of animals used for each group, while explaining materials method (though it has been mentioned later in results). Please, carefully read the manuscript and prefer to avoid using repetitive words (like "impaired" used twice in a single sentence). Also avoid repetitive use of "the" at many places (like "The ratio of the target genes to the reference genes"). Rest seems to be fine.

We thank Reviewer 1 for their very useful comments. As suggested in the comments, we have changed the following:

-“Impaired” has been replaced with “Altered” in the introduction section

-The sentence “The ratio of the target genes to the reference genes was calculated and expressed as 2-ΔCt.” Was modified to “Target gene/reference gene ratios were calculated and expressed as 2-ΔCt.”

-The style of the entire manuscript style has also been checked.

Response to Reviewer 2

Reviewer 2: The manuscript entitled “Epithelial changes of congenital intestinal obstruction in a rat model” by Ballouhey et al. has described the effect of surgically induced atresia in rat embryos. Different models of atresia have been reported, however, most of them focused on morphological changes. The authors tried to advance previous reports on morphological changes by taking a gene expression profile-based approach together with morphological examinations. However, in my opinion, the manuscript fails to address the specific scientific hypothesis. The conclusions, and the title of the manuscript are not supported by data.

Response to Reviewer 2

1. Overall representation of the manuscripts looks more incoherent. The result sections are very confusing and redundant.

Author’s response: We apologize for the fact that Reviewer 2 found the Results section to be confusing. In light of this remark, we have changed the followings points in the Results paragraph:

-“Analysis of global gene expression” section has been moved in the first part of the paragraph.

-The presentation of the table illustrating the morphometric results has been modified.

-Throughout the entire paragraph, “Microvilli” has been substituted with “Villi” as Microvilli can only been detected by electron microscopy.

-The “Enterocyte cell brush border” section has been modified and the last sentence has been deleted “Sucrase isomaltase…(S1 Table)”.

2. Sample size for most of the data are very small (n=3). Previous studies by Fourcade et al. had used n > 10 in the rat model.

Author’s response: Indeed, the sample size was n = 3 or = 4, as the guidelines for animal experimentation stipulate that as few animals as possible are used. The aim of the experiment was to use a variety of techniques rather than a large number of animals. The transcriptomic experiment required n = 3 for each group, which meant using more than 18 operated animals, not including the high mortality rate during the surgical procedures. In previous published studies, the number of animals was higher but only a single technique was used, for example Fourcade et al. only performed an optical microscopy analysis.

3. Table 2: The statistical power of this data is not so convincing considering the small sample size (n=3). It is difficult to assume the gaussian distribution of the data with the small sample size and with high variation. Therefore, I suggest non parametric test for this set of data.

Author’s response: We fully agree with this remark. Consequently, we have opted to use a non-parametric test and we have made the following changes:

-The sentence corresponding to the statistical analysis has been changed in the Methods section: Differences in the area between the proximal and the distal segment have been analyzed quantitatively using the Wilcoxon test.

-The data in the Results section corresponding to Table 3 have been changed.

A qualified statistician has now reviewed the statistics of the manuscript and this individual has hence been added to the list of authors.

4. Table 3: number of deferentially expressed gene does not make any scene unless they suggest any biological function or pathway. I suggest a gene ontology analysis of the deferentially expressed gene to better represents the biological changes.

Author’s response: the objective was not to produce biologically significant results but to determine which segment was the most impaired. In accordance with the reviewer’s comment, we have made the following modification:

-The beginning of the Introduction section has changed to “The aim of our study was to determine whether the proximal or the distal segment was the most impaired and …to analyze…”

-The Results section has also been modified and the “Analysis of global gene expression” section along with the related Table (Table 3 becoming Table 2) has been moved in the first part of this paragraph.

5. Is the gene expression data deposited in any data bank?

Author’s response: Yes, the data are available online. The microarray analysis of this study was performed at the genomic platform (GENOMIC’S) of the Institut Cochin in Paris (22 Rue Mechain, 75014 Paris) and it has been assigned accession number E-MTAB-5981 in ArrayExpress.

6. Figures should be more organized and properly labelled for the clarity of the readers.

Author’s response: We apologize for the fact that Reviewer 2 found our pictures to be in want of improvement. In accordance to this, all of the patterning schematics of the figures have been changed to improve their appearance: the labelling of the Figures 1 and 2 has been modified. A legend has been added for each picture and the scale bars have been modified.

7. Minor concerns. Please provide HPRT and TBP primer sequence in table 1.

Author’s response: the HPRT and TBP primer sequences are now provided in Table 1.

Submitted filename: Response to reviewers.doc

Click here for additional data file.

2 Apr 2020

PONE-D-19-26433R1

Epithelial changes of congenital intestinal obstruction in a rat model

PLOS ONE

Dear Dr Ballouhey,

Thank you for submitting your revised manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the minor points raised by a reviewer on your revised manuscript.

We would appreciate receiving your revised manuscript by May 17 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Shree Ram Singh, Ph. D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The authors have significantly improved the revised manuscript. I would suggest that the following analysis to be included in the manuscript for better elucidation of the intestinal differentiation in control embryos. As the authors have performed microarray with different stages of control samples, namely ED15, ED17, ED19 and E21, it is important to show differential gene expression of all three stages (i.e. ED17,19, 21) compare to ED15 and associated pathways instead of just number of genes in ED21 vs ED15 (table 3).

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

6 Apr 2020

Response to Reviewer 2

Reviewer 2: Manuscript appears to be well explained and contains all the The authors have significantly improved the revised manuscript. I would suggest that the following analysis to be included in the manuscript for better elucidation of the intestinal differentiation in control embryos. As the authors have performed microarray with different stages of control samples, namely ED15, ED17, ED19 and E21, it is important to show differential gene expression of all three stages (i.e. ED17,19, 21) compare to ED15 and associated pathways instead of just number of genes in ED21 vs ED15 (table 2).

Author’s response:

We thank Reviewer 2 for their very useful comments.

We fully agree with this remark.

Consequently, we have implemented the intermediate results of microarray E15-17-E19-E21 for kinetic controls in Table 2.

We have implemented the intermediate results of microarray E15-17-E19-E21 kinetic controls for specific pathways in Table S1.

Submitted filename: Response to reviewers.doc

Click here for additional data file.

7 Apr 2020

Epithelial changes of congenital intestinal obstruction in a rat model

PONE-D-19-26433R2

Dear Dr. Ballouhey,

We are pleased to inform you that your revised  manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Shree Ram Singh, Ph. D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

8 Apr 2020

PONE-D-19-26433R2

Epithelial changes of congenital intestinal obstruction in a rat model

Dear Dr. Ballouhey:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Shree Ram Singh

Academic Editor

PLOS ONE