Literature DB >> 32327630

Circ_0002770, acting as a competitive endogenous RNA, promotes proliferation and invasion by targeting miR-331-3p in melanoma.

Peng Qian1, Liu Linbo1, Zhai Xiaomei1, Pei Hui2.   

Abstract

Melanoma is a kind of tumor that originates from melanocytes and is characterized by chemoresistance and distant metastasis. Although the complete pathogenesis of melanoma remains unclear, increasing evidence suggests that circular RNAs (circRNAs) may be involved. In the present study, we identified a circular RNA, circ_0002770, which is produced from the well-known oncogene MDM2, and was sharply increased in melanoma and correlated with a poor prognosis. Knockdown of circ_0002770 suppressed melanoma cell invasion, migration and proliferation. Mechanistically, circ_0002770 acted as a sponge of miR-331-3p and could indirectly regulate DUSP5 and TGFBR1. Inhibition of miR-331-3p reversed the inhibitory effect of si-circ_0002770 on melanoma cell proliferation and invasion. In vivo evidence further confirmed that silencing circ_0002770 inhibited melanoma tumor formation. In conclusion, circ_0002770 facilitated melanoma cell proliferation, invasion and migration by sponging miR-331-3p and modulating DUSP5 and TGFBR1.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32327630      PMCID: PMC7181653          DOI: 10.1038/s41419-020-2444-x

Source DB:  PubMed          Journal:  Cell Death Dis            Impact factor:   8.469


Introduction

Melanoma, typically occurring in the skin, is a type of malignant tumor that usually originates from pigment-containing cells known as melanocytes[1,2]. It accounts for only 3% of the overall skin tumor cases diagnosed every year but is responsible for more than 65% of deaths[3]. Melanoma is a multifactorial tumor arising from an interplay between environmental exposure and genetic susceptibility[4], and UV exposure is considered to be the most important risk factor[5]. Early detection and timely treatment of melanoma are considered to be the two most critical factors in reducing mortality[6]. Compared to other tumors, melanoma has the advantage of cutaneous location, which allows its early detection. Nevertheless, the gold standard for melanoma diagnosis remains pathological examination[7]. Circular RNAs (circRNAs), characterized by a covalently closed loop structure, are a novel type of endogenous regulatory RNAs that widely exist in mammalian cells[8]. Unlike linear RNAs, circRNAs have no 5′ and 3′ ends, which enables circRNA resistance to digestion by endonuclease[9]. Thus, circRNAs could be expressed in mammalian cells for a relatively long time[10]. In recent decades, circRNAs have been reported to be involved in many human diseases, such as cancer, neurodegenerative disorders, and metabolic disorders[11,12]. In cancer, research studies have shown that circRNAs could be used not only as potential diagnostic agents but also as promising therapeutic targets for diverse human tumors[13]. However, little is known about the mechanism of action of circRNAs in melanoma. Circ_0002770 is a newly identified circRNA that originates from the MDM2 gene. It was reported to be upregulated in five uveal melanoma tissue samples compared to matched normal samples by microarray analysis[14]. However, its functional effects on melanoma remain undetermined. Additionally, circRNAs were recently demonstrated to play a role in many diseases by acting as a miRNA sponge[15]. The circRNA-miRNA-mRNA axis has also been found to contribute to the tumorigenesis of melanoma[16]. However, due to the variety of circRNAs and the complexity of the interaction between circRNAs and miRNAs, the complete regulatory mechanism of the circRNAs/miRNA axis in melanoma remains unclear. In this study, we identified circ_0002770 as a miR-331-3p sponge in melanoma. Then, we aimed to investigate whether circ_0002770 plays a role in melanoma tumorigenesis through miR-331-3p using both in vitro and in vivo experiments, in an attempt to better understand the regulatory network of circRNAs in melanoma and to provide novel promising therapeutic targets for melanoma.

Results

Circ_0002770 was increased in melanoma

By analyzing the UCSC dataset, we found that the exons of the well-known oncogene MDM2 encode three circRNAs (circ_0004448, circ_0000416 and circ_0002770). Then, we designed convergent and divergent primers to verify these circRNAs based on the cDNA and gDNA of melanoma cells. The results indicated that only circ_0002770 could be amplified by divergent primers from melanoma cell cDNA (Fig. 1a). The back-spliced junction of circ_0002770 was determined by Sanger sequencing (Fig. 1b). After exposure to RNase R, we found that linear MDM2 mRNA was significantly degraded, while no alteration was observed in circ_0002770 (P < 0.001, Fig. 1c). In addition, we observed that melanoma patients with high expression of circ_0002770 exhibited a shorter survival time than those with low expression of circ_0002770 (P < 0.05, Fig. 1d). We examined the level of circ_0002770 in three melanoma cell lines (SKMel1, A375 and A875) by qRT-PCR. Circ_0002770 was strongly increased in SKMel1, A375 and A875 cells compared to normal human epidermal melanocytes (NHEM) (P < 0.001, Fig. 1e). Additionally, the qRT-PCR assay results also revealed that circ_0002770 was highly expressed in metastatic melanoma tumor tissues compared to primary tissues (Fig. 1e).
Fig. 1

Circ_0002770 was increased in melanoma.

a MDM2 was identified as the host gene of circ_0002770 based on data from UCSC, and circ_0002770 could be amplified by divergent primers from cDNA but not gDNA. b Sanger sequencing verified the back-junction sequence of circ_0002770. c Resistance of circ_0002770 to RNase R was verified through qRT-PCR after RNase R digestion. d Melanoma patients with high circ_0002770 expression exhibited a worse overall survival rate than those with low circ_0002770 expression. e Circ_0002770 was highly increased in melanoma cell lines and metastatic tissues. *P < 0.05, ***P < 0.001.

Circ_0002770 was increased in melanoma.

a MDM2 was identified as the host gene of circ_0002770 based on data from UCSC, and circ_0002770 could be amplified by divergent primers from cDNA but not gDNA. b Sanger sequencing verified the back-junction sequence of circ_0002770. c Resistance of circ_0002770 to RNase R was verified through qRT-PCR after RNase R digestion. d Melanoma patients with high circ_0002770 expression exhibited a worse overall survival rate than those with low circ_0002770 expression. e Circ_0002770 was highly increased in melanoma cell lines and metastatic tissues. *P < 0.05, ***P < 0.001.

Knockdown of circ_0002770 inhibited melanoma cell migration and invasion

Next, we investigated the role of circ_0002770 in melanoma cell migration and invasion in both A375 and SKMel1 cells. First, A375 cells were transfected with negative control siRNA (si-NC) or circ_0002770 siRNA#1-3 (Supplementary Fig. S1A) followed by qRT-PCR detection of circ_0002770. Circ_0002770 was dramatically decreased in the si-circ_0002770#1 group compared to the untreated and si-NC groups (Supplementary Fig. S1B), suggesting that si-circ_0002770#1 could efficiently knockdown circ_0002770 in A375 cells. Therefore, si-circ_0002770#1 was used as the si-circ_0002770 in the following experiments. The qRT-PCR results indicated that si-circ_0002770 could directly block the expression of circ_0002770 but not MDM2 mRNA (P < 0.05, Fig. 2a). Wound-healing and transwell assays were performed to study the effects of circ_0002770 silencing on A375 cell migration. The results indicated that A375 cell migratory ability was remarkably suppressed in the si-circ_0002770 group compared to the untreated and si-NC groups (P < 0.05, Fig. 2b, c). Additionally, by using transwell chambers coated with Matrigel, we found that the A375 cell invasive ability was dramatically suppressed by knockdown of circ_0002770 (P < 0.05, Fig. 2d). We also obtained similar results in SKMel1 cells (P < 0.05, Fig. 2e–h), indicating that knockdown of circ_0002770 could inhibit cell migration and invasion in both A375 and SKMel1 cells.
Fig. 2

Knockdown of circ_0002770 inhibits melanoma cell migration and invasion.

a Circ_0002770 was sharply decreased in si-circ_0002770-transfected A375 cells, while no changes were observed in MDM2 mRNA expression. b, c Transfection of si-circ_0002770 caused a significant suppression of A375 cell migration. d The invasive ability of A375 cells was dramatically inhibited in the si-circ_0002770 group. e Circ_0002770 was significantly downregulated in si-circ_0002770-transfected SKMel1 cells, while no changes were observed in MDM2 mRNA expression. f, g Transfection of si-circ_0002770 caused a significant suppression of SKMel1 cell migration. h The invasive ability of SKMel1 cells was dramatically inhibited in the si-circ_0002770 group. Scale bars, 50 μm, *P < 0.05.

Knockdown of circ_0002770 inhibits melanoma cell migration and invasion.

a Circ_0002770 was sharply decreased in si-circ_0002770-transfected A375 cells, while no changes were observed in MDM2 mRNA expression. b, c Transfection of si-circ_0002770 caused a significant suppression of A375 cell migration. d The invasive ability of A375 cells was dramatically inhibited in the si-circ_0002770 group. e Circ_0002770 was significantly downregulated in si-circ_0002770-transfected SKMel1 cells, while no changes were observed in MDM2 mRNA expression. f, g Transfection of si-circ_0002770 caused a significant suppression of SKMel1 cell migration. h The invasive ability of SKMel1 cells was dramatically inhibited in the si-circ_0002770 group. Scale bars, 50 μm, *P < 0.05.

Knockdown of circ_0002770 suppressed melanoma cell proliferation

The role of circ_0002770 in melanoma cell proliferation was also studied in A375 and SKMel1 cells by 3D cell culture and colony formation assays. From 3D cell culture assays, we found that the colony number of si-circ_0002770-transfected A375 and SKMel1 cells was significantly decreased compared to that of the si-NC-transfected group and untreated group (P < 0.01, Fig. 3a, b). Moreover, in the 3D cell culture, we observed a significant decrease in colony diameter in the si-NC-transfected group and untreated group (P < 0.01, Fig. 3c, d). Additionally, by using a colony formation assay, we demonstrated that circ_0002770 knockdown resulted in a remarkable decrease in the colony formation rate in both A375 and SKMel1 cells (P < 0.01, Fig. 3e, f). These findings suggested that silencing circ_0002770 led to the melanoma cell proliferation suppression in A375 and SKMel1 cells.
Fig. 3

Knockdown of circ_0002770 inhibited melanoma cell proliferation.

a, b The colony number per field was significantly downregulated in si-circ_0002770-transfected A375 and SKMel1 cells. c, d The colony diameter was obviously smaller in the si-circ_0002770 group. e, f Knockdown of circ_0002770 dramatically decreased the colony formation rate of si-circ_0002770-transfected A375 and SKMel1 cells. Scale bars, 50 μm, **P < 0.01.

Knockdown of circ_0002770 inhibited melanoma cell proliferation.

a, b The colony number per field was significantly downregulated in si-circ_0002770-transfected A375 and SKMel1 cells. c, d The colony diameter was obviously smaller in the si-circ_0002770 group. e, f Knockdown of circ_0002770 dramatically decreased the colony formation rate of si-circ_0002770-transfected A375 and SKMel1 cells. Scale bars, 50 μm, **P < 0.01.

Knockdown of circ_0002770 inhibited melanoma tumor growth in vivo

Based on the above in vitro conclusions, we further investigated the role of circ_0002770 in melanoma tumor growth in vivo. Untreated A375 cells and cells stably transfected with si-NC or si-circ_0002770 were subcutaneously injected into nude mice for 5, 10, 15, 20, 25, 30, and 35 days. Silencing of circ_0002770 sharply decreased the tumor volume and weight compared to those in the untreated group and si-NC group (P < 0.05, Fig. 4a, b). Tumors were then cut into 35 μm sections and stained with Ki-67 to estimate the effects of circ_0002770 knockdown on tumor cell proliferation. The results showed that the Ki-67 staining intensity of tissues from the si-circ_0002770 group was dramatically weaker than that of tissues from the untreated and si-NC groups (P < 0.05, Fig. 4c). We also estimated the effects of circ_0002770 on tumor growth in vivo by using SKMel1 cells. Consistent with the previous findings, tumors formed by the si-circ_0002770-transfected SKMel1 cells were significantly smaller than those formed by untreated or si-NC-transfected SKMel1 cells (P < 0.05, Fig. 4d, e). Additionally, the Ki-67 staining score in the si-circ_0002770 group was also significantly reduced compared to that in the untreated and si-NC groups (P < 0.05, Fig. 4f).
Fig. 4

Knockdown of circ_0002770 suppressed melanoma tumor growth in vivo.

a, b The volume and weight of tumors formed by si-circ_0002770-transfected A375 cells were strongly decreased compared with those formed by si-NC-transfected A375 cells. c The Ki-67 staining score of si-circ_0002770-transfected A375 cells was lower than that of the si-NC group. d, e The volume and weight of tumors formed by si-circ_0002770-transfected SKMel1 cells were strongly decreased compared with those formed by si-NC-transfected SKMel1 cells. f The Ki-67 staining score of si-circ_0002770 SKMel1 cells was lower than that of the si-NC group. Scale bars, 50 μm, *P < 0.05.

Knockdown of circ_0002770 suppressed melanoma tumor growth in vivo.

a, b The volume and weight of tumors formed by si-circ_0002770-transfected A375 cells were strongly decreased compared with those formed by si-NC-transfected A375 cells. c The Ki-67 staining score of si-circ_0002770-transfected A375 cells was lower than that of the si-NC group. d, e The volume and weight of tumors formed by si-circ_0002770-transfected SKMel1 cells were strongly decreased compared with those formed by si-NC-transfected SKMel1 cells. f The Ki-67 staining score of si-circ_0002770 SKMel1 cells was lower than that of the si-NC group. Scale bars, 50 μm, *P < 0.05.

Circ_0002770 negatively modulated miR-331-3p

Studies have determined that circRNAs act as miRNA sponges in various cells; therefore, we screened the potential target miRNAs of circ_0002770 through bioinformatics analysis (Circular RNA interactome). 12 miRNAs were predicted to have binding sites with circ_0002770, including miR-1248, 197, 331-3p, 338-3p, 513a-3p, 548g, 556-3p, 578, 607, 634, 640, 875-5p. To further validate the target miRNAs of circ_0002770, a qRT-PCR was peroformed by trasfection of si-circ_0002770 or si-NC in melanoma cells and miR-331-3p exhibited the highest alteration (Fig. 5a). Transfection of si-circ_0002770 resulted in a dramatic downregulation of circ-0002770 in A375 cells (P < 0.05, Fig. 5b). In addition, the miR-331-3p sequence was conserved among species (Fig. 5c). Moreover, a dramatic upregulation of miR-331-3p was observed in si-circ_0002770-transfected A375 cells (P < 0.05, Fig. 5d). Bioinformatics analysis revealed a miR-331-3p binding site in circ_0002770 (Fig. 5e). The expression of miR-331-3p in A375 cells was gradually downregulated with the increased concentration of the circ_0002770 plasmid in transfected cells (Fig. 5f). To verify whether circ_0002770 could physically interact with miR-331-3p, RNA pulldown and AGO2 RIP assay were performed in A375 cells. More than six-fold enrichment of circ_0002770 was observed in the bio-miR-331-3p captured fraction compared with the bio-miR-NC group (P < 0.001, Fig. 5g); however, no enrichment of circ_0002770 was observed in the bio-miR-331-3p mut group (P < 0.001, Fig. 5i, j). Accordingly, in the AGO2 RIP assay, we observed a significant enrichment in the AGO2/IP fraction in the miR-331-3p group compared to that in the miR-NC group (P < 0.001, Fig. 5h); however, the miR-331-3p-induced enrichment in the AGO2/IP fraction was abolished when the complementary sequences of miR-331-3p were mutated (P < 0.001, Fig. 5k).
Fig. 5

Circ_0002770 negatively regulated miR-331-3p.

a The change level of 12 miRNAs (predicted by circular RNA interactome) by circ_0002770 transfection. U6 as internal control in each group. Color coding represents the mean level of miRNAs (n = 3). b Circ_0002770 was significantly downregulated in si-circ_0002770-transfected A375 cells compared to the si-NC group. c Conservation of miR-331-3p. d miR-331-3p was dramatically upregulated in si-circ_0002770-transfected A375 cells compared to the si-NC group. e Sequence of the complementary site between miR-331-3p and circ_0002770. f Relative expression of miR-331-3p was significantly downregulated with the increase in circ_0002770 concentration. g Circ_0002770 was pulled down by the specific biotin-labeled miR-331-3p probe. h The AGO2 IP/IgG IP ratio was increased in miR-331-3p-transfected A375 cells. i Sequences of wild-type and mutant miR-313-3p. j Circ_0002770 was pulled down by the biotin-miR-331-3p probe but not the biotin-miR-NC probe. k The AGO2 IP/IgG IP ratio was increased in miR-331-3p- but not miR-331-3p mut-transfected A375 cells. *P < 0.05, ***P < 0.001.

Circ_0002770 negatively regulated miR-331-3p.

a The change level of 12 miRNAs (predicted by circular RNA interactome) by circ_0002770 transfection. U6 as internal control in each group. Color coding represents the mean level of miRNAs (n = 3). b Circ_0002770 was significantly downregulated in si-circ_0002770-transfected A375 cells compared to the si-NC group. c Conservation of miR-331-3p. d miR-331-3p was dramatically upregulated in si-circ_0002770-transfected A375 cells compared to the si-NC group. e Sequence of the complementary site between miR-331-3p and circ_0002770. f Relative expression of miR-331-3p was significantly downregulated with the increase in circ_0002770 concentration. g Circ_0002770 was pulled down by the specific biotin-labeled miR-331-3p probe. h The AGO2 IP/IgG IP ratio was increased in miR-331-3p-transfected A375 cells. i Sequences of wild-type and mutant miR-313-3p. j Circ_0002770 was pulled down by the biotin-miR-331-3p probe but not the biotin-miR-NC probe. k The AGO2 IP/IgG IP ratio was increased in miR-331-3p- but not miR-331-3p mut-transfected A375 cells. *P < 0.05, ***P < 0.001.

The circ_0002770/miR-331-3p axis regulated melanoma cell proliferation and invasion

We then examined the effects of miR-331-3p overexpression on melanoma cell proliferation and invasion through colony formation and transwell experiments. The colony formation results indicated that miR-331-3p overexpression sharply decreased the colony number of both A375 and SKMel1 cells compared to that of the miR-NC group (P < 0.001, Fig. 6a, c). In the transwell assay, a dramatic reduction in invasive cell number was observed in miR-331-3p-overexpressing A375 and SKMel1 cells compared to miR-NC-treated cells (P < 0.001, Fig. 6b, d). Since miR-331-3p overexpression exhibited similar effects to those of circ_0002770 knockdown on melanoma cells, we wondered whether miR-331-3p inhibition could reverse the effects of si-circ_0002770 on melanoma cells. By cotransfecting A375 cells with si-circ_0002770 and miR-331-3p inhibitor, we demonstrated that si-circ_0002770-induced downregulation of colony formation was abolished (P < 0.001, Fig. 6e). Additionally, in the transwell assay, we revealed that circ_0002770 knockdown caused a reduction in invasive cell number that was reversed in A375 cells cotransfected with si-circ_0002770 and miR-331-3p inhibitor (P < 0.001, Fig. 6f). These findings suggested that the miR-331-3p inhibitor could reverse the suppressive effects of circ_0002770 knockdown on A375 cell proliferation and invasion. Similar conclusions were obtained in SKMel1 cells (P < 0.001, Fig. 6g, h).
Fig. 6

The circ_0002770/miR-331-3p axis regulated melanoma cell proliferation and invasion.

a, b Overexpression of miR-331-3p inhibited A375 cell proliferation and invasion. c, d Overexpression of miR-331-3p inhibited SKMel1 cell proliferation and invasion. e, f Inhibition of miR-331-3p abolished the suppressive effect of si-circ_0002770 on A375 cell proliferation and invasion. g, h Inhibition of miR-331-3p abolished the suppressive effect of si-circ_0002770 on SKMel1 cell proliferation and invasion. Scale bars, 50 μm, ***P < 0.001.

The circ_0002770/miR-331-3p axis regulated melanoma cell proliferation and invasion.

a, b Overexpression of miR-331-3p inhibited A375 cell proliferation and invasion. c, d Overexpression of miR-331-3p inhibited SKMel1 cell proliferation and invasion. e, f Inhibition of miR-331-3p abolished the suppressive effect of si-circ_0002770 on A375 cell proliferation and invasion. g, h Inhibition of miR-331-3p abolished the suppressive effect of si-circ_0002770 on SKMel1 cell proliferation and invasion. Scale bars, 50 μm, ***P < 0.001.

Circ_0002770 indirectly regulated DUSP5 and TGFBR1 through miR-331-3p

Based on the prediction results by TargetScan, we obtained a putative list of target genes of miR-331-3p. KEGG analysis revealed that the three signaling pathways with the highest scores included the MAPK signaling pathway (Supplementary Fig. S2A). Then, we constructed ceRNA networks (Supplementary Fig. S2B). Among MAPK signaling pathway factors, we focused on the complementary site between DUSP5 or TGFBR1 and miR-331-3p (Supplementary Fig. S2C, Fig. 7a). First, we examined the regulatory relationship between DUSP5 or TGFBR1 and miR-331-3p through qRT-PCR. Compared to the miR-NC group, miR-331-3p overexpression led to a remarkable downregulation of the mRNAs of both DUSP5 and TGFBR1 in A375 and SKMel1 cells (P < 0.05, Fig. 7b, c). By performing a luciferase reporter assay, we validated the interplay between miR-331-3p and DUSP5 or TGFBR1 in A375 and SKMel1 cells. The luciferase activity was dramatically attenuated only in the miR-331-3p+DUSP-wt and miR-331-3p + TGFBR1-wt treated groups (Fig. 7d). Accordingly, Western blot analysis indicated that miR-331-3p overexpression resulted in a significant downregulation of DUSP5 and TGFBR1 proteins in A375 and SKMel1 cells (P < 0.05, Fig. 7e–g). Additionally, we found that the mRNA levels of DUSP5 and TGFBR1 were remarkably decreased in si-circ_0002770-transfected A375 and SKMel1 cells, and their expression could be restored by the transfection of miR-331-3p inhibitor (P < 0.05, Fig. 7h, i). Similarly, Western blot analysis showed that the protein expression levels of DUSP5 and TGFBR1 were also significantly decreased in si-circ_0002770-transfected A375 and SKMel1 cells, and miR-331-3p inhibitor transfection abolished the downregulation of DUSP5 and TGFBR1 induced by si-circ_0002770 (P < 0.05, Fig. 7j–m). These findings demonstrated the presence of the circ_0002770-miR-331-3p-DUSP5/TGFBR1 axis in melanoma cells.
Fig. 7

Circ_0002770 indirectly regulated DUSP5 and TGFBR1 through miR-331-3p.

a Sequences of the complementary site between miR-331-3p and the 3′-UTRs of DUSP5 and TGFBR1. b, c Relative mRNA expression of DUSP5 and TGFBR1 was sharply downregulated in A375 and SKMel1 cells transfected with miR-331-3p mimics. d Luciferase activity was remarkably attenuated by the cotransfection of miR-331-3p and 3′-UTR wt plasmids. e–g Western blot analysis showed that the protein expression levels of DUSP5 and TGFBR1 were decreased in miR-331-3p-overexpressing A375 and SKMel1 cells. h, i Circ_0002770 knockdown-induced downregulation of DUSP5 and TGFBR1 mRNAs was reversed by cotransfection with si-circ_0002770 and miR-331-3p inhibitor. j–m Circ_0002770 knockdown-induced downregulation of DUSP5 and TGFBR1 proteins was abrogated by cotransfection with si-circ_0002770 and miR-331-3p inhibitor. *P < 0.05.

Circ_0002770 indirectly regulated DUSP5 and TGFBR1 through miR-331-3p.

a Sequences of the complementary site between miR-331-3p and the 3′-UTRs of DUSP5 and TGFBR1. b, c Relative mRNA expression of DUSP5 and TGFBR1 was sharply downregulated in A375 and SKMel1 cells transfected with miR-331-3p mimics. d Luciferase activity was remarkably attenuated by the cotransfection of miR-331-3p and 3′-UTR wt plasmids. e–g Western blot analysis showed that the protein expression levels of DUSP5 and TGFBR1 were decreased in miR-331-3p-overexpressing A375 and SKMel1 cells. h, i Circ_0002770 knockdown-induced downregulation of DUSP5 and TGFBR1 mRNAs was reversed by cotransfection with si-circ_0002770 and miR-331-3p inhibitor. j–m Circ_0002770 knockdown-induced downregulation of DUSP5 and TGFBR1 proteins was abrogated by cotransfection with si-circ_0002770 and miR-331-3p inhibitor. *P < 0.05.

Discussion

In China, melanoma accounts for less than 4% of all skin tumors but is responsible for more than 80% of skin cancer-related deaths[17]. The greatest challenge in melanoma therapy is the relatively low response to currently available treatment modalities[18]. Chemotherapy fails to dramatically improve the prognosis of melanoma patients due to the resistance of melanoma cells to chemotherapy drugs and toxic side effects[19]. To develop more efficient treatment modalities for melanoma patients, it is essential to understand the regulation of melanoma progression. CircRNAs have been shown to regulate melanoma cell proliferation, metastasis, and invasion through diverse molecular mechanisms[20,21], indicating that circRNAs could be critical regulators of melanoma. Circ_0002770 is a recently identified circRNA that originated from a well-known oncogene, the MDM2 gene. Evidence from both in vitro and in vivo studies has shown that MDM2 is often overexpressed in human tumors and is correlated with tumor grade and prognosis[22,23]. Moreover, MDM2 could not only repress p53 transactivation of its target genes but also mediate its degradation[24,25]. The MDM2/p53 pathway was revealed to be involved in the regulation of melanoma tumor progression[26,27]. Recently, circ_0002770 was reported to be dramatically increased in melanoma without functional examination[14]. In our study, we found that circ_0002770 was sharply increased in melanoma tissues and cells. In vitro, silencing of circ_0002770 inhibited melanoma cell proliferation, invasion and migration. Similarly, knockdown of circ_0002770 in vivo suppressed melanoma tumor growth. Overall, circ_0002770 was shown be an oncogene of melanoma. The circRNA-miRNA-mRNA axis is one of most common molecular mechanisms by which circRNAs exert their function in cancer regulation, including in melanoma[21]. For instance, Bian D et al. reported that a novel circRNA, circ_0025039, facilitated melanoma cell growth, invasion and glucose metabolism by directly regulating CDK4 through interaction with miR-198[28]. Additionally, circ_0016418 was revealed to be an oncogene in melanoma through the miR-625/YY1 cascade[29]. MiR-331-3p was previously reported to participate in the modulation of tumor growth in various human tumors; however, its effects can be opposite in different tumors. For example, miR-331-3p was revealed to be dramatically downregulated in colorectal cancer and to act as a tumor repressor of colorectal cancer by targeting HER2 through the PI3K/Akt cascade[30]. In contrast, miR-331-3p was found to be increased in pancreatic cancer and to function as an oncogene in pancreatic cancer[31]. However, the role of miR-331-3p in melanoma remains undetermined. In this study, circ_0002770 was demonstrated to act as a sponge of miR-331-3p, and circ_0002770 could negatively regulate the expression of miR-331-3p in melanoma cells. Additionally, a miR-331-3p inhibitor was found to reverse the suppressive effects of circ_0002770 knockdown on A375 cell proliferation and invasion. Furthermore, we demonstrated that DUSP5 and TGFBR1 are two direct target genes of miR-331-3p, and circ_0002770 could indirectly regulate DUSP5 and TGFBR1 through miR-331-3p in melanoma cells. In conclusion, our findings suggest that circ_0002770 functions as an oncogene in melanoma by indirectly regulating the expression of DUSP5 and TGFBR1 through miR-331-3p, indicating that circ_0002770 might be a promising therapeutic target of melanoma. While the goal of this study was to better understand circ_0002770 function in melanoma, future research is required to explore the role of circ_0002770 in other cancer types and address the therapeutic potential of modulating circ_0002770.

Materials and methods

Melanoma tissues and cell lines

A total of twenty pairs of melanoma tumor and normal tissue specimens were provided by the First Affiliated Hospital of Zhengzhou University. All tissues were subjected to qRT-PCR analysis. Research protocols were approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University, and all patients provided written informed consent before enrolling. Tissues were stored at −80 °C until use. Normal human epidermal melanocytes (NHEM) and melanoma cell lines (SKMEL1, A375 and A875) were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Cells were grown in DMEM (Gibco, Thermo-Fisher, USA) supplemented with 10% fetal bovine serum (FBS, Sigma, USA) in a 5% CO2 humidified environment.

Quantitative real-time PCR (RT-PCR) assay

TRIzol reagent (Takara, Japan) was employed to prepare total RNA from melanoma tissues and cells, followed by concentration examination using a NanoDrop 2000c (Thermo Scientific, USA). Then, cDNA was synthesized from total RNA (3 μg) using a cDNA synthesis kit (Takara). The reverse transcripts were amplified by qRT-PCR on the ABI 7500 system (ABI Biosystems, USA) using Bestar qPCR MasterMix (DBI Bioscience). The relative level of expression of miRNAs was normalized to the internal control (U6) using the 2−ΔCt cycle threshold method. The primers used in the present study are shown in Table 1.
Table 1

The sequences of all primers in the RT-PCR experiment of this study.

GenePrimers
Forward (5′–3′)Reverse (5′–3′)
GAPDHTGTTCGTCATGGGTGTGAACATGGCATGGACTGTGGTCAT
Circ_0002770GTATCAGGCAGGGGAGAGTGACACAGAGCCAGGCTTTCAT
MiR-331-3pGCCTGGCCCCTGGGCCTATCGTGCAGGGTCCGAGGT
MDM2GGGAGATATGTTGTGAAAGAAGCCCCTGCCTGATACACAGTAACTT
TGFBR1GAACTGTTTTGATTGGCATCAAGAAGGGACCTACACTATTT
DUSP5CTCACCTCGCTGCTGGCCTGTCTGGCCTCTTTCACCTTCGAGCTTCTC
U6CTCGCTTCG GCAGCACAAACGCTTCACGAATTTGCGT
The sequences of all primers in the RT-PCR experiment of this study.

Cell transfection

All oligonucleotides, including negative control siRNA (si-NC), circ_0002770 siRNA (si-circ_0002770), circ_0002770 overexpression plasmid, miRNA negative control (miR-NC), miR-331-3p mimics and miR-331-3p inhibitor, were designed and provided by RiboBio (Shanghai, China). For cell transfection, A375 and SKMel1 cells were plated into 6-well plates and cultured until approximately 80% confluence, and then the indicated 50 nM oligonucleotides, siRNAs or constructs were transfected into cells by using Lipofectamine 3000 (Invitrogen), according to the manufacturer’s protocol.

Wound-healing assay

Treated A375 and SKMel1 cells (3000 cells/per dish) in exponential growth phase were harvested and seeded into 35-mm glass dishes. Cells were cultured in an incubator at 37 °C until 100% confluence. A sterile pipette tip was used to make a straight wound on the surface of A375 and SKMel1 cells. Images were acquired after 0 and 24 h of wounding, and the width of the wound was examined under a microscope.

Transwell assay

Transwell chambers coated with (40 μl of 2 mg/ml Matrigel) or without Matrigel (Becton, Dickinson and Company, USA) were used to estimate the migratory or invasive abilities, respectively, of A375 and SKMel1 cells. Culture medium without or with FBS was added to the upper or lower chambers, respectively. Transfected A375 and SKMel1 cells were harvested and seeded into the upper chamber followed by incubation at 37 °C in a cell incubator for 24 h. Then, the bottom of the chamber was washed with precooled PBS, and the cells were fixed with 4% paraformaldehyde. After 10 min incubation with 0.5% crystal violet, the number of invasive or migratory cells was counted under a microscope at 10× magnification (Nikon, Japan).

Three-dimensional (3D) cell culture

Culture medium containing one thousand treated melanoma cells (A375 and SKMel1) and 4% Matrigel (BD Bioscience) was added into 96-well plates, which were placed at 37 °C in a cell incubator with 5% CO2. Matrigel-containing medium was renewed every 2 days until the assay was terminated after two weeks.

Colony formation assay

Transfected A375 and SKMel1 cells were uniformly dispersed and seeded on six-well plates at a concentration of 3 × 104 cells per well. After culturing at 37 °C in an incubator with 5% CO2 for 14 days, visible colonies were fixed in 10% formaldehyde (Sigma, USA) followed by staining with 1% crystal violet (Sigma) for 10 min. Next, colonies were washed with precooled PBS three times and then counted manually.

In vivo tumor growth assay

All animal experiments were subject to approval by the Institutional Review Board of the First Affiliated Hospital of Zhengzhou University (Zhengzhou, China). Nude male mice, eight weeks old, were kept in the animal room with a twelve-hour day and night cycle. 1 × 106 untreated A375 and SKMel1 cells or A375 and SKMel1 cells stably expressing si-NC or si-circ_0002770 were subcutaneously injected into nude mice randomly for 5, 10, 15, 20, 25, 30, and 35 days. The mice were sacrificed at the end of treatment (day 35) to harvest tumors and tumor volume and weight were measured. Anatomical tumors were subjected to subsequent detection of cell proliferation using Ki-67 staining. The animal study in this study was blinding.

Ki-67 staining

The anatomical tumors were fixed in paraffin and then cut into 4 μm sections by using a freezing microtome. Tissue sections were subjected to nonspecific blockade with 10% donkey serum for 2 h. Next, sections were incubated with anti-Ki-67 antibody (1:500, ab15580, Abcam) overnight, followed by incubation with HRP-conjugated secondary antibody for 2 h.

RNA pulldown assay

A375 cells (1 × 106) seeded in 6-well plates were transfected with biotinylated miR-331-3p (biotin-miR-331-3p) or its mutant (biotin-miR-NC) using Lipofectamine 3000 (Invitrogen). After 24 h of transfection, the cells were collected and centrifuged. Next, the pellets were resuspended in lysis buffer containing protease inhibitors. The cytoplasmic lysates were prepared by centrifugation. Cell lysates were then incubated with bovine serum albumin (Sigma) on the treated beads for 4 h. Finally, RNAs in the beads fraction were extracted with TRIzol and examined with qRT-PCR assay.

RNA immunoprecipitation assay (RIP)

A375 cells were transfected with miR-331-3p mimics or miR-NC for 48 h, and cytoplasmic lysates containing protease inhibitors (Roche) were subjected to immunoprecipitation (IP). AGO2-miRNA complexes were used for IP with a control IgG for 4 h. RNAs bound to the beads were separated using phenol-chloroform extraction (Ambion) and then subjected to ethanol precipitation. Extracted RNAs were examined by qRT-PCR analysis.

Dual luciferase reporter assay

The wild-type and mutant fragments of DUSP5 and TGFBR1 containing the specific miR-331-3p binding sites were amplified and subcloned into the luciferase vector psi-CHECK (Promega, USA) and then named DUSP5 wt/TGFBR1 wt and DUSP5 mut/TGFBR1 mut. A375 cells (1 × 106) were plated into 24-well plates and cultured at 37 °C overnight. Then, cells were cotransfected with DUSP5 wt/TGFBR1 wt or DUSP5 mut/TGFBR1 mut and miR-NC or miR-331-3p mimics using Lipofectamine 3000 (Invitrogen). Luciferase activities were detected by the Dual Luciferase Reporter Assay System (Promega, WI, USA) after 48 h of cotransfection.

Western blot analysis

Total proteins were obtained from treated melanoma cells using RIPA buffer and then subjected to protein quantification using a BCA kit (Pierce). Equal protein samples (50 μg) were loaded into and isolated by 10% SDS-PAGE and then transferred to polyvinylidene fluoride membranes. The nonspecific binding sites in the membranes were blocked by incubating with TBST solution containing 5% milk for 2 h. After washing with PBS three times, the membranes were incubated with primary antibodies against DUSP5 (1:1000, ab200708, Abcam), TGFBR1 (1:1000, ab235178, Abcam) and GAPDH (1:10000, sc420485, Santa Cruz) overnight at 4 °C. On the following day, membranes were washed with PBS again three times and then incubated with HRP-conjugated secondary antibodies (1:2000, 4412S, Santa Cruz) for 2 h. Protein bands were detected by an Odyssey infrared imaging system (LI-COR).

MiRNA targets prediction of circ_0002770

We predicted the specifically binding sites of circ_0002770 interacting with miRNA by using bioinformatic database Circular RNA interactome (https://circinteractome.nia.nih.gov/index.html).

Statistical analysis

Data from the present study are presented as the means ± standard deviation. SPSS (version 20.0, SPSS, Chicago, USA) was employed to analyze the differences between groups using Student’s t-test or one-way ANOVA. A P value less than 0.05 was regarded as statistically significant. Supplementary Figures
  2 in total

Review 1.  [Circular RNA in human disease and their potential clinic significance].

Authors:  Yonghua Chen; Cheng Li; Chunlu Tan; Gang Mai; Xubao Liu
Journal:  Zhonghua Yi Xue Yi Chuan Xue Za Zhi       Date:  2017-02-10

Review 2.  The circRNA-microRNA code: emerging implications for cancer diagnosis and treatment.

Authors:  Lorena Verduci; Sabrina Strano; Yosef Yarden; Giovanni Blandino
Journal:  Mol Oncol       Date:  2019-02-18       Impact factor: 6.603

  2 in total
  11 in total

1.  Hsa_circ_0026416 promotes proliferation and migration in colorectal cancer via miR-346/NFIB axis.

Authors:  Yahang Liang; Jingbo Shi; Qingsi He; Guorui Sun; Lei Gao; Jianhong Ye; Xiaolong Tang; Hui Qu
Journal:  Cancer Cell Int       Date:  2020-10-12       Impact factor: 5.722

2.  Differentially Expressed Circular RNAs and Their Therapeutic Mechanism in Non-segmental Vitiligo Patients Treated With Methylprednisolone.

Authors:  Jiaqi Zhang; Ning Liang; Yan Cao; Min Li
Journal:  Front Med (Lausanne)       Date:  2022-05-16

3.  The circSPON2/miR-331-3p axis regulates PRMT5, an epigenetic regulator of CAMK2N1 transcription and prostate cancer progression.

Authors:  Bing Yao; Sha Zhu; Xiyi Wei; Ming-Kun Chen; Yangkun Feng; Zhimin Li; Xinyu Xu; Yuwei Zhang; Yang Wang; Jingwan Zhou; Ningyuan Tang; Chengjian Ji; Peng Jiang; Shan-Chao Zhao; Chao Qin; Ninghan Feng
Journal:  Mol Cancer       Date:  2022-05-27       Impact factor: 41.444

4.  Circular RNA as a Potential Biomarker for Melanoma: A Systematic Review.

Authors:  Keyun Tang; Hanlin Zhang; Yaqi Li; Qiuning Sun; Hongzhong Jin
Journal:  Front Cell Dev Biol       Date:  2021-04-01

5.  CircRNA_Maml2 promotes the proliferation and migration of intestinal epithelial cells after severe burns by regulating the miR-93-3p/FZD7/Wnt/β-catenin pathway.

Authors:  Wenwen Zhang; Yu Liao; Jiaqi Lou; Mengmeng Zhuang; Hao Yan; Qi Li; Yuequ Deng; Xiaohu Xu; Dandan Wen; Yong Sun
Journal:  Burns Trauma       Date:  2022-03-07

6.  In Vivo miRNA Decoy Screen Reveals miR-124a as a Suppressor of Melanoma Metastasis.

Authors:  Rana S Moubarak; Lisa Koetz-Ploch; Gavriel Mullokandov; Avital Gaziel; Ana de Pablos-Aragoneses; Diana Argibay; Kevin Kleffman; Elena Sokolova; Marianne Berwick; Nancy E Thomas; Iman Osman; Brian D Brown; Eva Hernando
Journal:  Front Oncol       Date:  2022-04-04       Impact factor: 5.738

Review 7.  Squaring the circle: circRNAs in melanoma.

Authors:  Nicol Mecozzi; Olga Vera; Florian A Karreth
Journal:  Oncogene       Date:  2021-07-30       Impact factor: 9.867

8.  Circ_0013359 facilitates the tumorigenicity of melanoma by regulating miR-136-5p/RAB9A axis.

Authors:  Qi Zhang; Yingfa Feng; Jiangang Feng; Jinming Zhang; Lili Huang
Journal:  Open Life Sci       Date:  2021-05-22       Impact factor: 0.938

9.  Long Non-coding RNA MSTRG.24008.1 Regulates the Regeneration of the Sciatic Nerve via the miR-331-3p-NLRP3/MAL Axis.

Authors:  Gang Yin; Ying Peng; Yaofa Lin; Peilin Wang; Zhuoxuan Li; Renyuan Wang; Haodong Lin
Journal:  Front Cell Dev Biol       Date:  2021-06-04

10.  circITCH suppresses cell proliferation and metastasis through miR-660/TFCP2 pathway in melanoma.

Authors:  Jianfei Zhang; Yanlin Cai; Shunliang Sheng; Congling Zhao; Bin Jiang
Journal:  Cancer Med       Date:  2022-03-10       Impact factor: 4.711

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.