Fengjuan Chen1,2, Ka Zhang3, Yilin Huang4, Fang Luo1, Kunpeng Hu5, Qingxian Cai1. 1. Department of Hepatology, The Third People's Hospital of Shenzhen, Shenzhen, China. 2. Department of Hepatology, Guangzhou Eighth People's Hospital, Guangzhou, China. 3. Department of Infectious Diseases, The Third Affiliated Hospital of Sun yat-sen University, Guangzhou, China. 4. Department of Rehabilitation, Guangdong Provincial People's Hospital, Guangzhou, China. 5. Department of General Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China.
Abstract
Hepatocellular carcinoma (HCC) is a common malignancy with poor prognosis and high mortality. To identify key genes associated with HCC and the underlying mechanisms, we performed weighted correlation network analysis (WGCNA) of potential key genes of HCC. We identified 17 key genes closely related to HCC by yellow module combined with PPI analysis. Verification of the role of these genes revealed that SPC25 knockdown results in a significant decrease in proliferation and metastasis of HCC cells and increased protein levels of components of the p53 pathway in vitro. In summary, we identified that SPC25 is a potential tumor-promoting factor in HCC and may act via the p53 pathway.
Hepatocellular carcinoma (HCC) is a common malignancy with poor prognosis and high mortality. To identify key genes associated with HCC and the underlying mechanisms, we performed weighted correlation network analysis (WGCNA) of potential key genes of HCC. We identified 17 key genes closely related to HCC by yellow module combined with PPI analysis. Verification of the role of these genes revealed that SPC25 knockdown results in a significant decrease in proliferation and metastasis of HCC cells and increased protein levels of components of the p53 pathway in vitro. In summary, we identified that SPC25 is a potential tumor-promoting factor in HCC and may act via the p53 pathway.
Gene Expression Omnibus databaseGene Oncologygene significancehepatocellular carcinomaKyoto Encyclopedia of Genes and GenomesThe Cancer Genome Atlasweighted correlation network analysisHepatocellular carcinoma (HCC) is a common malignancy with poor prognosis and a high mortality rate [1]. There are approximately 466 000 new HCC cases in China each year, accounting for more than half of the total number of HCCpatients in the world [2]. In China, approximately 422 000 HCCpatients die each year, making HCC rank as the third leading cause of tumor‐related death, second only to gastric cancer and lung cancer [3]. HCC is the most important histologic subtype of liver cancer, accounting for more than 90% of primary liver cancer cases [4]. Although much progress has been made in the diagnosis and treatment of HCC in recent years, the prognosis of patients is still rather poor, and the 5‐year survival rate is still low. This is mainly because most patients are diagnosed in an advanced stage, accompanied by local invasion, regional lymph nodes, or distant metastasis. Therefore, further exploration of the prognostic markers and potential drug targets of HCC, providing new treatment methods, will greatly improve the survival opportunities of patients.With the continuous development of bioinformatics, weighted gene coexpression network analysis (WGCNA), as a novel and effective method, has been used to screen biomarkers [5, 6]. WGCNA clusters genes with similar expression patterns and then groups them into different modules. The genes in a given module have similar bioregulatory functions, and the central junction gene of the module is considered to be the key gene. The key genes represent the main regulatory role of the corresponding modules [7]. In addition, by analyzing the correlation between modules and clinical parameters, deep‐seated mechanisms of tumors can be explored. Therefore, WGCNA can help us understand the underlying mechanism of tumor occurrence and development, which can be used to screen potential prognostic markers and therapeutic targets.In this study, we analyzed the gene expression profile of HCC from Gene Expression Omnibus database (GEO) by WGCNA and The Cancer Genome Atlas (TCGA) dataset verification to screen 17 key genes, including SPC25, which are closely related to the prognosis of HCC. As a part of the Ndc80 complex, SPC25 plays a key role in the process of chromosomal segregation by regulating the combination of kinetochore protein and microtubule [8]. There is accumulating evidence that genetic instability caused by incorrect chromosomal segregation is closely related to tumorigenesis [9]. Many studies have confirmed that the abnormal expression of SPC25 is closely related to the progression of tumors. Some studies have suggested that SPC25 is upregulated in lung and prostate cancer tissues and is involved in the regulation of tumor cell proliferation and metastasis [10, 11, 12]. In addition, some studies have shown that SPC25 is involved in the regulation of stem cell properties of lung cancer and prostate cancer [13] and can be used as a stemness marker. However, the role of SPC25 in the occurrence and development of HCC has not been elucidated.In this study, the potential function of SPC25 in HCC was verified by WGCNA screening of the candidate gene SPC25 and molecular biological experiments. In this paper, we report the differential expression of SPC25 in HCC and its correlation with prognosis for the first time. Further molecular biological experiments verified that the knockdown of SPC25 could significantly inhibit the proliferation and metastasis of HCC cells. In summary, this study shows that SPC25 plays an important role in HCC and is a potential prognostic biomarker and therapeutic target in HCCpatients.
Methodology
Bioinformatics analysis
Data downloading and preprocessing
The GSE54236 dataset for HCC was obtained from the GEO database. A total of 161 samples included 81 HCC samples and 80 normal samples. Information from the Agilent‐014850 Whole Human Genome Microarray 4x44K G4112F (University of Modena and Reggio Emilia, Modena, Italy) platform annotation was used to match probes and gene names. Relevant clinical information was used for WGCNA.
WGCNA analyses
The gene coexpression network was constructed using the WGCNA package in r (https://horvath.genetics.ucla.edu/html/CoexpressionNetwork/Rpackages/WGCNA/). The first 25% of the genes were screened for the construction of WGCNA. The power value was calculated by the pickSoftThreshold function, and the dynamic tree shear algorithm was used to construct the network module.
Identification of key clinical modules
The correlation between modules and clinical features was evaluated by Pearson's correlation coefficients. Clinical information included the presence or absence of disease, sex, survival time, and doubling time for WGCNA. The correlation between eigengenes and clinical features of the modules was calculated to search for key modules. Gene significance (GS) was defined as a linear relationship between gene expression and clinical information. Module significance was defined as the average GS, screening the key modules for all genes in a module.
Gene Oncology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses
Gene Oncology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of the key modules were carried out to obtain the biological processes of key modules.
Search for key genes
Genes that are highly connected to nodes in the module are considered to have important functions. The key module network diagram was plotted with cytoscape (https://cytoscape.org), and the genes with degree ranking top 20 in the module network were screened out.
Survival analyses
GEPIA is a website for analyzing RNA expression data for tumors and normal samples in TCGA database. We used GEPIA to perform survival analysis according to the previously obtained hub genes to screen significant results (log‐rank P < 0.05).
Dataset validation
The selected hub genes were verified according to TCGA database for HCC.
Oncomine database extraction data
Oncomine database is a database and integrated data mining platform based on gene chip. In this database, you can set the conditions for filtering and mining data according to your needs. In this study, we set the screening conditions as follows: (a) ‘Gene: SPC25’; (b) critical value setting conditions: P‐value < 1E‐04, fold change > 1.5, gene rank = top 10%.
Experimental verification
Main reagents
RPMI 1640 medium was purchased from Gibco (Thermo Fisher Scientific, Inc, Waltham, MA, USA). Fetal bovine serum was purchased from Biological Industries (Cromwell, CT, USA). Antibodies against P53, p‐P53, and P21 were purchased from Cell Signaling Technology (Danvers, MA, USA). The anti‐SPC25 antibody was purchased from Abcam (Cambridge, UK). The anti‐actin antibody was purchased from Santa Cruz (Santa Cruz, CA, USA). The HCC cell lines SNU716, Huh7, HepG2, SMMC7721, and SNU423 were cultured in RPMI 1640 medium containing 10% fetal bovine serum and placed in an incubator at 37 °C and 5% CO2. After 2–3 days of culture, the cells in the logarithmic growth phase were selected for subsequent experiments.
Real‐time PCR
The cell culture dish was placed on an ice bucket and washed three times with PBS after the culture medium was discarded. RNA was then extracted using TRIzol. The extracted RNA was reverse‐transcribed into cDNA according to the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Shiga, Japan). The RT‐qPCR mixture was configured according to SYBR® Premix EX Taq™ II kit (Tli RNase H Plus; Takara). RT‐qPCR was performed using an Applied Biosystems® 7500 Real‐Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA), with 18S as the internal reference gene. The primer sequences were forward (5′‐GAGATACCTACAAGGATTCCA‐3′) and reverse (5′‐GCTGATCTGATTTTGATATTCC‐3′). The 18S primer sequences were forward (5′‐GGTGAAGGTCGGAGTCAACGG‐3′) and reverse (5′‐GAGGTCAATGAAGGGGTCATTG‐3′).
Western blotting
The protein samples were lysed with 4 °C RIPA lysis buffer (1% Triton X‐100, 50 mm Tris/HCl, pH 7.4, 150 mm NaCl, 10 mm EDTA, 100 mm NaF, 1 mm Na3VO4, 1 mm PMSF, and 2 μg·mL−1 aprotinin) for 40 min. The sample was centrifuged at 18 620 × for 25 min. The supernatant was removed, and the protein concentration was quantified by the Coomassie Brilliant Blue method. After mixing with 3× sample buffer solution, the protein sample was boiled for 5 min. The sample (30–50 μg/lane) was electrophoresed in a 12% SDS/polypropylene gel for 3 h and then transferred to a nitrocellulose membrane (voltage: 2 mV·cm−2; time: 120 min). After the membrane was blocked with 5% skimmed milk for 1 h, the membrane was cut according to the predyed molecular weight marked. Then, the primary antibody was added, and the membrane was incubated at 4 °C overnight. After being washed 4 times with TBST, the membrane was incubated with the secondary antibody (1 : 2000) at room temperature for 30 min. Once again, the sample is washed four times with TBST, and the ECL method was used to detect the proteins.
Liposome‐mediated cell transfection
Cells with good growth status and in logarithmic growth phase were selected and digested into a single‐cell suspension and plated in a 6‐well cell culture plate. The plate was placed in an incubator overnight. After the cells had adhered to the plate, they were transfected with SPC25‐siRNA and NC‐siRNA. Approximately 5 μL Lipofectamine 2000 was added to RPMI 1640 medium and then set aside for 5 min. Subsequently, 10 μL of siRNA was added to 240 μL RPMI 1640 medium and mixed with the Lipofectamine 2000 prepared in the previous step. Then, the mixture was allowed to rest for 20 min. The original medium from the 6‐well culture plate was removed, and 1.5 mL RPMI 1640 medium was added to each well. Then, the mixed transfection solution was added, and the cells were cultured in an incubator. After 6–8 h of transfection, the medium was replaced with normal RPMI 1640 medium containing serum.
MTT cell viability assay
Cells with good growth status and in logarithmic growth phase were selected and digested into a single‐cell suspension and plated in a 96‐well cell culture plate. The plate was placed in an incubator overnight. After the cells had adhered to the plate, they were transfected with SPC25‐siRNA and NC‐siRNA. The absorbance was detected before and 1–4 days after transfection to evaluate cell viability. In detail, 20 μL MTT solution (5 mg·mL−1) was added to each well and incubated for another 4 h. We removed the supernatant, added 200 μL DMSO to each well, and agitated the plate to dissolve the crystals. The absorbance was measured at 570 nm with an enzyme marker.
Colony formation assay
Forty‐eight hours after transfection, the cells were plated in a 12‐well culture plate and incubated in an incubator. The growth status of cells was observed every 3 days. After 2 weeks, the colonies formed were fixed with formaldehyde and stained with 0.5% crystal violet. The number of colonies was calculated.
Transwell assay
Cells were digested, and the sample was centrifuged. After removal of the supernatant and resuspension with RPMI culture medium, the sample was centrifuged and rinsed again. Then, the cells were resuspended with RPMI medium. The cell concentration was calculated, and the cells were added to 200 µL of RPMI culture medium to make a suspension, mixed, and placed in the upper chamber of a micropore filter membrane with a diameter of 8 μm. In the lower chamber of Transwell, 500 μL of RPMI 1640 medium containing 10% FBS was added, and the plate was incubated in the incubator at 37 °C. Migration and invasion were determined using cell penetration into plain membranes and matrix gel‐coated membranes, respectively. After 24 h, we removed the chamber, wiped off the remaining cells with a cotton swab, and dried the membrane at room temperature. The sample was fixed with 4% paraformaldehyde and dyed for 1 min with the Wright Stain Method. The sample was mixed with diluted Giemsa and redyed for 40 min. The filter membrane was dried with a cotton swab, and the sample was photographed.
Scratch assay
Cells were selected, and 2.0 × 105 cells were counted after digestion. The cells were plated in a 6‐well culture plate and incubated overnight in an incubator. The next day, SPC25‐siRNA and NC‐siRNA were used for transfection. Forty‐eight hours after transfection, when the cells grew to nearly 100% confluence, the cell monolayers were scratched with a 200‐μL pipette tip and photographed using an inverted microscope. The 6‐well culture plate is placed in the incubator again and photographed 24 h later. The areas of the scratches in the two photographs were compared.
Adhesion assay
Preparation of the solution: The matrix glue was diluted at 1 : 10 with 1× PBS (this part of the experiment was performed over ice).The researcher added matrix glue solution to a 96‐well culture plate, 50 μL per well, and put the plate in the cell incubator overnight.The treated cells were prepared into a 2 × 104 cell·mL−1 cell suspension, which was plated at 100 μL per well in a 96‐well culture plate.After 60 min of culture, nonadherent cells were washed away with PBS. After fixation with alcohol, the cells were stained with Wright–Giemsa stain.Cell adhesion was observed under a microscope and photographed. The adherent cells were counted.
Statistical analysis
The software spss 22.0 (IBM Corp., Armonk,NY, USA) was used for inspection and analysis. t‐Tests were used to compare the differences between groups. P < 0.05 indicates statistical significance. All experiments were performed in triplicate, and data represent the mean ± SD; statistical comparisons were calculated using Student's two‐tailed t‐tests (versus control group).
Results
Acquisition of microarray data
GSE54236 raw data were downloaded from the GEO database. The Agilent‐014850 Whole Human Genome Microarray 4x44K G4112F platform annotation information was used to match probes and gene names. Ultimately, we obtained a total of 161 samples, including expression data of 80 normal samples and 81 HCC samples, as well as their related clinical information (Table S1).
WGCNA and gene module recognition
The top 25% of differential genes in the GSE54236 chip data were used for cluster analysis through the WGCNA package (Fig. 1A). To ensure the reliability of the network structure, we removed three outlier values after calculation, and 158 samples remained (Fig. 1B). The top 25% of the gene expression data were used to construct WGCNA. A power value of 10 was selected (Fig. 1C), and 24 modules were generated, where the gray module represented the genes that were not coexpressed. Then, we analyzed the interaction between the 24 modules, constructed the network heat map, and analyzed the relative interaction among the modules (Fig. 1D).
Fig. 1
(A) Clustering diagram of gene expression data based on GSE54236, which contains 161 samples, including 81 HCC samples and 80 normal samples. The first 25% of differential genes were analyzed by WGCNA. The color intensity is proportional to disease status (having disease or not), sex, doubling time, and survival time. (B) Clustering diagram of gene expression data based on GSE54236, where three outlier samples were removed. (C) Genetic clustering tree map obtained based on the hierarchical clustering of adjacency‐based dissimilarity. The color below represents the module identified by the dynamic tree shear method. (D) Analysis diagram of the interacting relationships among coexpressed genes. Different colors of the horizontal and vertical axes represent different modules. The brightness of yellow in the middle indicates the degree of correlation between different modules.
(A) Clustering diagram of gene expression data based on GSE54236, which contains 161 samples, including 81 HCC samples and 80 normal samples. The first 25% of differential genes were analyzed by WGCNA. The color intensity is proportional to disease status (having disease or not), sex, doubling time, and survival time. (B) Clustering diagram of gene expression data based on GSE54236, where three outlier samples were removed. (C) Genetic clustering tree map obtained based on the hierarchical clustering of adjacency‐based dissimilarity. The color below represents the module identified by the dynamic tree shear method. (D) Analysis diagram of the interacting relationships among coexpressed genes. Different colors of the horizontal and vertical axes represent different modules. The brightness of yellow in the middle indicates the degree of correlation between different modules.As shown in Fig. 2A, compared with other modules, the blue, red, dark green, brown, green, and salmon modules were positively correlated with tissues (having cancer or not) and negatively correlated with survival time (cancer development stage). The green‐yellow and yellow modules were negatively correlated with tissues (having cancer or not) and positively correlated with survival time (cancer development stage). There was a significant negative correlation between the royal blue module and sex. In addition, we calculated the eigengenes of modules and clustered them according to their correlation with tissues. Among them, the yellow module was the most closely related to tissue (Fig. 2B). Similar results were demonstrated by heat maps based on adjacencies (Fig. 2C). Figure 2D illustrates the relationship between the yellow module and the genetic significance.
Fig. 2
(A) Heat map of the correlation between the modules and the clinical features of the patients. The number above represents the correlation, and the number below represents the P‐value. Red represents a positive correlation, and green represents a negative correlation. (B) Module and clinical hierarchical clustering diagram used to summarize the modules generated in WGCNA. The yellow module is most closely related to tissues. (C) Heat map of module adjacency. (D) Scatter plot of the yellow module eigengenes.
(A) Heat map of the correlation between the modules and the clinical features of the patients. The number above represents the correlation, and the number below represents the P‐value. Red represents a positive correlation, and green represents a negative correlation. (B) Module and clinical hierarchical clustering diagram used to summarize the modules generated in WGCNA. The yellow module is most closely related to tissues. (C) Heat map of module adjacency. (D) Scatter plot of the yellow module eigengenes.
GO enrichment analysis and KEGG pathway analysis results
Gene Oncology enrichment and KEGG enrichment analyses of the yellow modules were carried out using the r package clusterProfiler. P < 0.05 was defined as a meaningful result of enrichment analysis. The results of enrichment analysis were closely related to HCC, which proved the correctness of our analysis results, as shown in Fig. 3A,B, Tables [Link], [Link].
Fig. 3
(A) Gene GO enrichment analysis diagram in the yellow module. The x‐axis represents the number of genes, and the y‐axis represents the GO annotation. The color bar shows P.adjust, which is significantly enriched. (B) Gene KEGG enrichment analysis diagram in the yellow module. The x‐axis represents the number of genes, and the y‐axis represents the KEGG pathway. The color bar shows P.adjust, which is significantly enriched.
(A) Gene GO enrichment analysis diagram in the yellow module. The x‐axis represents the number of genes, and the y‐axis represents the GO annotation. The color bar shows P.adjust, which is significantly enriched. (B) Gene KEGG enrichment analysis diagram in the yellow module. The x‐axis represents the number of genes, and the y‐axis represents the KEGG pathway. The color bar shows P.adjust, which is significantly enriched.
Identification of key nodes through network analysis
The yellow module was imported into cytoscape for topology analysis. The topological parameters of all nodes in the modular network were calculated (Table S4). Nodes in each module whose degree ranked top 20 were screened out. These nodes were selected to construct a network diagram as candidate key nodes for subsequent analysis, as shown in Fig. 4.
Fig. 4
Interaction network diagram of all nodes in the yellow module. The dark yellow nodes are the genes with the degree value ranking top 20, and the light yellow nodes are the other nodes.
Interaction network diagram of all nodes in the yellow module. The dark yellow nodes are the genes with the degree value ranking top 20, and the light yellow nodes are the other nodes.
Survival analysis of hub genes
We used GEPIA database to analyze the overall survival, and P < 0.05 was considered significant. Further survival analysis was carried out on a total of 20 key genes selected above. A total of 17 genes were significantly correlated with the prognosis of patients (P < 0.05). They were BIRC5, CCNB1, CDCA5, CDCA8, CDK1, CENPF, DLGAP5, EXO1, HMMR, KIF20A, KIFC1, MELK, NCAPG, NUF2, PRC1, PTTG1, and SPC25. The survival prognosis of high‐expression group was worse than that of low‐expression group (Fig. 5).
Fig. 5
Survival analysis of hub genes. The survival analysis results based on BIRC5, CCNB1, CDCA5, CDCA8, CDK1, CENPF, DLGAP5, EXO1, HMMR, KIF20A, KIFC1, MELK, NCAPG, NUF2, PRC1, PTTG1, and SPC25 are significant (P < 0.05).
Survival analysis of hub genes. The survival analysis results based on BIRC5, CCNB1, CDCA5, CDCA8, CDK1, CENPF, DLGAP5, EXO1, HMMR, KIF20A, KIFC1, MELK, NCAPG, NUF2, PRC1, PTTG1, and SPC25 are significant (P < 0.05).
Analysis of differential expression of SPC25 in tumor
At present, there are few reports on SPC25 gene in HCC. Therefore, it is of great significance to explore the occurrence and development mechanism of SPC25 in HCC. So we focus on the expression of SPC25 in HCC and its molecular mechanism. In the Oncomine database, there are 378 studies related to SPC25 in tumors, of which 53 are statistically significant and 45 are high expression of SPC25. It was highly expressed in HCC, lung cancer, breast cancer, glioma, gastric cancer, and colon cancer, and significantly lower in leukemia (Fig. 6A). Through the study of TCGA database, we found that it is also highly expressed in HCC, lung cancer, breast cancer, colon cancer, and ovarian cancer tissues, indicating that it is closely related to the occurrence and development of tumors (Fig. 6B,C).
Fig. 6
Analysis of differential expression of SPC25 in tumor. (A): The expression of SPC25 in different tumor studies was analyzed using Oncomine database. (B, C) Expression of SPC25 in different tumors in TCGA database.
Analysis of differential expression of SPC25 in tumor. (A): The expression of SPC25 in different tumor studies was analyzed using Oncomine database. (B, C) Expression of SPC25 in different tumors in TCGA database.
Correlation between SPC25 gene expression and clinicopathology in patients with HCC
Then, we used UALCAN online database [14] to analyze the correlation between SPC25 gene expression and clinicopathological parameters in patients with HCC. We found that the expression of SPC25 gene in Stage III and Stage II patients was significantly higher than that in Stage I (Fig. 7A). The expression of SPC25 gene in patients with Grade 3 and Grade 4 was significantly higher than that in Grades 1 and 2, indicating that SPC25 can be used as a biomarker of molecular subtypes of HCC (Fig. 7B).
Fig. 7
Correlation between SPC25 gene expression and clinicopathology in patients with HCC. (A) Expression of SPC25 in different clinical stages. (B) Expression of SPC25 in different grades.
Correlation between SPC25 gene expression and clinicopathology in patients with HCC. (A) Expression of SPC25 in different clinical stages. (B) Expression of SPC25 in different grades.
Knockdown of SPC25 in vitro can inhibit the proliferation of HCC cells
To select the appropriate cell model for the next study, we first compared the expression levels of SPC25 in HCC cells (SNU716, Huh7, HepG2, SMMC7721, and SNU423) (Fig. 8). HepG2 and SMMC7721 cell lines were selected for further study because the expression level of SPC25 in HepG2 and SMMC7721 cells was the highest. The knockdown efficiency was evaluated by qRT‐PCR and WB after siRNA‐mediated knockdown of SPC25 (Fig. 9A,B). MTT assays showed that the proliferation of HepG2 and SMMC7721 cells was significantly decreased after SPC25 knockout (Fig. 10A). Colony formation assays showed that the number of colonies in the si‐SPC25 group was significantly lower than that in the si‐NC group (Fig. 10B). The above results suggest that the knockdown of SPC25 significantly inhibits the proliferation of HCC cells.
Fig. 8
PCR and western blot validation of the expression level of SPC25 in HCC cell lines. (A) PCR detection of mRNA expression of SPC25 in five HCC cell lines; all experiments were performed in triplicate, and data represent the mean ± SD. (B) Western blot experiments verified the protein expression level of SPC25 in five HCC cell lines.
Fig. 9
PCR and western blot validation of the knockdown efficiency of SPC25‐siRNA. PCR (A) and western blot experiments (B) verified that siRNA‐mediated SPC25 knockdown inhibits SPC25 expression in HEPG2 and SMMC7721 cells. *P < 0.05, **P < 0.01, and ***P < 0.001. All experiments were performed in triplicate, and data represent the mean ± SD; statistical comparisons were calculated using Student's two‐tailed t‐tests (versus control group).
Fig. 10
Effect of SPC25 on the proliferation of HCC cells. MTT (A) and colony formation (B) assays revealed changes in the proliferation of HepG2 and SMMC7721 cells after SPC25‐siRNA transfection. All experiments were performed in triplicate, and data represent the mean ± SD; statistical comparisons were calculated using Student's two‐tailed t‐tests (versus control group). **P < 0.01 and ***P < 0.001.
PCR and western blot validation of the expression level of SPC25 in HCC cell lines. (A) PCR detection of mRNA expression of SPC25 in five HCC cell lines; all experiments were performed in triplicate, and data represent the mean ± SD. (B) Western blot experiments verified the protein expression level of SPC25 in five HCC cell lines.PCR and western blot validation of the knockdown efficiency of SPC25‐siRNA. PCR (A) and western blot experiments (B) verified that siRNA‐mediated SPC25 knockdown inhibits SPC25 expression in HEPG2 and SMMC7721 cells. *P < 0.05, **P < 0.01, and ***P < 0.001. All experiments were performed in triplicate, and data represent the mean ± SD; statistical comparisons were calculated using Student's two‐tailed t‐tests (versus control group).Effect of SPC25 on the proliferation of HCC cells. MTT (A) and colony formation (B) assays revealed changes in the proliferation of HepG2 and SMMC7721 cells after SPC25‐siRNA transfection. All experiments were performed in triplicate, and data represent the mean ± SD; statistical comparisons were calculated using Student's two‐tailed t‐tests (versus control group). **P < 0.01 and ***P < 0.001.
Knockdown of SPC25 in vitro inhibits the invasion, migration, and adhesion of HCC cells
In addition, we asked whether SPC25 affects the invasion and migration of HCC cells. Further wound healing assays showed that knockdown of SPC25 significantly inhibited the migration of HepG2 and SMMC7721 cells (Fig. 11A). This result was further validated by a Transwell assay in which the migration and invasion ability of the si‐SPC25 transfection group were significantly decreased (Fig. 11B). In Fig. 11C, adhesion assays show that the adhesion between cells and matrix significantly decreases after SPC25 knockdown.
Fig. 11
Effects of SPC25 on invasion, migration, and adhesion of HCC cells. (A) Scratch test showing that the knockdown of SPC25 inhibited the migration of HepG2 and SMMC7721 cells. (B) Transwell assays were performed 48 h after SPC25‐siRNA transfection. Comparison of the number of cells on the Transwell membrane shows that migration and invasion are significantly inhibited. (C) The adhesion between HepG2 and SMMC7721 cells and the matrix significantly decreased after SPC25 knockdown. (A) Scale bar: 200 μm. (B, C) Scale bar: 100 μm. *P < 0.05, **P < 0.01, and ***P < 0.001. All experiments were performed in triplicate, and data represent the mean ± SD; statistical comparisons were calculated using Student's two‐tailed t‐tests (versus control group).
Effects of SPC25 on invasion, migration, and adhesion of HCC cells. (A) Scratch test showing that the knockdown of SPC25 inhibited the migration of HepG2 and SMMC7721 cells. (B) Transwell assays were performed 48 h after SPC25‐siRNA transfection. Comparison of the number of cells on the Transwell membrane shows that migration and invasion are significantly inhibited. (C) The adhesion between HepG2 and SMMC7721 cells and the matrix significantly decreased after SPC25 knockdown. (A) Scale bar: 200 μm. (B, C) Scale bar: 100 μm. *P < 0.05, **P < 0.01, and ***P < 0.001. All experiments were performed in triplicate, and data represent the mean ± SD; statistical comparisons were calculated using Student's two‐tailed t‐tests (versus control group).
P53 pathway is activated after SPC25 knockdown in vitro
GSEA showed a significant correlation between SPC25 and the P53 pathway. The above results were verified using WB. We tried to explore the relationship between SPC25 and the P53 pathway in HCC. Figure 12 shows that the protein expression levels of P53, p‐P53, and P21 were significantly increased after SPC25 knockdown in HepG2 and SMMC7721 cells. These results suggested that the P53 pathway is activated in HCC cells after SPC25 knockdown, which may inhibit the malignant phenotype of HCC cells.
Fig. 12
P53 pathway activation after SPC25 knockdown. (A) KEGG_P53_SIGNALING_PATHWAY. (B) Changes in protein expression levels of P53, p‐P53, and P21 were detected by western blotting.
P53 pathway activation after SPC25 knockdown. (A) KEGG_P53_SIGNALING_PATHWAY. (B) Changes in protein expression levels of P53, p‐P53, and P21 were detected by western blotting.
Discussion
Hepatocellular carcinoma is a global health problem that kills a large number of patients every year [15]. Therefore, in‐depth exploration of new prognostic markers and new drug targets is important to improve the overall survival rate of patients. In this study, we screened yellow gene modules closely related to HCC through WGCNA of GEO datasets. Furthermore, 17 key genes closely related to HCC progression and prognosis were screened using a PPI network constructed by the module genes combined with prognostic analysis. In summary, the WGCNA screening results showed that these 17 genes may play an important role in HCC development. The biological functions of these genes in HCC still require further study.Chromosomal instability is inseparably linked to the occurrence and progression of tumors [16]. A variety of factors, including chromosomal segregation abnormality [9], cell cycle checkpoint abnormality [17], and DNA damage [18], can lead to chromosomal instability. The combination of the kinetochore protein and microtubules plays an important regulatory role in the chromosome segregation process during mitosis [19]. The Ndc80 complex is an important component regulating this process [20]. The Ndc80 complex consists of Hec1, Nuf2, SPC24, and SPC25 [8, 21]. Among these, SPC25, as a component of the Ndc80 complex, is involved in the regulation of several important processes, such as mitosis and tumor occurrence [22, 23, 24]. However, the potential role of SPC25 in HCC is still unclear. In this study, the high expression of SPC25 in HCC was found to be closely related to the prognosis of patients through WGCNA combined with PPI analysis. Based on the above findings, this study is the first to reveal the potential clinical value of SPC25 in HCC.Uncontrolled proliferation and high metastatic potential are important characteristics of tumor cells [25]. In lung adenocarcinoma, it has been verified in studies that SPC25 has the ability to promote tumor cell metastasis. The stemness of tumor cells is significantly inhibited by SPC25 knockout in A549lung adenocarcinoma cells [11]. Studies in prostate cancer have confirmed that SPC25 is significantly correlated with the proliferation ability of tumor cells [12]. After SPC25 knockout, prostate cancer cells display G2 phase arrest, increased apoptosis, and inhibited stem cell properties [13]. In this study, we tried to detect the potential biological function of SPC25 in HCC. The results of MTT, colony formation, scratch, and Transwell assays showed that the knockdown of SPC25 significantly inhibited the proliferation, invasion, and migration of HCC cells. These results confirm for the first time that SPC25 is a potential cancer gene in HCC.Subsequently, we explored the molecular mechanism by which SPC25 promotes the proliferation and metastasis of HCC. Studies have suggested that SPC25 regulates the proliferation of lung adenocarcinoma cells through checkpoint‐related proteins [10]. In this study, through GSEA, we found that the ‘P53 pathway’ is a potential pathway related to SPC25. P53 is an important tumor suppressor gene that plays an important role in regulating the malignant biological functions of tumor cells [26, 27]. Our experiments show that the expression levels of P53, p‐P53, and P21 are upregulated by siRNA‐mediated SPC25 knockdown. These experimental results indicate for the first time the potential mechanism of SPC25 in modulating malignant biological behavior by regulating the P53 pathway in HCC.There are some limitations in this study: The specific mechanism by which SPC25 regulates the P53 pathway has not been fully elucidated, which requires further experiments in vitro and in vivo. In addition, the data used in this study were all retrospective. The clinical application of SPC25 as a biomarker of HCC needs to be studied comprehensively and deeply.Based on the current research results, we verified that SPC25 plays an important role in HCC. SPC25 can promote the proliferation and metastasis of HCC cells and can be used as a potential prognostic biomarker and a therapeutic target.
Conflict of interest
The authors declare no conflict of interest.
Author contributions
FC conceptualized the study, curated the data, and performed formal analysis. KZ contributed to methodology and supervised the study. YH and FL wrote the original draft of the manuscript. QC and KH wrote, reviewed, and edited the manuscript.Table S1. Expression data of 80 normal samples and 81 HCC samples.Click here for additional data file.Table S2. GO enrichment analysis.Click here for additional data file.Table S3. KEGG enrichment analysis.Click here for additional data file.Table S4. Topological parameters of all nodes in the modular network.Click here for additional data file.