During kidney development, WNT/β-catenin signalling has to be tightly controlled to ensure proliferation and differentiation of nephron progenitor cells. Here, we show in mice that the signalling molecules RSPO1 and RSPO3 act in a functionally redundant manner to permit WNT/β-catenin signalling and their genetic deletion leads to a rapid decline of nephron progenitors. By contrast, tissue specific deletion in cap mesenchymal cells abolishes mesenchyme to epithelial transition (MET) that is linked to a loss of Bmp7 expression, absence of SMAD1/5 phosphorylation and a concomitant failure to activate Lef1, Fgf8 and Wnt4, thus explaining the observed phenotype on a molecular level. Surprisingly, the full knockout of LGR4/5/6, the cognate receptors of R-spondins, only mildly affects progenitor numbers, but does not interfere with MET. Taken together our data demonstrate key roles for R-spondins in permitting stem cell maintenance and differentiation and reveal Lgr-dependent and independent functions for these ligands during kidney formation.
During kidney development, WNT/β-catenin signalling has to be tightly controlled to ensure proliferation and differentiation of nephron progenitor cells. Here, we show in mice that the signalling molecules RSPO1 and RSPO3 act in a functionally redundant manner to permit WNT/β-catenin signalling and their genetic deletion leads to a rapid decline of nephron progenitors. By contrast, tissue specific deletion in cap mesenchymal cells abolishes mesenchyme to epithelial transition (MET) that is linked to a loss of Bmp7 expression, absence of SMAD1/5 phosphorylation and a concomitant failure to activate Lef1, Fgf8 and Wnt4, thus explaining the observed phenotype on a molecular level. Surprisingly, the full knockout of LGR4/5/6, the cognate receptors of R-spondins, only mildly affects progenitor numbers, but does not interfere with MET. Taken together our data demonstrate key roles for R-spondins in permitting stem cell maintenance and differentiation and reveal Lgr-dependent and independent functions for these ligands during kidney formation.
Nephron endowment is a critical factor for renal health and low number of nephrons have been associated with chronic kidney disease and hypertension (Bertram et al., 2011). In mammals, nephrogenesis is restricted to the developmental period and involves a dedicated nephrogenic niche at the most cortical region of the forming kidney that fuels successive rounds of nephron production (McMahon, 2016; Oxburgh, 2018; O'Brien, 2019). The nephrogenic niche consists of three independent progenitor populations that will develop into collecting ducts, stroma (interstitial cells) and nephrons. Nephron progenitor cells (NPCs) form a condensed cap around the tips of the branching ureter. This cap mesenchyme (CM) can be further subdivided into populations that represent cells of progressive differentiation status depending on the position along their migration trajectories around the ureteric tips. Analysis over the last decade have identified at least four different subpopulations: 1) CITED1+/SIX2+ that are considered as ‘ground-state’ progenitors; 2) CITED1-/SIX2+ progenitors; 3) primed CITED1-/SIX2+/pSMAD+ progenitors; 4) WNT4+/LEF1+ pretubular aggregates (PTA). Once engaged, PTAs undergo a mesenchyme to epithelial transition (MET) to form epithelialized renal vesicles, which will further differentiate via comma- and S-shaped bodies into segmented nephrons. This traditional view of a molecular and spatial subdivision of the CM has been challenged by findings that nephron progenitor cells (NPCs) are much more mobile than previously appreciated. Indeed, NPCs have been observed to travel back and forth between caps of independent tips (Combes et al., 2016) and between the pretubular aggregate and cap mesenchyme state (Lawlor et al., 2019).The transformation of nephron progenitors into epithelialized nephrons is not an entirely cell-intrinsic process, but requires inductive signals from both the ureteric tip and stromal cells (O'Brien, 2019). Of particular importance is WNT9b, a molecule released from the branching ureter that induces canonical WNT/β-catenin signalling, stimulates proliferation and thus ensures self-renewal of kidney progenitors. Accordingly, deletion of β–catenin leads to the loss of progenitor cells (Karner et al., 2011). However, canonical WNT signalling is also required for MET (Carroll et al., 2005) and transient activation of β–catenin in isolated progenitors induces epithelialisation (Park et al., 2007; Kuure et al., 2007; Park et al., 2012). How the balance between progenitor proliferation and differentiation is achieved is not well understood, but experimental evidence suggests that progenitor proliferation requires low levels of β-catenin activity, whereas genes that are involved in MET are activated in the presence of a strong canonical β-catenin signal (Ramalingam et al., 2018). In the context of nephrogenesis, a strong β-catenin response appears to rely on the activation of canonical BMP/SMAD pathway, as progenitor cells leaving the niche are positive for pSMAD and deletion of Bmp7 interferes with MET (Brown et al., 2013).WNT/β-catenin signalling is essential for many organ systems and multiple feedback mechanisms have been identified that control signalling strength at almost every level of this signal transduction pathway. WNT receptor availability at the cell membrane is controlled by RNF43 and ZNRF3, two trans-membrane E3 ubiquitin ligases that induce receptor endocytosis and thus negatively regulate WNT signalling. Their action is counteracted by R-spondins (RSPO1-4), a family of secreted molecules that bind to the G-protein-coupled receptors LGR4/5/6. Binding to LGRs permits R-spondins to interact with RNF43/ZNRF3 and suppress endocytosis of the WNT receptor complex, thus enhancing WNT signalling (de Lau et al., 2014).In this study, we investigated a potential role of the R-spondin/LGR axis in controlling renal stem/progenitor behaviour in vivo. We show that Rspo1 and Rspo3 are required to maintain the pool of renal progenitors throughout development by supporting their proliferative capacity and preventing their apoptosis. Moreover, strong R-spondin signal is essential to allow nephron progenitors to engage in differentiation and undergo MET. RSPO1/3 achieve these functions by their ability to activate the WNT/β−catenin signalling pathway, a role that is primarily mediated in an LGR-independent manner.
Results
R-spondins are dynamically expressed during kidney development
To understand the role of R-spondins during kidney development in mice, we first mapped the expression of the four members of this gene family using qPCR and in situ hybridisation analysis. Although Rspo2 and Rspo4 were undetectable in developing kidneys (Figure 1—figure supplement 1A—source data 1), Rspo1 and Rspo3 could be found as early as E10.5 within SIX2+ renal progenitors (Figure 1—figure supplements 1B and Motamedi et al., 2014). Interestingly, Rspo3 marked only a proportion of SIX2 positive cells, suggesting this population to be heterogeneous already at this early age (Figure 1—figure supplement 1B). At E14.5, Rspo1 was detected throughout the CM, PTA, within renal vesicles, and the proximal part of the comma- and S-shaped bodies, but decreased upon podocyte differentiation (Figure 1A and Figure 1—figure supplement 1C). By contrast, Rspo3 expression was restricted to uncommitted SIX2+ cells (Figure 1B and Figure 1—figure supplement 1B–C), and what appeared to be low levels of expression within the cortical stroma (Figure 1—figure supplement 1C). Indeed, expression within the most cortical population of stromal cells persisted in animals that carry a CM-specific deletion of Rspo3 (Six2:Cre, Rspo3) (Figure 1—figure supplement 1C). Interestingly, by E18.5 Rspo3 was dramatically reduced in NPCs, but strongly expressed in the cortical stromal compartment (Figure 1Bii), indicating a shift of expression towards the stroma. Strong Rspo3 signal was also detected in stromal cells lining ducts of the renal papilla (Figure 1Biii).
Figure 1—figure supplement 1.
R-spondin expression analysis during kidney development.
(A) qPCR analysis on wildtype (Ctrl Kidney), Rspo1-/- (R1 Ko), CAGG:CreER (R3 Ko) and on CAGG:CreER-/-, Rspo3 (R1 R3 Dbl Ko). For the conditional Rspo3 allele, Tam induction was performed at E11.5 and kidneys were collected at E14.5. Data are expressed as fold change to highly expressing tissues (lung for Rspo2, kidney for Rspo3 and nail for Rspo4). In wildtype kidneys, strong Rspo3 expression was detected. By contrast, Rspo2 and Rspo4 showed little or no amplification, respectively. Tamoxifen-induced activation efficiently deleted Rspo3. No compensatory upregulation of family members was observed. A one-way ANOVA test was performed. Analysis was performed on kidney pairs isolated from three mouse embryos (n = 3) for all samples except for (R1 R3 Dbl Ko) n = 2. See Figure 1—figure supplement 1—source data 1. (B) Rspo3 is expressed in a subset of SIX2+ nephron progenitors. In situ hybridisation (ISH) analysis carried out on wildtype embryonic kidneys followed by immunofluorescent analysis. (C) In situ hybridisation (ISH) on E14.5 kidney sections prepared from control (Ctrl) and Six2:Cre, Rspo3 animals. Immunofluorescence (IF) staining with anti-SIX2 antibodies was achieved on same sections to identify renal progenitors (red). ISH and IF signals were overlaid (green and red, respectively). Expression patterns within the nephrogenic niche are schematized to the right of the panel. Note the persistence of Rspo3 expression in stromal cells upon progenitor-specific deletion (Six2-Cre, Rspo3 animals).
Worksheet 1 : Quantification of Rspo2 expression in controls and Rspo1 and Rspo3 mutants kidneys.
Worksheet 2: Quantification of Rspo3 expression in controls and Rspo1 and Rspo3 mutants kidneys.
Worksheet 3: Quantification of Rspo4 expression in controls and Rspo1 and Rspo3 mutants kidneys.
Figure 1.
Rspo1 and Rspo3 are expressed in embryonic kidneys and are required for normal development.
(A) RNA-Scope analysis demonstrates Rspo1 (i) and Rspo3 (iii) expression in the nephrogenic zone of developing (E14.5) kidneys. (B) RNA-Scope analysis followed by immunostaining for the progenitor marker SIX2 reveals a switch from strong Rspo3 expression within progenitors at E14.5 (i) to almost exclusively stromal progenitor expression at E18.5 (ii). In addition, strong staining was found within medullary stromal cells (iii). Hoechst stains nuclei in blue (C) Schematic outline of tamoxifen induction for CAGG:CreER-mediated deletion leading to a complete loss of R-spondin expression in the Rspo1/Rspo3 double mutant (DM). Colour legend: Purple for Rspo1+, pink for Rspo3+, dark red for Rspo1/Rspo3+ cells. Rspo depleted cells are dark grey, light grey highlights ureteric cells. (D) Macroscopic view of the urogenital system of Control and CAGG:CreER embryos dissected at E18.5, (E). Hematoxylin and Eosin (Hand E) staining of E14.5 sections reveals smaller kidneys virtually lacking nephrons. A: adrenal gland, B: bladder, K: kidney, O: ovary, T: testis. CAGG:CreERTM-DM stands for (CAGG:CreERTM, Rspo1-/-, Rspo3fl/fl), Ctrl: Control.
(A) qPCR analysis on wildtype (Ctrl Kidney), Rspo1-/- (R1 Ko), CAGG:CreER (R3 Ko) and on CAGG:CreER-/-, Rspo3 (R1 R3 Dbl Ko). For the conditional Rspo3 allele, Tam induction was performed at E11.5 and kidneys were collected at E14.5. Data are expressed as fold change to highly expressing tissues (lung for Rspo2, kidney for Rspo3 and nail for Rspo4). In wildtype kidneys, strong Rspo3 expression was detected. By contrast, Rspo2 and Rspo4 showed little or no amplification, respectively. Tamoxifen-induced activation efficiently deleted Rspo3. No compensatory upregulation of family members was observed. A one-way ANOVA test was performed. Analysis was performed on kidney pairs isolated from three mouse embryos (n = 3) for all samples except for (R1 R3 Dbl Ko) n = 2. See Figure 1—figure supplement 1—source data 1. (B) Rspo3 is expressed in a subset of SIX2+ nephron progenitors. In situ hybridisation (ISH) analysis carried out on wildtype embryonic kidneys followed by immunofluorescent analysis. (C) In situ hybridisation (ISH) on E14.5 kidney sections prepared from control (Ctrl) and Six2:Cre, Rspo3 animals. Immunofluorescence (IF) staining with anti-SIX2 antibodies was achieved on same sections to identify renal progenitors (red). ISH and IF signals were overlaid (green and red, respectively). Expression patterns within the nephrogenic niche are schematized to the right of the panel. Note the persistence of Rspo3 expression in stromal cells upon progenitor-specific deletion (Six2-Cre, Rspo3 animals).
Worksheet 1 : Quantification of Rspo2 expression in controls and Rspo1 and Rspo3 mutants kidneys.
Worksheet 2: Quantification of Rspo3 expression in controls and Rspo1 and Rspo3 mutants kidneys.
Worksheet 3: Quantification of Rspo4 expression in controls and Rspo1 and Rspo3 mutants kidneys.
Expression patterns are labeled as follows. Rspo1 (only) = violet; stromal progenitor specific Rspo3 = light pink; nephron progenitor specific Rspo3 = dark red. Structures in dark grey represent cells that are depleted for Rspo1 and/or Rspo3. The branching collecting duct is depicted in light grey.
(A) Schematic outline of the experimental strategy. CAGG:CreER was activated by Tam at E11.5 and kidneys analyzed at E14.5. (B) Analysis of compound knockouts indicates that single gene deletion has only mild effects on progenitor survival and kidney formation. Dramatic loss of progenitors occurs when both genes are lost. Immunolabelling for RALDH1A2 (stromal cells in green), CITED1 (progenitors in red) and JAG1 (median segment of RV), comma/S-shaped bodies = white). Nuclei were counterstained with Hoechst (blue).
Rspo1 and Rspo3 are expressed in embryonic kidneys and are required for normal development.
(A) RNA-Scope analysis demonstrates Rspo1 (i) and Rspo3 (iii) expression in the nephrogenic zone of developing (E14.5) kidneys. (B) RNA-Scope analysis followed by immunostaining for the progenitor marker SIX2 reveals a switch from strong Rspo3 expression within progenitors at E14.5 (i) to almost exclusively stromal progenitor expression at E18.5 (ii). In addition, strong staining was found within medullary stromal cells (iii). Hoechst stains nuclei in blue (C) Schematic outline of tamoxifen induction for CAGG:CreER-mediated deletion leading to a complete loss of R-spondin expression in the Rspo1/Rspo3 double mutant (DM). Colour legend: Purple for Rspo1+, pink for Rspo3+, dark red for Rspo1/Rspo3+ cells. Rspo depleted cells are dark grey, light grey highlights ureteric cells. (D) Macroscopic view of the urogenital system of Control and CAGG:CreER embryos dissected at E18.5, (E). Hematoxylin and Eosin (Hand E) staining of E14.5 sections reveals smaller kidneys virtually lacking nephrons. A: adrenal gland, B: bladder, K: kidney, O: ovary, T: testis. CAGG:CreERTM-DM stands for (CAGG:CreERTM, Rspo1-/-, Rspo3fl/fl), Ctrl: Control.
R-spondin expression analysis during kidney development.
(A) qPCR analysis on wildtype (Ctrl Kidney), Rspo1-/- (R1 Ko), CAGG:CreER (R3 Ko) and on CAGG:CreER-/-, Rspo3 (R1 R3 Dbl Ko). For the conditional Rspo3 allele, Tam induction was performed at E11.5 and kidneys were collected at E14.5. Data are expressed as fold change to highly expressing tissues (lung for Rspo2, kidney for Rspo3 and nail for Rspo4). In wildtype kidneys, strong Rspo3 expression was detected. By contrast, Rspo2 and Rspo4 showed little or no amplification, respectively. Tamoxifen-induced activation efficiently deleted Rspo3. No compensatory upregulation of family members was observed. A one-way ANOVA test was performed. Analysis was performed on kidney pairs isolated from three mouse embryos (n = 3) for all samples except for (R1 R3 Dbl Ko) n = 2. See Figure 1—figure supplement 1—source data 1. (B) Rspo3 is expressed in a subset of SIX2+ nephron progenitors. In situ hybridisation (ISH) analysis carried out on wildtype embryonic kidneys followed by immunofluorescent analysis. (C) In situ hybridisation (ISH) on E14.5 kidney sections prepared from control (Ctrl) and Six2:Cre, Rspo3 animals. Immunofluorescence (IF) staining with anti-SIX2 antibodies was achieved on same sections to identify renal progenitors (red). ISH and IF signals were overlaid (green and red, respectively). Expression patterns within the nephrogenic niche are schematized to the right of the panel. Note the persistence of Rspo3 expression in stromal cells upon progenitor-specific deletion (Six2-Cre, Rspo3 animals).
Quantitative analysis of all R-spondin genes expression inRspo1andRspo3mutant kidneys.
Worksheet 1 : Quantification of Rspo2 expression in controls and Rspo1 and Rspo3 mutants kidneys.Worksheet 2: Quantification of Rspo3 expression in controls and Rspo1 and Rspo3 mutants kidneys.Worksheet 3: Quantification of Rspo4 expression in controls and Rspo1 and Rspo3 mutants kidneys.
Schematic outline of the different genetic approaches used in this study.
Expression patterns are labeled as follows. Rspo1 (only) = violet; stromal progenitor specific Rspo3 = light pink; nephron progenitor specific Rspo3 = dark red. Structures in dark grey represent cells that are depleted for Rspo1 and/or Rspo3. The branching collecting duct is depicted in light grey.
Rspo1 and Rspo3 are functionally redundant.
(A) Schematic outline of the experimental strategy. CAGG:CreER was activated by Tam at E11.5 and kidneys analyzed at E14.5. (B) Analysis of compound knockouts indicates that single gene deletion has only mild effects on progenitor survival and kidney formation. Dramatic loss of progenitors occurs when both genes are lost. Immunolabelling for RALDH1A2 (stromal cells in green), CITED1 (progenitors in red) and JAG1 (median segment of RV), comma/S-shaped bodies = white). Nuclei were counterstained with Hoechst (blue).
RSPO1 and RSPO3 are essential to maintain the pool of kidney progenitors
Lack of Rspo1 is compatible with life (Chassot et al., 2008) and kidneys isolated from knockout mice showed no discernible abnormalities (data not shown). Mice carrying a constitutive deletion of Rspo3 die at E9.5 due to placental defects (Aoki et al., 2007; Kazanskaya et al., 2008). To overcome this early lethality, we employed a conditional allele for Rspo3 (Rspo3) (Rocha et al., 2015) in combination with a range of Cre-expressing lines (Figure 1—figure supplement 2). Tamoxifen (Tam) induction at E11.5 in presence of the ubiquitously expressed CAGG:CreER driver (Hayashi and McMahon, 2002) efficiently abolished Rspo3 expression 3 days after induction (E14.5) (Figure 1—figure supplement 1A) and resulted in a mild reduction of progenitor cells (Figure 1—figure supplement 3B). To test whether Rspo1 and Rspo3 may act in a functionally redundant manner, we induced deletion at E11.5 and analysed the renal phenotype at E14.5 and E18.5 in double mutant animals (CAGG:CreER - from now on called DM). Depletion was efficient, and no compensatory up-regulation of Rspo2 or Rspo4 was detected in double mutant kidneys (Figure 1—figure supplement 1A). Macroscopic observation at E18.5 showed severe renal hypoplasia in R-spondinDM, when compared to control littermates (Figure 1C,D). Hematoxylin and Eosin (H&E) staining of kidneys at E14.5 indicated a reduced nephrogenic zone and a near-complete absence of nephrons (Figure 1E). Molecular analysis confirmed a dramatic loss of SIX2+ progenitors and an absence of forming nephrons (Figure 2A). The remaining SIX2-positive cells appeared scattered, when compared to the condensed mesenchyme seen in controls. A similar loss of NPCs was observed when R-spondin deletion was induced at E10.5, E12.5 or E13.5 indicating a continuous requirement of these signalling molecules for the maintenance of the NPC pool (data not shown). To test whether the reduction of progenitors was caused by defects in proliferation or apoptosis, we next quantified BrdU incorporation and TUNEL staining (Figure 2B–C; Figure 2—source data 1; Figure 2—figure supplement 1B,C). In order to measure early events of R-spondin deletion within progenitors, we allowed the first wave of nephrons to form, TAM-induced CRE activity at E12.5 and analysed samples 2 days thereafter. Quantification of BrdU-labelled SIX2+ progenitors indicated a 40% reduction of proliferation in this compartment (p=0.0003) (Figure 2B). In addition, a significant 8.1 fold increase of apoptosis among the SIX2+ cells located in the CM was observed (p=0.0319) (Figure 2C).
Figure 1—figure supplement 2.
Schematic outline of the different genetic approaches used in this study.
Expression patterns are labeled as follows. Rspo1 (only) = violet; stromal progenitor specific Rspo3 = light pink; nephron progenitor specific Rspo3 = dark red. Structures in dark grey represent cells that are depleted for Rspo1 and/or Rspo3. The branching collecting duct is depicted in light grey.
Figure 1—figure supplement 3.
Rspo1 and Rspo3 are functionally redundant.
(A) Schematic outline of the experimental strategy. CAGG:CreER was activated by Tam at E11.5 and kidneys analyzed at E14.5. (B) Analysis of compound knockouts indicates that single gene deletion has only mild effects on progenitor survival and kidney formation. Dramatic loss of progenitors occurs when both genes are lost. Immunolabelling for RALDH1A2 (stromal cells in green), CITED1 (progenitors in red) and JAG1 (median segment of RV), comma/S-shaped bodies = white). Nuclei were counterstained with Hoechst (blue).
Figure 2.
R-spondins are required for renal progenitor maintenance.
(A) Immunofluorescent analysis at E14.5 (induced at E11.5) reveals loss of SIX2+ progenitor cells and nascent nephrons (comma or S-shaped bodies) in CAGG:CreER embryos. (WT1 = green; SIX2 = red; DBA = white; Hoechst = blue). Colour legend for the cartoon: Purple label Rspo1+, pink Rspo3+, dark red Rspo1/Rspo3+ cells. Rspo depleted cells are dark grey, light grey highlights ureteric cells. (B) Quantification of BrdU-labelled SIX2+ progenitors performed on four embryos (n = 4) demonstrates a significant reduction of proliferation 2 days after Rspo3 deletion. See Figure 2—source data 1 (C) TUNEL analysis reveals a dramatic increase in apoptosis (n = 3 embryos for each genotype, two litters). (D) Progenitor specific deletion of β-catenin (Six2:Cre; Ctnnb1) results in the loss of progenitor cells at E14.5 (SIX2 = red; CDH1 = green; JAG1 = white). (E). Quantification of SIX2+ progenitors (n = 4 embryos for each genotype isolated from two litters). See Figure 2—source data 1. Columns are means ± SEM with p<0.05 (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****). One black dot = average value for one control embryo, one black square = average value for one CAGG:CreER embryo.
Worksheet 1 - source data for Figure 2B: Quantification of proliferating (BrdU+) progenitor cells (SIX2+) in controls and CAGGCreER.
Worksheet 2 - source data for Figure 2C: Quantification of apoptotic (TUNEL+) progenitor cells (SIX2+) in controls and CAGGCreER.
Worksheet 3 - source data for Figure 2E: Quantification of progenitor cells (SIX2+) in controls and mutant (Six2:Cre, Ctnnb1 ) samples.
(A) Schematic outline of the experimental strategy. To detect early events the CAGG:CreERTM was activated by Tam induction at E12.5, pregnant female received a BrdU injection and were sacrificed 2 hr later at E14.5. B) Representative images for the BrdU labelling quantification used in Figure 2B. Proliferating progenitors were immunodetected with SIX2 (green) and BrdU (red) antibodies. Nuclei were counter stained with Hoechst (blue). (C) Representative images for the TUNEL labelling quantification used in Figure 2C. Cells undergoing apoptosis were labeled with TUNEL assay (red), progenitors were stained with anti-SIX2 (green) antibodies. (D) RNAScope analysis demonstrates reduced Axin2 expression (pink and red signal) in the nephrogenic zone of developing kidney CAGG:CreER mutants (E14.5). Cell nuclei were counterstained with Hematoxylin.
Figure 2—figure supplement 1.
Proliferation and apoptosis analysis.
(A) Schematic outline of the experimental strategy. To detect early events the CAGG:CreERTM was activated by Tam induction at E12.5, pregnant female received a BrdU injection and were sacrificed 2 hr later at E14.5. B) Representative images for the BrdU labelling quantification used in Figure 2B. Proliferating progenitors were immunodetected with SIX2 (green) and BrdU (red) antibodies. Nuclei were counter stained with Hoechst (blue). (C) Representative images for the TUNEL labelling quantification used in Figure 2C. Cells undergoing apoptosis were labeled with TUNEL assay (red), progenitors were stained with anti-SIX2 (green) antibodies. (D) RNAScope analysis demonstrates reduced Axin2 expression (pink and red signal) in the nephrogenic zone of developing kidney CAGG:CreER mutants (E14.5). Cell nuclei were counterstained with Hematoxylin.
R-spondins are required for renal progenitor maintenance.
(A) Immunofluorescent analysis at E14.5 (induced at E11.5) reveals loss of SIX2+ progenitor cells and nascent nephrons (comma or S-shaped bodies) in CAGG:CreER embryos. (WT1 = green; SIX2 = red; DBA = white; Hoechst = blue). Colour legend for the cartoon: Purple label Rspo1+, pink Rspo3+, dark red Rspo1/Rspo3+ cells. Rspo depleted cells are dark grey, light grey highlights ureteric cells. (B) Quantification of BrdU-labelled SIX2+ progenitors performed on four embryos (n = 4) demonstrates a significant reduction of proliferation 2 days after Rspo3 deletion. See Figure 2—source data 1 (C) TUNEL analysis reveals a dramatic increase in apoptosis (n = 3 embryos for each genotype, two litters). (D) Progenitor specific deletion of β-catenin (Six2:Cre; Ctnnb1) results in the loss of progenitor cells at E14.5 (SIX2 = red; CDH1 = green; JAG1 = white). (E). Quantification of SIX2+ progenitors (n = 4 embryos for each genotype isolated from two litters). See Figure 2—source data 1. Columns are means ± SEM with p<0.05 (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****). One black dot = average value for one control embryo, one black square = average value for one CAGG:CreER embryo.
Worksheet 1 - source data for Figure 2B: Quantification of proliferating (BrdU+) progenitor cells (SIX2+) in controls and CAGGCreER.Worksheet 2 - source data for Figure 2C: Quantification of apoptotic (TUNEL+) progenitor cells (SIX2+) in controls and CAGGCreER.Worksheet 3 - source data for Figure 2E: Quantification of progenitor cells (SIX2+) in controls and mutant (Six2:Cre, Ctnnb1 ) samples.
Proliferation and apoptosis analysis.
(A) Schematic outline of the experimental strategy. To detect early events the CAGG:CreERTM was activated by Tam induction at E12.5, pregnant female received a BrdU injection and were sacrificed 2 hr later at E14.5. B) Representative images for the BrdU labelling quantification used in Figure 2B. Proliferating progenitors were immunodetected with SIX2 (green) and BrdU (red) antibodies. Nuclei were counter stained with Hoechst (blue). (C) Representative images for the TUNEL labelling quantification used in Figure 2C. Cells undergoing apoptosis were labeled with TUNEL assay (red), progenitors were stained with anti-SIX2 (green) antibodies. (D) RNAScope analysis demonstrates reduced Axin2 expression (pink and red signal) in the nephrogenic zone of developing kidney CAGG:CreER mutants (E14.5). Cell nuclei were counterstained with Hematoxylin.As R-spondins are known activators of Wnt/β-catenin signalling, we analysed the expression of Axin2, a direct downstream target and read-out of canonical β–catenin signalling. Ubiquitous deletion of R-spondins caused a general downregulation of Axin2 already 2 days after tamoxifen induction, an observation consistent with a loss of WNT/β–catenin signalling (Figure 2—figure supplement 1D). Progenitor-specific deletion of β-catenin (Six2:Cre; Ctnnb1 phenocopied the Rspo1/3 DM phenotype with a dramatic reduction (93%; p<0.0001) of SIX2+ progenitor cells and a near-complete block of nephron formation as indicated by an almost complete absence of the nephron specific marker JAG1 (Figure 2D and E; Figure 2—source data 1). Taken together these data indicate a requirement of R-spondins for nephron progenitor maintenance via the activation of canonical β-catenin signalling.
Stromal Rspo3 maintains nephron progenitors during late stages of kidney development
Rspo3 is produced by both, stromal and nephron progenitors, but at later stages expression shifts to a predominantly stromal expression (compare Figure 1Bi with Figure 1Bii). To evaluate the contribution of stromally derived RSPO3, on kidney development, we specifically depleted its expression in this compartment using the constitutively active Foxd1:Cre line. In this context, progenitor cells were the only source of RSPO3 (Figure 3A and Figure 1—figure supplement 2). At E14.5, Foxd1:Cre-DM kidneys appeared normal and showed a comparable number of SIX2+ cells per section when compared to control littermates (p=0.7887; Figure 3C; Figure 3—source data 1 and data not shown). By contrast, at E18.5 mutant kidneys were hypoplastic (Figure 3B) and displayed a reduction of the nephrogenic zone associated with a significant loss of SIX2+ progenitor cells (p=0.0167) (Figure 3D–F; Figure 3—source data 1). We conclude that continuous expression of Rspo3 from the stromal compartment is required to maintain progenitor cells at later stages of kidney formation.
Figure 3.
Stromal RSPO3 maintains the pool of renal progenitors at late stages of kidney development.
(A) Schematic outline of the strategy used for stromal-specific deletion of Rspo3 in the absence of Rspo1. (B) Macroscopic view of urogenital systems at E18.5 reveals smaller kidneys in Foxd1:Cre-DM mutants when compared to control littermates. (C) Quantification of SIX2+ progenitors reveals no significant difference in the number of progenitors between mutant and control kidneys at E14.5 (n = 4 embryos for each genotype, one litter), see Figure 3—source data 1 (D) but a more than 50% decrease by E18.5 (n = 3 embryos for each genotype, two litters), see Figure 3—source data 1. (E) H and E staining of kidney sections at E18.5 shows a reduction of the nephrogenic zone (double arrowed black lines). (F) IF analysis using anti-CDH1 (green) anti-SIX2 (red), and anti-NPHS1 (marks podocytes in white) antibody reveals a loss of progenitors. Nuclei were counterstained with Hoechst (blue). A: adrenal gland, B: bladder, K: kidney, O: ovary. Columns are means ± SEM with p<0.05 (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****). Foxd1:Cre-DM stands for (Foxd1:Cre, Rspo1-/-, Rspo3fl/fl) double mutant, Ctrl: Control.
Worksheet 1 - source data for Figure 3C: Quantification of progenitor cells (SIX2+) in controls and Foxd1:Cre-DM at E14.5.
Worksheet 2 - source data for Figure 3D: Quantification of progenitor cells (SIX2+) in controls and Foxd1:Cre-DM at E18.5.
Stromal RSPO3 maintains the pool of renal progenitors at late stages of kidney development.
(A) Schematic outline of the strategy used for stromal-specific deletion of Rspo3 in the absence of Rspo1. (B) Macroscopic view of urogenital systems at E18.5 reveals smaller kidneys in Foxd1:Cre-DM mutants when compared to control littermates. (C) Quantification of SIX2+ progenitors reveals no significant difference in the number of progenitors between mutant and control kidneys at E14.5 (n = 4 embryos for each genotype, one litter), see Figure 3—source data 1 (D) but a more than 50% decrease by E18.5 (n = 3 embryos for each genotype, two litters), see Figure 3—source data 1. (E) H and E staining of kidney sections at E18.5 shows a reduction of the nephrogenic zone (double arrowed black lines). (F) IF analysis using anti-CDH1 (green) anti-SIX2 (red), and anti-NPHS1 (marks podocytes in white) antibody reveals a loss of progenitors. Nuclei were counterstained with Hoechst (blue). A: adrenal gland, B: bladder, K: kidney, O: ovary. Columns are means ± SEM with p<0.05 (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****). Foxd1:Cre-DM stands for (Foxd1:Cre, Rspo1-/-, Rspo3fl/fl) double mutant, Ctrl: Control.
Progenitors quantification inFoxd1:Cre-DMat E14.5 and E18.5.
Worksheet 1 - source data for Figure 3C: Quantification of progenitor cells (SIX2+) in controls and Foxd1:Cre-DM at E14.5.Worksheet 2 - source data for Figure 3D: Quantification of progenitor cells (SIX2+) in controls and Foxd1:Cre-DM at E18.5.
RSPO1 and RSPO3 are required for mesenchyme-to-epithelial transition
To test the role of progenitor-released R-spondins, we used a constitutively active progenitor specific Cre-line (Six2:Cre) to delete expression of Rspo3 in this cell compartment. Consequently, in Rspo1mice (Six2:Cre-DM), stromal Rspo3 is the only remaining R-spondin (Figure 4A and Figure 1—figure supplement 2). At E18.5 Six2:Cre-DM embryos had hypodysplastic kidneys that histologically displayed defects in nephrogenesis and a complete absence of glomeruli (Figure 4B). Histological and immunofluorescent analysis of E14.5 kidneys confirmed this observation and revealed the persistence of SIX2+ progenitors albeit at slightly lower numbers (Figure 4C and Figure 4—figure supplement 1B). Importantly, staining for JAG1 and WT1 demonstrated a complete absence of epithelial nephrons and podocytes, respectively, indicating an essential role for R-spondin1/3 in nephron differentiation.
Figure 4.
Absence of R-spondins from progenitors causes lack of MET and downregulation of β-catenin target genes.
(A) Schematic outline of the strategy used for progenitor-specific deletion of Rspo3. Six2:Cre-DM stands for (Six2:Cre, Rspo1 (B) Macroscopic view reveals smaller kidneys (K) in mutant E18.5 embryos. H and E staining reveals a complete absence of glomeruli (compare iii and iv). (C) Immunolabelling for SIX2 (red), WT1 (green) and JAG1 (white) revealed a mild reduction of progenitors and confirmed the lack of nephrons on the molecular level (D). In situ hybridization performed on E14.5 embryos revealed persistence of Wnt9b expression, but dramatic reduction of class I (Wnt4) and class II (Bmp7, Tfrc, Slc12a) β-catenin target genes in the nephrogenic lineage. Dotted white lines highlight the ureter and orange lines outline the CM compartment. (E) Quantification with RNA-Scope technology combined with Halo software analysis shows a reduction of Axin2 expression by 51% in the nephrogenic zone of mutant kidneys compared to control (p<0.0001). (n = 4 embryos isolated from four litters for control genotype, and n = 7 embryos isolated from six litters for mutant genotype). Each dot or square represents the total RNAScope signal detected per nephrogenic area normalised to the total number of cells present in this field. See Figure 4—source data 1. Columns are means ± SEM with p<0.05 (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****).
(A) Schematic outline of the experimental strategy. (B) H and E staining of E14.5 kidney sections reveals an absence of forming nephrons. (C) Wnt9b Class II target genes are reduced upon nephron progenitor specific depletion of Rspo3. Ureteric tips are outlined with a dashed white line, the cap mesenchyme with an orange line. (D) RNA-Scope analysis demonstrates reduced Axin2 expression in the nephrogenic zone of developing kidney Six2:Cre-DM mutants (E14.5). Axin2 probe was detected with a chromogenic substrate (pink colour) that fluorescences (red signal). Nuclei were counterstained with Hematoxylin and with Hoechst (blue).
Figure 4—figure supplement 1.
Analysis of progenitor-specific deletion reveals a requirement of R-Spondins for MET.
(A) Schematic outline of the experimental strategy. (B) H and E staining of E14.5 kidney sections reveals an absence of forming nephrons. (C) Wnt9b Class II target genes are reduced upon nephron progenitor specific depletion of Rspo3. Ureteric tips are outlined with a dashed white line, the cap mesenchyme with an orange line. (D) RNA-Scope analysis demonstrates reduced Axin2 expression in the nephrogenic zone of developing kidney Six2:Cre-DM mutants (E14.5). Axin2 probe was detected with a chromogenic substrate (pink colour) that fluorescences (red signal). Nuclei were counterstained with Hematoxylin and with Hoechst (blue).
Absence of R-spondins from progenitors causes lack of MET and downregulation of β-catenin target genes.
(A) Schematic outline of the strategy used for progenitor-specific deletion of Rspo3. Six2:Cre-DM stands for (Six2:Cre, Rspo1 (B) Macroscopic view reveals smaller kidneys (K) in mutant E18.5 embryos. H and E staining reveals a complete absence of glomeruli (compare iii and iv). (C) Immunolabelling for SIX2 (red), WT1 (green) and JAG1 (white) revealed a mild reduction of progenitors and confirmed the lack of nephrons on the molecular level (D). In situ hybridization performed on E14.5 embryos revealed persistence of Wnt9b expression, but dramatic reduction of class I (Wnt4) and class II (Bmp7, Tfrc, Slc12a) β-catenin target genes in the nephrogenic lineage. Dotted white lines highlight the ureter and orange lines outline the CM compartment. (E) Quantification with RNA-Scope technology combined with Halo software analysis shows a reduction of Axin2 expression by 51% in the nephrogenic zone of mutant kidneys compared to control (p<0.0001). (n = 4 embryos isolated from four litters for control genotype, and n = 7 embryos isolated from six litters for mutant genotype). Each dot or square represents the total RNAScope signal detected per nephrogenic area normalised to the total number of cells present in this field. See Figure 4—source data 1. Columns are means ± SEM with p<0.05 (*), p<0.01 (**), p<0.001 (***), p<0.0001 (****).
Analysis of progenitor-specific deletion reveals a requirement of R-Spondins for MET.
(A) Schematic outline of the experimental strategy. (B) H and E staining of E14.5 kidney sections reveals an absence of forming nephrons. (C) Wnt9b Class II target genes are reduced upon nephron progenitor specific depletion of Rspo3. Ureteric tips are outlined with a dashed white line, the cap mesenchyme with an orange line. (D) RNA-Scope analysis demonstrates reduced Axin2 expression in the nephrogenic zone of developing kidney Six2:Cre-DM mutants (E14.5). Axin2 probe was detected with a chromogenic substrate (pink colour) that fluorescences (red signal). Nuclei were counterstained with Hematoxylin and with Hoechst (blue).The above phenotype is reminiscent of defects seen in mutants for Wnt9b, a signalling molecule that is released from the branching ureter. WNT9b activity has been shown to activate two classes of β–catenin dependent genes: Class II genes that require lower levels of β–catenin signalling and are found predominantly in nephron progenitors; Class I genes such as Wnt4 that depend on strong β–catenin activation and are highly expressed in pretubular aggregates (Karner et al., 2011; Ramalingam et al., 2018). In situ hybridisation (ISH) analysis revealed that loss of R-spondins did not impact Wnt9b expression (Figure 4Di and ii), but dramatically reduced the expression of Class II (Bmp7, Tfrc, Crym1, Uncx4, Etv5 and Slc12a) target genes within progenitors (Figure 4D and Figure 4—figure supplement 1C). Interestingly, Tfrc was absent from mesenchymal cells, but was maintained to be expressed in the ureteric epithelium suggesting that progenitor-specific R-spondin expression is dispensable for its activation in the collecting duct system. The class I target Wnt4, a key regulator of MET (Stark et al., 1994), was also undetectable within the nephrogenic zone, but remained expressed in medullary stromal cells (Figure 4D ix and x). Consistent with a requirement of R-spondins for β-catenin activation, the direct downstream target Axin2 was 51% down regulated in the nephrogenic zone of mutant kidneys (p<0.0001, Figure 4E; Figure 4—source data 1 and Figure 4—figure supplement 1D).Six2:Cre-DM kidneys showed a small reduction of nephron progenitors (Figure 4C). To exclude the possibility that the lower number of progenitors interfered with the MET process, we employed the Wt1:CreER strain (Figure 5A), which in response to Tamoxifen activation, induced deletion primarily within nephron progenitors (Figure 1—figure supplement 2 and Figure 5—figure supplement 1). Wt1:CreER embryos kidneys contained large numbers of SIX2+ progenitors (Figure 5Bi and ii) that failed to differentiate. Indeed, expression of LEF1, a direct target and interaction partner of β-catenin that is also a marker of committed pretubular aggregates, was virtually absent from the nephrogenic region of Rspo1/3 double mutant mice (Figure 5Biii and iv). Six2:Cre and Wt1:CreER driven deletion thus showed a very similar phenotype. The higher number of progenitors in WT1:CreER-induced mutants is likely due to less efficient deletion of Rspo3 and, as a consequence, persistence of slightly higher levels of R-spondin activity.
Figure 5.
R-spondins are required for MET induction.
(A) Schematic outline of the strategy used for Wt1:CreER induced deletion of Rspo3. Wt1:CreER (B) i and ii) Immunolabelling revealed lack of nephrogenesis upon Wt1:CreER induced deletion of R-spondins, despite the persistence of large numbers of SIX2+ (red) nephron progenitors and FOXD1+ (blue) stroma progenitors (CDH1 = green). iii and iv) Staining for LEF1 (red) and WT1 (green) confirmed the lack of nephrogenesis (C) Schematic representation of the methodology followed to isolate and grow kidney progenitors in vitro. (D) Comparison of Axin2 or Wnt4 gene expression levels in nephron progenitors treated by recombinant protein WNT3a (50 ng/ml) or RSPO3 (200 ng/ml) alone, WNT3a and RSPO3 in combination or CHIR (3µM) alone as an internal positive control. Experiments were performed as triplicates (n = 3). Compared to control, addition of RSPO3 + WNT3A leads to a 2.3 fold and 4.6 fold increase of Axin2 and Wnt4 expression respectively, see Figure 5—source data 1. (E). Immunohistochemical analysis for pSMAD1/5 demonstrated the lack of nephron progenitor priming (black arrowhead). Note the persistence of pSMAD staining in medullary stroma (black asterisk). In the inset, black lines outline the ureter and dotted lines the CM compartment. (F) Quantification of progenitors that are pSMAD1/5+ reveals a highly significant reduction of SMAD1/5 phosphorylation in mutant compared to control kidneys at E14.5 (n = 4 embryos for each genotype, 3 and 4 litters for control and mutant respectively), see Figure 5—source data 1.
Worksheet 1 - source data for Figure 5D: Quantification of RNA expression in in vitro culture experiments. Worksheet 2 – source data for Figure 5F: Quantification of pSMAD1/5 positive cells within the nephrogenic zone.
(A) Schematic outline of the experimental strategy. (B) In situ hybridization analysis using an Rspo3 anti-sense probe reveals persistence of Rspo3 in stromal cells.
Figure 5—figure supplement 1.
Wt1:CreER induced deletion leads to reduced Rspo3 expression.
(A) Schematic outline of the experimental strategy. (B) In situ hybridization analysis using an Rspo3 anti-sense probe reveals persistence of Rspo3 in stromal cells.
R-spondins are required for MET induction.
(A) Schematic outline of the strategy used for Wt1:CreER induced deletion of Rspo3. Wt1:CreER (B) i and ii) Immunolabelling revealed lack of nephrogenesis upon Wt1:CreER induced deletion of R-spondins, despite the persistence of large numbers of SIX2+ (red) nephron progenitors and FOXD1+ (blue) stroma progenitors (CDH1 = green). iii and iv) Staining for LEF1 (red) and WT1 (green) confirmed the lack of nephrogenesis (C) Schematic representation of the methodology followed to isolate and grow kidney progenitors in vitro. (D) Comparison of Axin2 or Wnt4 gene expression levels in nephron progenitors treated by recombinant protein WNT3a (50 ng/ml) or RSPO3 (200 ng/ml) alone, WNT3a and RSPO3 in combination or CHIR (3µM) alone as an internal positive control. Experiments were performed as triplicates (n = 3). Compared to control, addition of RSPO3 + WNT3A leads to a 2.3 fold and 4.6 fold increase of Axin2 and Wnt4 expression respectively, see Figure 5—source data 1. (E). Immunohistochemical analysis for pSMAD1/5 demonstrated the lack of nephron progenitor priming (black arrowhead). Note the persistence of pSMAD staining in medullary stroma (black asterisk). In the inset, black lines outline the ureter and dotted lines the CM compartment. (F) Quantification of progenitors that are pSMAD1/5+ reveals a highly significant reduction of SMAD1/5 phosphorylation in mutant compared to control kidneys at E14.5 (n = 4 embryos for each genotype, 3 and 4 litters for control and mutant respectively), see Figure 5—source data 1.
Quantification ofWnt4andAxin2expression in progenitors cultured in vitro and quantification of pSMAD1/5+progenitors inSix2:Cre-DMkidneys.
Worksheet 1 - source data for Figure 5D: Quantification of RNA expression in in vitro culture experiments. Worksheet 2 – source data for Figure 5F: Quantification of pSMAD1/5 positive cells within the nephrogenic zone.
Wt1:CreER induced deletion leads to reduced Rspo3 expression.
(A) Schematic outline of the experimental strategy. (B) In situ hybridization analysis using an Rspo3 anti-sense probe reveals persistence of Rspo3 in stromal cells.Isolated NPCs can be induced to undergo MET when cultured under high-density conditions and stimulated with chiron (CHIR99021), an inducer of canonical β-catenin signalling. To test whether R-spondins can replace chemical inducers under such in vitro conditions, we treated freshly isolated NPCs with recombinant WNT3A, RSPO3 or a combination of both (Figure 5C; Figure 5—source data 1). Gene expression analysis after 48 hr revealed a 2.3-fold and 4.6-fold increase for the β-catenin targets Axin2 and Wnt4, respectively, after combined treatment (Figure 5D). Interestingly, treatment with recombinant WNT3A alone did not have an effect suggesting that WNT/β-catenin signalling is actively suppressed in this cell type and crucially requires R-spondin action to permit activation of this pathway (Figure 5D).Commitment of renal progenitors to nephron differentiation involves canonical BMP7 signalling, which allows cells to fully respond to the WNT/β−catenin pathway and undergo MET (Brown et al., 2013). In situ hybridization indicated a dramatic downregulation of Bmp7 in Six2:Cre-DM kidneys (Figure 4D). Canonical BMP signalling induces phosphorylation of SMAD1/5 and we therefore evaluated the phosphorylation status of this signal transducer. Whereas progenitors in control kidneys that engaged in MET were positive for pSMAD1/5 (Figure 5E), the nephrogenic zone in Six2:Cre-DM kidneys showed a 88% reduction of staining (p<0.0001; Figure 5F; Figure 5—source data 1). pSMAD staining in medullary stroma was not affected by this deletion. Taken together these data demonstrate that R-spondins are required for Bmp7 activation, which in turn permits priming of renal progenitors for MET.
LGRs are dispensable for MET
R-spondins act by associating and internalising the ubiquitin E3 ligases ZNRF3/RNF43. Expression analysis using RNA-Scope demonstrated RNF43 to be specifically expressed within the branching ureter, whereas ZNRF3 showed a more widespread expression pattern, covering also the nephrogenic niche (Figure 6—figure supplement 1). R-spondin interaction with ZNRF3/RNF43 is believed to be primarily mediated via binding to their cognate receptors LGR4-6 and mutations in Lgr4 or Lgr4/5 have been shown to have mild defects in kidney development (Kato et al., 2006; Dang et al., 2014; Kinzel et al., 2014). To determine to what extent RSPO1/3 activity in kidney development depends on the LGR receptor family we mapped their expression using RNA-Scope analysis. Lgr4 showed the broadest expression pattern with mRNA detected in virtually all cell types of the developing kidney (Figure 6A). Particularly, strong staining was found in the distal part of comma shaped bodies that extended into the intermediate segment at the S-shaped body stage. In addition, we detected strong staining in medullary stromal cells that line the developing ureter. Lgr5 mRNA was virtually absent from the CM, but could be found within ureteric tips, a proportion of medullary stroma cells and the distal segment of S-shaped bodies, as previously reported using a lacZ reporter strain (Barker et al., 2012). Lgr6 mRNA showed the most restricted expression pattern and could only be detected in PTAs of forming nephrons (Figure 6A).
Figure 6—figure supplement 1.
RNF43 and ZNRF3 expression pattern in developing kidneys.
RNF43 expression was found to be strongly expressed in the developing collecting duct system, but very low/absent in other compartments. ZNRF3 expression was more widespread with signals visible in virtually all compartments.
Figure 6.
R-spondins can function in an LGR-independent manner during kidney development.
(A) i-iiii) RNAScope analysis (red) revealed low levels of Lgr4 expression throughout the developing kidney with strong signal within the distal portion of the forming nephron and weak activation in the stromal cells (white arrowhead). v-viii) Lgr5 expression was found within the ureteric tip and distal segment of S-shaped bodies. ix-xii) Lgr6 expression was restricted to PTAs of newly forming nephrons. (SIX2 = green, Hoechst = blue). The Cap Mesenchyme compartment is outlined by dotted white lines. (B) Immunofluorescence analysis of Lgr4 knockout and control samples performed on E14.5 kidney sections with SIX2 antibodies reveals a reduction of nephron progenitors. (C) Quantification of SIX2+ progenitors from (B) (for each genotype n = 3 embryos collected from two litters,) Every black dot or square represents the total number of SIX2+ progenitors located in the CM counted in one control or mutant of an entire kidney field, see Figure 6—source data 1. (D) Lgr4 negative progenitors undergo MET as revealed by WT1 staining (high WT1 expression is found in the proximal part of Comma and S-shaped bodies, as well as podocytes). (E) Immunofluorescent analysis in wholebody Lgr4/5/6 mutants demonstrates persistence of progenitors and MET despite the absence of all three cognate R-spondin receptors. (F) Model for the molecular cascade regulated by R-spondins during nephrogenesis.
RNF43 expression was found to be strongly expressed in the developing collecting duct system, but very low/absent in other compartments. ZNRF3 expression was more widespread with signals visible in virtually all compartments.
R-spondins can function in an LGR-independent manner during kidney development.
(A) i-iiii) RNAScope analysis (red) revealed low levels of Lgr4 expression throughout the developing kidney with strong signal within the distal portion of the forming nephron and weak activation in the stromal cells (white arrowhead). v-viii) Lgr5 expression was found within the ureteric tip and distal segment of S-shaped bodies. ix-xii) Lgr6 expression was restricted to PTAs of newly forming nephrons. (SIX2 = green, Hoechst = blue). The Cap Mesenchyme compartment is outlined by dotted white lines. (B) Immunofluorescence analysis of Lgr4 knockout and control samples performed on E14.5 kidney sections with SIX2 antibodies reveals a reduction of nephron progenitors. (C) Quantification of SIX2+ progenitors from (B) (for each genotype n = 3 embryos collected from two litters,) Every black dot or square represents the total number of SIX2+ progenitors located in the CM counted in one control or mutant of an entire kidney field, see Figure 6—source data 1. (D) Lgr4 negative progenitors undergo MET as revealed by WT1 staining (high WT1 expression is found in the proximal part of Comma and S-shaped bodies, as well as podocytes). (E) Immunofluorescent analysis in wholebody Lgr4/5/6 mutants demonstrates persistence of progenitors and MET despite the absence of all three cognate R-spondin receptors. (F) Model for the molecular cascade regulated by R-spondins during nephrogenesis.
RNF43 and ZNRF3 expression pattern in developing kidneys.
RNF43 expression was found to be strongly expressed in the developing collecting duct system, but very low/absent in other compartments. ZNRF3 expression was more widespread with signals visible in virtually all compartments.Based on these findings we hypothesized that LGR4 was likely to be the main receptor mediating RSPO function in renal progenitors. To test this hypothesis, we took advantage of a mouse strain carrying an Lgr4 null allele that was previously generated by our laboratory (Da Silva et al., 2018). Quantification of SIX2-positive NPCs at E14.5 indicated a reduction by 37% (p=0.0006) in Lgr4-mutants compared to control kidneys (Figure 6B,C; Figure 6—source data 1), a cell loss that was considerably inferior to that observed in R-spondin mutants. Moreover, MET appeared to be unaffected in LGR4 mutants as exemplified by the activation of LEF1 in PTAs and the presence of WT1 positive cells in proximal proportion of forming nephrons (Figure 6D). To test whether LGR5 and/or LGR6 may compensate for the lack of LGR4, we next analyzed wholebody Lgr4/5/6 triple knockout kidneys at E14.5, the latest developmental stage where these embryos can be collected. The absence of LGR4/5/6 had little effect on early renal development and progenitors were able to undergo MET and form WT1+ glomeruli (Figure 6E). We conclude that while LGR4 appears to mediate some R-spondin activity within the nephrogenic niche, the majority of signalling occurs in an LGR-independent manner.
Discussion
Controlled proliferation and differentiation of renal progenitors is essential for the establishment of sufficient numbers of nephrons that ensure healthy kidney function throughout life. Our analysis has established R-spondins as novel key regulators that ensure the maintenance of a healthy pool of nephron progenitors throughout kidney development and permit MET during nephrogenesis (Figure 6F).Consistent with their partially overlapping expression pattern, R-spondins appear to act in a functionally redundant manner in kidney development and single gene deletion of Rspo1 or Rspo3 had only mild effects on progenitor numbers (Figure 1—figure supplement 3). However, whereas Rspo1 is present in all SIX2+ cells, Rspo3 expression is restricted to a subpopulation that - based on their location at the outermost cortex - appear to represent ‘ground-state’ progenitors. Interestingly, by E18.5 Rspo3 expression is lost from the nephron progenitor compartment, which is likely to reflect the progressive aging/differentiation of these cells. Indeed, age-dependent changes of nephron progenitors that affect their proliferation capacity and lifespan have been described, previously (Chen et al., 2015).At late stages of embryogenesis, Rspo3 expression becomes almost exclusively restricted to stromal progenitors, which is consistent with recent single sequencing data at E18.5 that highlighted Rspo3 as a marker for the stromal compartment (Combes et al., 2019). Stromal expression appears to be important for nephron progenitor maintenance, as Rspo3 deletion in this compartment (Foxd1:Cre) resulted in progenitor loss at later stages of development. Renal progenitor cells are thus sandwiched between stromal cells releasing RSPO3 and the WNT9b producing ureteric bud that ensures their survival at later stages of development.In previous studies, R-spondins, and in particular Rspo3, have been shown to enhance both canonical and non-canonical WNT signalling (Kazanskaya et al., 2004; Scholz et al., 2016; Ohkawara et al., 2011). Our analysis demonstrates that upon R-spondin deletion direct downstream targets of β–catenin, such as Tafa5 (Karner et al., 2011) and Axin2 (Lustig et al., 2002) are reduced in nephron progenitors indicating that in kidney development R-spondins activate canonical WNT signalling. Indeed, the observed phenotypes largely mimic those seen upon loss of β−catenin activity (Karner et al., 2011; Carroll et al., 2005; Park et al., 2012 and this study). These findings are consistent with recent in vitro data that described Rspo1 to enhance canonical signalling upon treatment of a mesonephric cell line (M15) with WNT9b (Dickinson et al., 2019). However, at present we can not exclude that R-spondins may also modulate non-canonical WNT signalling, which might affect cell adhesion and migration of NPCs. Live imaging experiments in Six2-Cre:DM will be required to address this hypothesis.The substantially different phenotypes observed in CAGG:CreER (or Foxd1:Cre) driven deletion of R-spondins, which impacted progenitor survival, and Wt1:CreER (or Six2:Cre) driven excision that interfered with MET, may at a first glance seem surprising. However, the ubiquitously expressed CAGG:CreER strain completely abolished R-spondin expression in the kidney and thus effectively blocked β–catenin signalling within progenitors. Since β–catenin signalling is essential for proliferation and survival, progenitor cell numbers rapidly declined in these mutants. By contrast, Six2:Cre and Wt1:CreER-induced deletions did not interfere with stromal Rspo3 expression, which bestowed sufficient β-catenin signalling on progenitors to permit survival. This hypothesis is compatible with a model in which low and high levels of β–catenin signalling regulates Class II and Class I target genes, respectively (Ramalingam et al., 2018). However, the concept of lower β–catenin signalling in uncommitted progenitors seems contradictory considering that they are exposed to higher levels of R-spondins (RSPO1+RSPO3), when compared to cells that engage in MET (only RSPO1). This dilemma can be resolved when introducing an additional ‘switch’ that permits the activation of class I targets (e.g. Wnt4/Lef1) once progenitors leave the cortical niche. Evidence from knockout studies suggests this switch to involve Bmp7-dependent activation of pSMAD signalling at the boundary between the niche and committed cells (Brown et al., 2013). Since progenitors in Six2:Cre-DM/Wt1:CreER mice have significantly decreased levels of Bmp7 (a class II target of β-catenin [Park et al., 2012]), progenitor cells fail to activate pSMAD signalling, lack expression of class I targets and as a consequence do not epithelialize.We have also addressed the potential role of LGR4/5/6, the cognate receptors of R-spondins, in conveying their action. Lgr4 single mutants have been described previously to show dilated collecting ducts and reduced kidney size (Kato et al., 2006) that could be traced back to a reduction in renal progenitors (Dang et al., 2014). Our own analysis with an independent Lgr4 knockout allele confirms this phenotype, although duct dilation was only seen at late stages of kidney development (Da Silva et al., 2018 and data not shown). In R-spondin mutants we did not observe dilated collecting ducts, which might be explained by persistent expression of Rspo3 in medullary stroma using the tissue-specific deletion in stromal or nephron progenitors. Lgr5 was found to be virtually absent from uninduced progenitors, but was strongly expressed within the ureteric tip and the distal part of the developing nephron, two sites of strong β-catenin activity. To our knowledge, no renal abnormalities have been associated with Lgr5 mutations and the previously published Lgr4/Lgr5 double mutants show a kidney phenotype comparable to the Lgr4 single mutant (Kinzel et al., 2014). Our RNAScope analysis revealed Lgr6 expression to be highly restricted to the pretubular aggregates and renal vesicle. Surprisingly, Lgr4/5/6 triple knockouts are associated with only a mild loss of renal progenitors that are capable to undergo MET, a phenotype that does not phenocopy the dramatic loss of renal progenitors and their inability to undergo MET correlated with the absence of Rspo1 and Rspo3. Due to the embryonic death around E14.5, later stages could not be analysed. Taken together these data indicate that Lgr4, but not Lgr5/6, contribute to R-spondin signalling in nephron progenitor cells. However, the mild phenotype observed in single Lgr4 mutants and the triple Lgr knockout when compared to Rspo1/3 mutants, suggests that R-spondins are likely to act primarily in an LGR-independent manner in NPCs. A similar LGR-independent action has recently been described for Rspo2 in limb and lung development (Szenker-Ravi et al., 2018). Interestingly, an alternative mode of action for RSPO2 and RSPO3 has recently emerged that potentiates the WNT/β−catenin pathway through an interaction with heparan sulfate proteoglycans (HSPG) (Lebensohn and Rohatgi, 2018). In Xenopus, RSPO3 has been shown to interact with Syndecan4 to induce non-canonical (PCP) signalling (Ohkawara et al., 2011) and Syndecan1 has been suggested to present WNT and R-spondins in multiple myeloma (Ren et al., 2018). Further analysis will be needed to identify the proteins responsible for mediating LGR-independent R-spondin action in the kidney.The number of nephrons varies dramatically in the human population with a count of 250,000 and 2.5 million glomeruli per kidney being considered as normal. However, lower nephron numbers have been directly linked with hypertension and a higher risk of developing renal diseases (Bertram et al., 2011). Our study has identified R-spondins as regulators that maintain the nephrogenic niche during development and we can speculate that changes in expression levels or protein function in these genes may be associated with renal disorders. Interestingly, the RSPO3 locus has been identified in two studies to be linked with renal diseases including abnormal blood ureanitrogen (BUN), a hallmark for glomerular filtration dysfunction (Okada et al., 2012; Osman et al., 2018). Given these studies and our findings in mice, it will be of interest to further investigate a potential role of R-spondin variants in the predisposition to renal disease.
Materials and methods
Mice
The experiments described in this paper were carried out in compliance with the French and international animal welfare laws, guidelines and policies and were approved by the local ethics committee (PEA N°: NCE-2014–207 and PEA N°: 2018060516474844 (V2)). Genetically modified mice used in this study have been described previously: Rspo3 (Rocha et al., 2015), Rspo1 (Chassot et al., 2008), Ctnnb (Brault et al., 2001), Lgr4 (Da Silva et al., 2017), Lgr4/5/6(Szenker-Ravi et al., 2018), CAGG:CreER (Hayashi and McMahon, 2002), Wt1:CreER (Zhou et al., 2008), Six2:Cre (Kobayashi et al., 2008) and Foxd1:Cre (Kobayashi et al., 2014). Primers for genotyping can be found in Table 1. For inducible Cre lines (CAGG:CreER and Wt1:CreER), Cre activation was achieved by gavage of pregnant females with an extemporarily prepared single dose of 200 mg tamoxifen dissolved in corn oil per kg of body weight. For proliferation assays, BrdU dissolved in 0.9% NaCl was administered to pregnant dams 2 hr before sacrificing via intraperitoneal (IP) injection at a dose of 50 mg/kg. Embryos were analyzed at various time-points and genders were not considered.
Table 1.
List of primer pairs used for qPCR or genotyping analysis in this study.
Name
Forward
Reverse
Usage
Axin2
GCAAGTCCAAGCCCCATA
CGGCTGACTCGTTCTCCT
qPCR
Rspo2
GCCAGGCAAAAGACACAATACCA
CAATCAGGCTTCCGCCTCTTCTTC
qPCR
Rspo3
TCAAAGGGAGAGCGAGGA
CAGGAGGAGGAGCTTGTTTCC
qPCR
Rspo4
GCTGTTTCAGGCCAGGGACTTC
TTGTGTATGCAGGGGACTCCA
qPCR
Sdha
TGTTCAGTTCCACCCCACA
TCTCCACGACACCCTTCTG
pPCR
Wnt4
ACTGGACTCCCTCCCTGTCT
TGCCCTTGTCACTGCAAA
qPCR
Ctnnb1
AAGGTAGAGTGATGAAAGTTGTT
CACCATGTCCTCTGTCTATTC
Genotyping
Cre
CCCACCGTCAGGTACGTGAGATAT
CGCGGTCTGGCAGGTAAAAACTAT
Genotyping
Foxd1 Wt
CTCCTCCGTGTCCTCGTC
TCTGGTCCAAGAATCCGAAG
Genotyping
Foxd1 Cre
GGGAGGATTGGGAAGACAAT
TCTGGTCCAAGAATCCGAAG
Genotyping
Lgr4 Wt and Ko
TGTGTTTTGGCTTGCTTGAC
AGTCTGCTCCCCTACCACT
Genotyping
Lgr4 Wt
TGCAACCCTAGAAGGGAAAA
CTCACAGGTGCTTGGGTGAAG
Genotyping
Lgr4 Ko
GCCTGCATTACCGGTCGATGCAACGA
CTCACAGGTGCTTGGGTGAAG
Genotyping
Lgr5 Wt
ACATGCTCCTGTCCTTGCT
GTAGGAGGTGAAGACGCTGA
Genotyping
Lgr5 Ko
CACTGCATTCTAGTTGTGG
CGGTGCCCGCAGGCGAG
Genotyping
Lgr6 Wt
CGCTCGCCCGTCTGAGC
GCGTCCAGGGTCCGCAGGG
Genotyping
Lgr6 Ko
CGCTCGCCCGTCTGAGC
CCTGGACGTAGCCTTCGGGC
Genotyping
Rspo1Ko
ATCCAGGGGTCCCTCTTGATC
AATATCGCGGCTCATTCGAGG
Genotyping
Rspo1Wt
ATCCAGGGGTCCCTCTTGATC
TTGAGGCAACCGTTGACTTC
Genotyping
Rspo3flox
CTTCAACTTGAAGGTGCTTTACC
CCAGGAATGTACAACAGGATCCTCTC
Genotyping
Embryo collection
Embryos were collected from time-mated females considering the date when the vaginal plug was observed as embryonic day 0.5 (E0.5). Embryos from E11.5 to E18.5 were fixed with 4% paraformaldehyde (PFA) in phosphate buffer saline (PBS) overnight at 4°C or at room temperature, if used for RNA-Scope analysis. The day after, embryos were washed in PBS, dehydrated through an Automatic tissue processor (Leica TP1020) and embedded in paraffin.
In situ hybridization
Tissues were fixed overnight in 4% paraformaldehyde, progressively dehydrated and embedded in paraffin. 7-µm-thick sections were cut then rehydrated and hybridization was performed as described in Lescher et al., 1998 using an InsituPro VSi robot from Intavis Bioanalytical Instruments. Digoxygenin-labelled antisense RNA probes were synthesized from plasmids obtained from different sources: Rspo1, Rspo3, Wnt4, Wnt9b (Gift from McMahon’s laboratory), Bmp7, Etv5 and Crym (Gift from T. Carroll’s laboratory), Uncx4 (Gift from A. Reginensi, in J. Wrana’s laboratory), Slc12a, Tfrc and Tafa5 DNA sequences were subcloned in pCRII Topo vector. Hybridized DIG-RNA probes were detected with alkaline phosphatase-coupled anti-digoxigenin antibody. After washing, the chromogenic reaction was performed with BM-purple substrate for several days at room temperature. RNAscope analysis (Advanced Cell Diagnostics; Lgr4, Lgr5, Lgr6, Rspo1, Rspo2, Rspo3, Axin2) was performed according to the manufacturer's instructions using the chromogenic Fast Red dye that can be visualized using light or fluorescence microscopy. Alternatively, after in situ hybridization, sections were blocked in a PBS solution containing 3% BSA, 10% Normal Donkey Serum and 0.1%Tween, then primary antibodies were added at concentrations reported in Supplementary file 1 and incubated overnight at 4°C. The following day, after three washes in PBS, secondary antibodies were diluted 1/500 in PBS and applied on sections for 1H at room temperature. After three washes in PBS, sections were mounted in a 50% glycerol (in PBS) medium.
Immunofluorescence and histological analysis
For immunofluorescence experiments, tissues were fixed overnight in 4% paraformaldehyde, progressively dehydrated and embedded in paraffin. 5 µm thick sections were rehydrated, boiled in a pressure cooker for 2 min with Antigen Unmasking Solution and blocked in PBS solution containing 10% normal donkey serum, 0.1% tween and 3% BSA. All antibodies were applied overnight at 4°C at the concentrations listed in the Supplementary file 1. Secondary antibodies were diluted 1:500 and applied at room temperature for 1 hr. For histological analysis, 5-µm-thick sections were stained with hematoxylin and eosin according to standard procedures.
Quantitative RT-PCR analysis
RNA was extracted from embryonic samples or cultured cells using RNeasy Mini- or Micro-kit, following the manufacturer’s instructions. Reverse transcription was performed using M-MLV reverse transcriptase in combination with Random Hexamers. The cDNA synthesised was used as a template for qPCR reaction performed using the Light Cycler SYBR Green I Master Kit. Expression levels were normalized for Sdha. Primers are described in Table 1.
Quantification of proliferating renal progenitors
A combination of anti-BrdU and anti-SIX2 antibodies was used to detect proliferating renal progenitors. Quantification was performed on four embryos (n = 4) isolated either from 2 (for CAGG:CreER or 3 (for Ctrl) different litters. For each embryo between 10 and 40 kidney sections were analysed that were collected throughout the entire organ. Pictures were taken with a Zeiss Apotome two upright microscope and every kidney field on the picture was analysed with Fiji software. Only SIX2+ cells located in the cap mesenchyme were considered for quantification. The percentage of proliferating progenitors was obtained after scoring for every embryo the average of (BrdU/SIX2) double positive nuclei divided by the total number of SIX2+ cells in the CM. Each value was reported on the graph as a single symbol (black dot for Ctrl and black square for CAGG:CreER).
Quantification of apoptotic renal progenitors
Apoptotic cells were labelled with TUNEL kit (Roche) and renal progenitors identified using anti-SIX2 antibodies. Quantification was performed on three embryos (n = 3) isolated from two different litters. For each embryo, between 6 and 15 sections, going through the kidney centre (pelvic region) were analysed. Pictures were taken for every kidney with a Zeiss Apotome two upright microscope. In every kidney field, only SIX2+ cells located in the cap mesenchyme were considered and quantified with Fiji software. The percentage of apoptotic progenitors was obtained after scoring for every embryo the average of (TU/SIX2) double positive nuclei divided by the total number of SIX2+ cells in the CM. Each value was reported on the graph as a single symbol (black dot for Ctrl and black square for CAGG:CreER).
Quantification of renal progenitors
SIX2+ progenitors located in the cap mesenchyme were counted in three sagittal sections (20 μm apart to each other) of kidney samples through the renal pelvis and the average number obtained for every embryo was reported on the graph.
Quantification of Axin2 level of expression from RNAScope analysis
Three to eight sagittal sections of kidney samples were cut through the renal pelvis (20 μm apart from each other), and subjected to in situ RNA hybridisation (RNAScope technology) using an Axin2 anti-sense probe. Sections were mounted in Vectashield antifade mounting medium with DAPI and imaged with a Slide scanner Vectra Polaris. RNAScope signal was detected with filter 555 and nuclei with filter 350. Images were analysed with Halo software (Indica labs) using FISH-IF module that was based on cell segmentation and ISH signal per cell. The value obtained for every kidney section analysed is reported on the graph by either a point (for control) or a square (for mutant). Each symbol corresponds to the total RNAScope signal detected per selected kidney field normalised to the total number of cells present in this area.
Quantification of progenitors that are pSMAD1/5 positives
Immunostaining with anti-pSMAD1/5 antibodies was performed on 3 to 6 sagittal sections (20 μm apart to each other) of kidney samples, and signal was revealed using the Vector Red alkaline phosphatase kit. For every section, progenitors located in CM that were labelled with anti-PSMAD1/5 antibodies were counted and normalised to the total number of progenitors that were in this CM. Every average number obtained for every embryo was reported on the graph as a dot (for control) or a square (for mutant) samples.
Statistical analyses
Data are shown as mean (± s.e.m). Analyses were performed according to the two-tailed unpaired Student's t-test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. The letter ‘n’ refers to the number of individual samples.
Nephron progenitor isolation and culture
Kidneys were dissected from E16.5 wild-type embryos. The kidney capsule was removed and the nephrogenic zone digested by incubating kidneys in collagenaseA/pancreatin mix for 15 min according to Brown et al. (2015). Nephron progenitors were purified by MACS sorting and resuspended in Apel medium supplemented with 2% PFHM II (Protein Free Hybridoma Medium II), FGF9 (200 ng/ml) and Heparin (1 μg/ml) as growth control medium. Freshly isolated cells were seeded at 200,000 cells per 24-well dish and cultured for 48 hr at 37°C, 5% CO2. We tested the effect of medium supplementation with RSPO3 (200 ng/ml) + WNT3a (50 ng/ml) or with Chir (3 μM) only. After 2 days, cells were scrapped with RLT buffer (Qiagen) and RNA extracted using RNeasy Mini kit according to the manufacturer’s instructions (Qiagen).In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:The topic of the maintenance and differentiation of renal stem cells is of prime interest. The work examines the role of R-spondins in controlling nephron progenitors/stem cells and the formation of nephrons. With different Cre drivers, distinct roles for Rspo1 and Rspo3 in the formation of nephrons are suggested. This indicates that there are additional signals in the process of MET. The actions of R-spondins seem to be independent of Lgr4/5/6 signalling. The results have implications for renal development and possibly for regenerative medicine in kidney disease.Decision letter after peer review:Thank you for submitting your article "Paracrine and autocrine R-spondin signalling is essential for the maintenance and differentiation of renal stem cells" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Roel Nusse as Reviewing Editor and Kathryn Cheah as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Melissa H Little (Reviewer #3).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.The work examines the role of R-spondins in controlling nephron progenitors/stem cells and the formation of nephrons. With different Cre drivers, distinct roles for Rspo1 and Rspo3 in the formation of nephrons are suggested. This indicates that there are additional signals in the process of MET. The actions of R-spondins seem to be independent of Lgr4/5/6 signalling.Summary:The reviewers have mixed opinions about the quality of the work but they converge on a number of important issues to be addressed.Essential revisions:1) Clarify the use of the term stem cells or progenitors.2) A better quantification of the data is required: e.g. on gene expression, proliferation and apoptosis, pSMAD1/5.3) Provide an explanation of the finding that Lgrs are not required for the Rspo phenotypes, and if there is no explanation, consider to leave the data out.4) To address proliferative versus a differentiative roles by analysing the effects of R-spondins on freshly cultured NPCs.Reviewer #1:Vidal et al. are interested in signals responsible for the maintenance and differentiation of stem cells in the kidney. They come to the conclusion that RSPO1 and RSPO3, signals that amplify Wnt signaling, are redundant and permit WNT/β-catenin signalling. Deleting the genes for RSPO1 and RSPO3 leads to a loss of renal stem cells, while deletion of the genes in cap mesenchymal cells blocks MET together with loss of Bmp7 signaling. Mutations in LGR4/5/6, has a limited effect on progenitor numbers. The authors suggest that R-spondins have a role in permitting stem cell maintenance.The data and the paper have some merit but in aggregate, the work is presented in a confusing manner and raises more questions than answers.For one, there is the use of the term stem cells in the title and the Abstract. Stem cells are defined as self-renewing cells throughout life, but the studies here are limited to embryonic or fetal development of the kidney. The term progenitor is more appropriate, which is used as well by the authors but in an intermittent way raising confusion on what they intend to say.A major problem is the lack of robust quantification of gene expression. Transcripts are detected by RNA in situ hybridization, using RNAscope technology. But how the number or size of the dots detected correlate to real differences in number of RNA molecules is not clear.Why certain drivers of Cre are used in certain experiments is not clear. The CAGG:CreER driver in subsection “RSPO1 and RSPO3 are essential to maintain the pool of kidney progenitors” is ubiquitous, would eliminate Rspo expression everywhere, not only in the kidney. Are there effects on other organs? Secondary effects on the kidney? In subsection “Stromal Rspo3 maintains nephron progenitors during late stages of kidney development” there is a Foxd1-Cre driver, which is not inducible.The observation that a triple knockout of LGR4/5/6 has a very limited phenotype has been made before by two of the co-authors (Szenker-Ravi, Reversade et al.). The underlying mechanism is still not clear, and the current manuscript doesn't shed light on it either. In the absence of an explanation, it is questionable whether these data belong in the manuscript.Reviewer #2:The authors have addressed the role of R-spondins in proliferation and differentiation of nephron progenitor cells. Nephron progenitor cells exist in a discrete anatomic site in the developing kidney and both self renew throughout fetal life and give rise to nephrons. No NPCs exist in adult life. While the Wnt system has been thoroughly investigated in renal development direct relevance to humankidney malformations has been rarely suggested (PMID: 23520208). Importantly, R-spondins have been recently used to expand organoid cultures of adult kidney epithelia (Nat Biotech 2019). The cell types in adult cultures include proliferating mature epithelia and maybe "stem states" of mature epithelia but surely they do not include NPCs.The manuscript is overall elegant and the experiments are properly performed. Nevertheless, the verdict of proliferation versus differentiation of NPCs following an R-spondin cue is still out there. For the manuscript to be acceptable to eLife I would suggest a major revision and additional experiments on NPC cultures. Currently R-spondins are not required to propagate NPC ex vivo. To make a strong case for a proliferative versus a differentiative roles , isolation of NPC and analysis of the effects of R-spondins on freshly cultured NPCs is critically needed. I would like to see these data.Reviewer #3:This study takes a close look at the role of R-spondins in the regulation of nephron progenitors and the subsequent formation of nephrons. Using a series of different Cre drivers specific to subsets of cells within the developing kidney, they identify distinct roles for Rspo1 and Rspo3 in the formation of nephrons during kidney development. This suggests the involvement of an additional signal to the previously described role of canonical Wnt signalling in the process of MET. Surprisingly, they also demonstrate that the actions of R-spondins are independent of Lgr signalling as the phenotypes were not replicated in cell-specific LGR knockouts. While the mechanism of action was not further investigated, the study was performed well and adds clarity to our understanding of the molecular basis of kidney development. The data presented in large part supports the conclusions that have been made by the authors. The quality of the data is generally high.Essential revisions:1) Clarify the use of the term stem cells or progenitors.The term “renal stem cell” has been used repeatedly in the literature for nephron precursors, but we agree that nephron progenitors are less controversial. We have therefore replaced stem cells with nephron progenitors throughout the manuscript.2) A better quantification of the data is required: e.g. on gene expression, proliferation and apoptosis, pSMAD1/5.Proliferation and apoptosis:We have noticed that the descriptions provided in our original submission on how quantifications were performed were incomplete and we would like to apologize for this oversight. We have now revised the Materials and methods section and also provide more details on the number of samples analyzed (n) in the figure legends.Gene expression:Many of the genes analysed show a highly dynamic expression pattern in kidney development and their expression is not restricted to the nephron progenitor compartment. This makes quantification by qPCR unsuitable. We had therefore opted for in situ hybridization analysis that provides spatial information, and a qualitative assessment of RNA expression. RNA-Scope analysis is considered more quantitative when counting individual dots, but cost-prohibitive if a large number of genes have to be analysed. As a compromise, we have now performed new RNA-Scope experiments for the direct β-catenin target Axin2 and quantified its expression using the HALO software package. Our new data demonstrate a significant reduction of Axin2 expression upon NPC-specific deletion of R-spondins (Figure 4E and Figure 2—figure supplement 1). The use of the Halo Software required the expertise of Samah Rekima (plateform Histology, iBV), who has been added as a co-author in the revised manuscript.pSMAD1/5:We have now quantified pSMAD1/5 cells within the nephrogenic zone on 4 independent knockout and wildtype samples. Our data confirm a >90% reduction for SMAD1/5 activation and this data have now been added as Figure 5F.3) Provide an explanation of the finding that Lgrs are not required for the Rspo phenotypes, and if there is no explanation, consider to leave the data out.LGR4-6 are considered as the main receptors of R-spondins (de Lau 2012). However, recent results demonstrate that RSPO3 can also act through an LGR-independent mechanism involving HSPGs (Lebensohn and Rohatgi, 2018). As discussed in our manuscript, the Lgr knockout kidney phenotype is far less severe than that observed in R-spondins mutants, which implies that the latter must act in an LGR independent manner. Providing functional proof that they act via HSPGs (or through alternative adaptors) is difficult and beyond the scope of this paper. While LGRs only play a minor role in mediating R-spondin activity in the kidney, we believe this observation is still important. If the reviewers insist, we could eventually move the data to the supplementary figures section.4) To address proliferative versus a differentiative roles by analysing the effects of R-spondins on freshly cultured NPCs.Depending on culture conditions isolated NPCs can be either expanded (low density plating) or induced to undergo MET (high density plating with a pulse of β-catenin inducing agent). We had planned to evaluate the effect of recombinant R-spondins under both of these conditions.Low density plating:We used the previously established medium by Brown et al., 2015, and cultured freshly isolated NPCs for 72h replacing Chiron (or not) with RSPO3. Surprisingly, in our hands, NPC expansion was also achieved in the absence of Chiron (and RSPO3), perhaps because intrinsic factors (cells continue to produce R-spondins) were sufficient to ensure expansion for the first 72h. Additional experiments, using R-spondin knockout mice had to be abandoned because of the COVID19 lockdown. However, deletion of Rspo1/3 at any time point during kidney development (we tested E10.5/E11.5/E12.5/ E13.5) leads to a rapid decline of the NPC population (Figure 2), which clearly demonstrates that these signalling molecules are essential for maintaining the progenitor pool.High density plating:Kidney progenitors were freshly isolated according to Brown et al., 2015, and cultured for 48h under high density plating conditions in the presence of RSPO3 (200μg/ml) or RSPO3 (200μg/ml) + Wnt3a (50ng/ml) or with Chiron (3μM). Under those conditions recombinant RSPO3 appears to induce canonical β-catenin signalling and initiate the initial steps of MET, as evidenced by the upregulation of Axin2 and Wnt4. (Figure 5D) (unfortunately we could not test other markers due to the COVID-19 lockdown). These new data have been included in the revised manuscripts.Reviewer #1:Vidal et al. are interested in signals responsible for the maintenance and differentiation of stem cells in the kidney. They come to the conclusion that RSPO1 and RSPO3, signals that amplify Wnt signaling, are redundant and permit WNT/β-catenin signalling. Deleting the genes for RSPO1 and RSPO3 leads to a loss of renal stem cells, while deletion of the genes in cap mesenchymal cells blocks MET together with loss of Bmp7 signaling. Mutations in LGR4/5/6, has a limited effect on progenitor numbers. The authors suggest that R-spondins have a role in permitting stem cell maintenance.The data and the paper have some merit but in aggregate, the work is presented in a confusing manner and raises more questions than answers.For one, there is the use of the term stem cells in the title and the Abstract. Stem cells are defined as self-renewing cells throughout life, but the studies here are limited to embryonic or fetal development of the kidney. The term progenitor is more appropriate, which is used as well by the authors but in an intermittent way raising confusion on what they intend to say.We have replaced the term renal stem cells with nephron progenitors throughout the text.A major problem is the lack of robust quantification of gene expression. Transcripts are detected by RNA in situ hybridization, using RNAscope technology. But how the number or size of the dots detected correlate to real differences in number of RNA molecules is not clear.Please see our response to point 2 of the Essential revisions section.Why certain drivers of Cre are used in certain experiments is not clear. The CAGG:CreERTM driver in subsection “RSPO1 and RSPO3 are essential to maintain the pool of kidney progenitors” is ubiquitous, would eliminate Rspo expression everywhere, not only in the kidney. Are there effects on other organs? Secondary effects on the kidney? In subsection “Stromal Rspo3 maintains nephron progenitors during late stages of kidney development” there is a Foxd1:Cre driver, which is not inducible.We apologize for the confusion. The inducible ubiquitous driver (CAGG:CreER) has been used to efficiently delete R-spondins in all cell types. Since the effect on kidney progenitor proliferation and survival is very rapid (48h) and can be seen independently of the time of induction (we tested E9.5, E10.5, E11.5, E12.5, E13.5), the phenotype is unlikely to be due to secondary effects caused by phenotypes in other organ systems. Moreover, R-spondins are considered to work locally rather than on an organismal level. Finally, loss of progenitor cell maintenance is also seen when using tissue specific Cre lines such as Foxd1-Cre (see Figure 3). We have modified the text to better explain why certain drivers have been used.The observation that a triple knockout of LGR4/5/6 has a very limited phenotype has been made before by two of the co-authors (Szenker-Ravi, Reversade et al.). The underlying mechanism is still not clear, and the current manuscript doesn't shed light on it either. In the absence of an explanation, it is questionable whether these data belong in the manuscript.The paper by Szenker-Ravi et al. did not report on the kidney phenotype and we believe that the information that RSPO signalling in the kidney only partially depends on LGR receptors is important to the scientific community. We would therefore prefer to maintain this information in the paper. If the editors feel strongly against the inclusion as a main figure, we could move these data to the supplementary section. (please see also our response to point 3 of the Essential revisions section.)Reviewer #2:The authors have addressed the role of R-spondins in proliferation and differentiation of nephron progenitor cells. Nephron progenitor cells exist in a discrete anatomic site in the developing kidney and both self renew throughout fetal life and give rise to nephrons. No NPCs exist in adult life. While the Wnt system has been thoroughly investigated in renal development direct relevance to humankidney malformations has been rarely suggested (PMID: 23520208). Importantly, R-spondins have been recently used to expand organoid cultures of adult kidney epithelia (Nat Biotech 2019). The cell types in adult cultures include proliferating mature epithelia and maybe "stem states" of mature epithelia but surely they do not include NPCs.The manuscript is overall elegant and the experiments are properly performed. Nevertheless, the verdict of proliferation versus differentiation of NPCs following an R-spondin cue is still out there. For the manuscript to be acceptable to eLife I would suggest a major revision and additional experiments on NPC cultures. Currently R-spondins are not required to propagate NPC ex vivo. To make a strong case for a proliferative versus a differentiative roles , isolation of NPC and analysis of the effects of R-spondins on freshly cultured NPCs is critically needed. I would like to see these data.Please see our response to point 4 of the Essential revisions section.
Authors: Alexander N Combes; Belinda Phipson; Kynan T Lawlor; Aude Dorison; Ralph Patrick; Luke Zappia; Richard P Harvey; Alicia Oshlack; Melissa H Little Journal: Development Date: 2019-06-12 Impact factor: 6.868
Authors: Shuang Chen; Eric W Brunskill; S Steven Potter; Phillip J Dexheimer; Nathan Salomonis; Bruce J Aronow; Christian I Hong; Tongli Zhang; Raphael Kopan Journal: Dev Cell Date: 2015-10-12 Impact factor: 12.270
Authors: Fariba Jian Motamedi; Danielle A Badro; Michael Clarkson; M Rita Lecca; Stephen T Bradford; Fabian A Buske; Kathrin Saar; Norbert Hübner; André W Brändli; Andreas Schedl Journal: Nat Commun Date: 2014-07-17 Impact factor: 14.919
Authors: Olga Kazanskaya; Andrei Glinka; Ivan del Barco Barrantes; Peter Stannek; Christof Niehrs; Wei Wu Journal: Dev Cell Date: 2004-10 Impact factor: 12.270
Authors: Kyle K Dickinson; Leah C Hammond; Courtney M Karner; Nicholas D Hastie; Thomas J Carroll; Paul Goodyer Journal: PLoS One Date: 2019-04-12 Impact factor: 3.240
Authors: Niall J Treacy; Shane Clerkin; Jessica L Davis; Ciarán Kennedy; Aline F Miller; Alberto Saiani; Jacek K Wychowaniec; Dermot F Brougham; John Crean Journal: Bioact Mater Date: 2022-08-19