| Literature DB >> 32328970 |
Liqiang Han1, Kun Pang2, Tong Fu1, Clive J C Phillips3, Tengyun Gao4.
Abstract
Supplementation with selenium is common for dairy cows, but the importance of selenium source is not clear. This study aimed to compare nano-selenium (Nano-Se) and sodium selenite supplements for dairy cows on lactation performance, milk Se levels and selenoprotein (Sel) gene expression. Twelve multiparous Holstein cows were randomly divided into two groups: a control group fed a basal diet plus 0.30 mg Se/kg of DM as sodium selenite or Nano-Se for 30 days. Dry matter intake, milk yield and composition were not affected by dietary Se source (P > 0.05); however, the milk total Se levels and milk glutathione peroxidase (GSH-Px) activities were higher with Nano-Se supplementation than sodium selenite (P < 0.05). At the end of the experiment, Nano-Se supplementation significantly increased plasma Se levels and GSH-Px activity, compared with the sodium selenite supplement. The mRNA expression levels of glutathione peroxidase 1, 2 and 4; thioredoxin reductase 2 and 3; and selenoproteins W, T, K and F were markedly upregulated (P < 0.05) in the mammary gland of the Nano-Se group. Thus, the source of selenium plays an important role in the antioxidant status and in particular the Sel gene expression in the mammary glands of dairy cows, both being stimulated by nano sources.Entities:
Keywords: Dairy cow; Glutathione peroxidase; Milk; Nano-Se; Selenoprotein
Mesh:
Substances:
Year: 2020 PMID: 32328970 PMCID: PMC7746563 DOI: 10.1007/s12011-020-02139-2
Source DB: PubMed Journal: Biol Trace Elem Res ISSN: 0163-4984 Impact factor: 3.738
Ingredients and chemical composition of the basal diets of cows
| Composition | Content |
|---|---|
| Ingredient, in g/kg DM | |
| Corn silage | 420 |
| Ground corn | 38 |
| Steam-flaked corn | 155 |
| Soybean meal | 85 |
| Cottonseed | 40 |
| Oat hay | 43 |
| Alfalfa hay | 132 |
| Soybean hull | 54 |
| Yeast XP1 | 4.2 |
| NaCl | 3.8 |
| Limestone | 5.8 |
| NaHCO3 | 6.2 |
| KHCO3 | 5.4 |
| MgO | 2.6 |
| Premix2 | 5 |
| Chemical composition, in g/kg DM | |
| Crude protein | 167 |
| Neutral detergent fibre | 315 |
| Acid detergent fibre | 208 |
| Ether extract | 56 |
| Net energy of diet, Mcal/kg3 | 1.81 |
| Ca | 8.1 |
| P | 4.5 |
| Se (mg/kg DM) | 0.05 |
1Purchased from Diamond V Co., USA
2Composition in kg−1 DM: 670,000 IU of vitamin A; 92,000 IU of vitamin D; 3750 IU of vitamin E; 700 mg of niacin; 2000 mg of Cu; 4000 mg of Zn; 330 mg of Mn; 65 mg of I; 37 mg of Co.
3Calculated using NRC
Primer sequences of Sel genes for real-time PCR
| Gene symbol (GenBank number) | Primer sequence (5′-3′) | Length of products | Gene name |
|---|---|---|---|
| GPX1 (NM_174076) | F: AACGTAGCATCGCTCTGAGG R: GATGCCCAAACTGGTTGCAG | 121 | Glutathione peroxidase 1 |
| GPX2 (NM_001163139) | F: TGAGCATTCACTGTGCCCTC R: GGAAGGAAACAGGCAGACCA | 104 | Glutathione peroxidase 2 |
| GPX3 (NM_174077) | F: TTGGTCTGGTCATTCTGGGC R: CCCCACCTGGTCGAACATAC | 105 | Glutathione peroxidase 3 |
| GPX4 (NM_174770) | F: CCGAGATGAGCTTTAGCCGT R: TGGCTGAAAATTCGTGCATGG | 144 | Glutathione peroxidase 4 |
| TXNRD1 (NM_174625) | F: CATTGCCACTGGTGAAAGGC R: CCAACCACCAGGGTCTTACC | 117 | Thioredoxin reductase 1 |
| TXNRD2 (NM_174626) | F: ACCACGTGAAGTCCCTGAAC R: CCTTTGGAGACACCGCAAAC | 118 | Thioredoxin reductase 2 |
| TXNRD3 (NM_001192109) | F: CAGCACGCGGGTTAAAGAAC R: CTGGTGATCTCCGACAGAGC | 114 | Thioredoxin reductase 3 |
SelM (NM_001163171) | F:ACTGGAACCGTCTACAAGGC R:GGATGTCCTGGGTGACGAAG | 105 | Selenoprotein M |
| SelT (NM_001103103) | F: TTTTGCAAGAGCAGCGTGAC R: AAGAGGTACAACGAGCCTGC | 102 | Selenoprotein T |
| SelW (NM_001163225) | F: CTAGCCGTCTGGACATCTGC R: TGGAGTGAACCAGCTTTCCC | 87 | Selenoprotein W |
| SelH (NM_001164092) | F: GCTTCGAGGTGACGTTGCTG R:CTGCCCCACCTCCCTACGA | 150 | Selenoprotein H |
| SelK (NM_001037489) | F:AGGCTACGGAAGCTCATCTG R: CGGCCATTGGAGGAGGATTA | 122 | Selenoprotein K |
| SelI (NM_001075257) | F: ACAAGCATGTACCCGACTGG R: GAATTGGTTCTGCGGGCTTG | 103 | Selenoprotein I |
| SelO (NM_001163193) | F: CCACGTTCCTCAGGTTTGGA R: ATCTGCAGTCGGATGTCGTC | 103 | Selenoprotein O |
| SelS (NM_001046114) | F: CCCACCCTCGAGACCGA R: ATGTACCAGCCGTAAGTGGC | 77 | Selenoprotein S |
| SelF (NM_001034759) | F: TTGGGGAGGTTCCCTCAAGT R: AGCAATGTTCCCACTGTCGT | 132 | Selenoprotein F |
| SelV (NM_001163244) | F: CCATCCAGGCCATCTTACCG R: AGGCCACAGTAAACCACTCG | 103 | Selenoprotein V |
Effects of Nano-Se supplementation on lactation performance and milk composition of dairy cows (n = 6)
| Control | Nano-Se | |||||
|---|---|---|---|---|---|---|
| Item | SEM | Treatment | Time | Treat × time | ||
| DMI (kg/day) | 13.45 | 13.28 | 0.35 | 0.74 | 0.17 | 0.79 |
| Milk yield (kg/day) | 26.74 | 27.44 | 0.64 | 0.36 | 0.11 | 0.19 |
| Milk protein (%) | 3.34 | 3.50 | 0.10 | 0.31 | 0.63 | 0.32 |
| Milk fat (%) | 3.37 | 3.33 | 0.22 | 0.87 | 0.79 | 0.80 |
| Milk lactose (%) | 4.87 | 4.86 | 0.05 | 0.94 | 0.66 | 0.67 |
| Milk Se (μg/L) | 23.19 | 30.60 | 1.55 | < 0.01 | < 0.01 | < 0.01 |
Fig. 1Effect of Nano-Se supplementation on the milk GSH-Px activity. Data are presented as the mean ± SEM. The milk samples were collected on day 1, 7, 14, 21 and 28. One unit of GSH-Px is defined as the amount of enzyme depleting 1 μmol of GSH per gram of milk protein /5 min at 37 °C. *P < 0.05 or **P < 0.01
Effects of Nano-Se supplementation on the antioxidant activity of plasma (n = 6)
| Item | Control | Nano-Se | SEM | |
|---|---|---|---|---|
| Total Se (μg/L) | 110.13 | 137.49 | 5.89 | < 0.01 |
| GSH-Px activities (U/mL)1 | 131.20 | 161.53 | 6.49 | < 0.01 |
1One unit of GSH-Px is defined as the amount of enzyme depleting 1 μmol of GSH /5 min at 37 °C in 0.1 mL of serum
Effects of Nano-Se supplementation on the mRNA expression of Sel genes in the mammary gland of dairy cows (n = 5)
| Gene | Control | Nano-Se | SEM | |
|---|---|---|---|---|
| GPX1 | 0.64 | 1.54 | 0.12 | < 0.01 |
| GPX2 | 0.82 | 1.58 | 0.07 | < 0.01 |
| GPX3 | 1.18 | 1.39 | 0.16 | 0.33 |
| GPX4 | 0.49 | 1.52 | 0.08 | < 0.01 |
| TXNRD1 | 0.91 | 1.32 | 0.25 | 0.21 |
| TXNRD2 | 0.63 | 1.64 | 0.24 | 0.02 |
| TXNRD3 | 0.90 | 1.25 | 0.06 | < 0.01 |
| SelM | 1.27 | 1.23 | 0.25 | 0.91 |
| SelW | 0.90 | 1.20 | 0.54 | 0.02 |
| SelT | 0.90 | 1.58 | 0.12 | < 0.01 |
| SelH | 0.88 | 1.29 | 0.09 | 0.19 |
| SelK | 1.01 | 1.52 | 0.12 | 0.01 |
| SelI | 0.97 | 1.11 | 0.05 | 0.06 |
| SelO | 0.84 | 1.00 | 0.08 | 0.16 |
| SelS | 1.05 | 1.32 | 0.11 | 0.06 |
| SelF | 0.84 | 1.31 | 0.18 | 0.04 |
| SelV | 1.01 | 1.05 | 0.04 | 0.51 |