Literature DB >> 32315372

Fibrosis growth factor 23 is a promoting factor for cardiac fibrosis in the presence of transforming growth factor-β1.

Kazuhiro Kuga1, Yoichiro Kusakari1, Ken Uesugi1,2, Kentaro Semba2, Takashi Urashima3, Toru Akaike1, Susumu Minamisawa1,2.   

Abstract

Myocardial fibrosis is often associated with cardiac hypertrophy; indeed, fibrosis is one of the most critical factors affecting prognosis. We aimed to identify the molecules involved in promoting fibrosis under hypertrophic stimuli. We previously established a rat model of cardiac hypertrophy by pulmonary artery banding, in which approximately half of the animals developed fibrosis in the right ventricle. Here, we first comprehensively analyzed mRNA expression in the right ventricle with or without fibrosis in pulmonary artery banding model rats by DNA microarray analysis (GSE141650 at NCBI GEO). The expression levels of 19 genes were up-regulated more than 1.5-fold in fibrotic hearts compared with non-fibrotic hearts. Among them, fibrosis growth factor (FGF) 23 showed one of the biggest increases in expression. Real-time PCR analysis also revealed that, among the FGF receptor (FGFR) family, FGFR1 was highly expressed in fibrotic hearts. We then found that FGF23 was expressed predominantly in cardiomyocytes, while FGFR1 was predominantly expressed in fibroblasts in the rat ventricle. Next, we added FGF23 and transforming growth factor (TGF)-β1 (10-50 ng/mL of each) to isolated fibroblasts from normal adult rat ventricles and cultured them for three days. While FGF23 itself did not directly affect the expression levels of any fibrosis-related mRNAs, FGF23 enhanced the effect of TGF-β1 on increasing the expression levels of α-smooth muscle actin (α-SMA) mRNA. This increase in xx-SMA mRNA levels due to the combination of TGF-β1 and FGF23 was attenuated by the inhibition of FGFR1 or the knockdown of FGFR1 in fibroblasts. Thus, FGF23 synergistically promoted the activation of fibroblasts with TGF-β1, transforming fibroblasts into myofibroblasts via FGFR1. Thus, we identified FGF23 as a paracrine factor secreted from cardiomyocytes to promote cardiac fibrosis under conditions in which TGF-β1 is activated. FGF23 could be a possible target to prevent fibrosis following myocardial hypertrophy.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32315372      PMCID: PMC7173860          DOI: 10.1371/journal.pone.0231905

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Cardiac fibrosis often follows cardiac hypertrophy induced by pressure overload. It stiffens the heart to provide resistance to pressure overload, but also promotes diastolic dysfunction of the heart. Because cardiac fibrosis is rarely reversible, controlling cardiac fibrosis is important to reduce the risk of heart failure. Studies on the molecular mechanisms of cardiac fibrosis have identified transforming growth factor (TGF)-β1 as one of the most important factors involved in fibrosis. However, TGF-β1 is known to be related to both hypertrophy and fibrosis [1, 2]. Distinguishing between a factor for myocardial fibrosis and a hypertrophic factor is challenging because myocardial fibrosis and cardiac hypertrophy typically occur together. In the previous study, we established pulmonary artery banding (PAB) model rats which exhibited heavier right ventricular weight and wider right atrium dimension compared to normal rats [3, 4]. Interestingly, approximately half of PAB rats developed fibrosis in the right ventricle, although hypertrophy was observed in all animals at four weeks after PAB operation. Therefore, we considered that this model could enable us to distinguish the factors involved in myocardial fibrosis from those involved in hypertrophy. The purpose of this study is to clarify the mechanisms of cardiac fibrosis as distinct from those of hypertrophy. We comprehensively analyzed the gene expression profiles in PAB rat right ventricles with or without fibrosis by DNA microarray.

Materials and methods

Animals

Experiments were performed after obtaining approval from the Animal Experiment Committee of The Jikei University School of Medicine. Sprague-Dawley (SD) rats were obtained from Sankyo Labo Service Corporation (Japan). Rats were allowed free access to a pelleted laboratory animal diet and tap water.

PAB model

In our previous study [3] we demonstrated that, four weeks after the PAB operation, rats could be divided into two groups: an F+ group in which the fibrotic area occupied more than 6.5% of the whole area of the heart tissues, and an F- group in which the fibrotic area occupied less than 6.5% of this area. We used heart samples obtained from PAB or sham-operated rats in the present study.

Microarray analysis

Frozen right ventricles in the Sham, F-, and F+ groups were immersed in 1 mL of TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and crushed using a bead-type homogenizer. After centrifugation at 12,000 g at 4°C for 15 minutes, the supernatant was collected. Microarray analysis was performed as previously described [5, 6]. Briefly, total mRNA was extracted following the instructions attached to the kit. Sense-strand cDNA containing dUTP was synthesized by amplified cRNA. These fragmented cDNAs (25 μg) were then labeled through a terminal deoxy-transferase reaction and hybridized to the Affymetrix GeneChip® Rat Gene 1.0 ST Array (Affymetrix, Santa Clara, CA, USA). Each array was then washed and stained on the GeneChip fluidics station 450 using the appropriate fluidics script; once completed, the array was inserted into the Affymetrix autoloader carousel and scanned using the GeneChip Scanner 3000. The hybridization experiments were performed in triplicate, and the intensities were averaged.

Isolation of cardiomyocytes and fibroblasts from adult rat hearts and cell culture

Male SD rats at 9–12 weeks old were supplied for cell isolation. Animals were anesthetized with pentobarbital (100 mg/kg, i.p.). Heparin sodium was injected to prevent blood clotting after anesthetization. The chest cavity was opened and the heart rapidly excised. The excised heart was perfused in a reverse fashion via the aorta with a HEPES Tyrode's solution (137 mM NaCl, 5.4 mM KCl, 0.5 mM MgCl2, 0.3 mM NaH2PO4, 5 mM HEPES, 0.9 g/L glucose, 2 mM CaCl2, pH7.4) using a Langendorff perfusion apparatus. After the remaining blood was washed out and the heartbeat was stable, the heartbeat was stopped with potassium chloride solution. Next, the heart was perfused with heart media solution (S-MEM [Gibco, Waltham, MA, USA] with 2.4 g/L HEPES, 3.76 g/L Taurin, 0.40 g/L DL-carnitine and 0.3 g/L Creatine, pH7.4) for 6 min, then with collagenase solution (heart media solution with 13000 units/head collagenase L, 1% bovine serum albumin [BSA], 20 μM CaCl2) for 20 min at 37°C. After perfusion was completed, the ventricle was isolated and cut into small pieces. Cells were triturated with a transfer pipette for 6 min at 37°C and filtered through a Cell Strainer (100 μm, BD Falcon, San Jose, CA, USA), then incubated in a mixture of 5 mL collagenase solution and 5 mL washing solution (heart media solution with 10% BSA, 20 μM CaCl2) at room temperature for 9 min. Fibroblasts were collected from the supernatant and cardiomyocytes were collected from precipitation. Supernatant containing fibroblasts was centrifuged (1000 rpm, 10 minutes, r.t.) and precipitation was collected. The fibroblasts were suspended in plating medium (DMEM, High Glucose, GlutaMAX™, Pyruvate [Gibco] with 10% fetal bovine serum [FBS] and 1% penicillin/streptomycin solution) and plated. Cells were cultured at 37°C with 5% CO2. Cardiomyocytes were washed twice with washing buffer, and 100 mM CaCl2 was added five times every four minutes. Separated cardiomyocytes were dispersed in attaching medium (Medium 199 [Invitrogen] with 4% FBS and 1% penicillin/streptomycin solution) and seeded to laminin-coated dishes. Cells were cultured at 37°C with 5% CO2 for 1–2 hours in connecting medium. After cells were attached, the cardiomyocyte cells were suspended in maintenance medium (199 Medium with 1% BSA and 1% penicillin/streptomycin solution) and cultured at 37°C with 5% CO2 for about 24 hours.

FGF23 and TGF-β1 treatments

At approximately 50% confluence, fibroblasts were treated with TGF-β1 (PeproTech, Rocky Hill, NJ, USA) and FGF23 recombinant protein (R&D Systems, Minneapolis, MN, USA) in low serum medium (DMEM with 1% FBS and 1% penicillin/streptomycin solution) for three days. Dose levels of TGF-β1 and FGF23 were 10, 25 and 50 ng/mL. To inhibit the activity of FGFR1, 10 μM of SU5402 (R&D Systems) was added to some wells prior to treatment with FGF23 and TGF-β1. Cells were then treated with 10 ng/mL of TGF-β1 and/or 25 ng/mL of FGF23 in low-serum medium for three days. For other fibroblasts, medium was changed to Opti-MEM (Gibco). Mixture of 3% lipofectamin and 1% siRNA (Fgfr1, GENE_ID 79114, Bioneer Corporation, Daejeon, Korea) was added, and cells were incubated at 37°C with 5% CO2 overnight. Cells were then treated with 10 ng/mL of TGF-β1 and/or 25 ng/mL of FGF23 in low serum medium for three days.

Quantitative real-time PCR

Quantitative real-time PCR was performed as previously described [3, 7]. Briefly, heart tissues from PAB or sham operated rats were immersed in 1 mL of TRIzol Reagent (Invitrogen) or Sepasol-RNA Super G (Nacalai Tesque, Kyoto, Japan) and crushed using a bead-type homogenizer. Fibroblasts and cardiomyocytes isolated from normal rat hearts were immersed in 1 mL of TRIzol Reagent (Invitrogen) or Sepasol-RNA Super G (Nacalai Tesque). Total RNA was extracted through sequential treatment with chloroform, 2-propanol, and ethanol. cDNA was synthesized using a TAKARA PCR Thermal Cycler Dice ™ (Takara Bio, Shiga, Japan), and real-time PCR was performed using a Thermal Cycler Dice 1 and SYBR 1 Premix Ex Taq™ (Takara Bio). The nucleotide sequences of the primers used are shown in Table 1. The experiments were performed in duplicate or triplicate, and the intensities were averaged. The GAPDH mRNA expression level was quantitated as an internal reference.
Table 1

List of primer sequence used for RT-PCR.

Gene nameForward primerReverse primer
GAPDHTGGTGAAGCAGGCATCTGAGTGCTGTTGAAGTCGCAGGAG
FGF23GCCAGGAACAGCTATCACCTACAGAGTTGCCGCGGAGATCCATAC
KlothoGCAAAGCGCTCAACTGGCTAAGCGAATACGCAAAGTAGCCACA
FGFR1CAGGGCTACCAGCCAACAACACTGTACACCTTGCACATGAACTC
FGFR2TGTTTCAACTCTGCTGTCCGATGCATCTTGGGATGAGGACTCTGGTA
FGFR3CCCAGAACCCTGACCAAGTACCCAGAACCCTGACCAAGTA
FGFR4CGAGGCATGCAGTATCTGGCCAAAGTCAGCGATCTTCATCAC
α-SMAAGCCAGTCGCCATCAGGAACGGGAGCATCATCACCAGCAA
Pro collagen ICAGCGGAGAGTACTGGATCGACTGACCTGTCTCCATGTTGCA
Pro collagen IIITGCCATTGCTGGAGTTGGAGAAGACATGATCTCCTCAGTGTTGA

GAPDH: glyceraldehyde 3-phosphate dehydrogenase; TGF-β1: transforming growth factor-β1; FGF23: fibroblast growth factor 23; FGFR: FGF receptor; α-SMA: α-smooth muscle actin

GAPDH: glyceraldehyde 3-phosphate dehydrogenase; TGF-β1: transforming growth factor-β1; FGF23: fibroblast growth factor 23; FGFR: FGF receptor; α-SMA: α-smooth muscle actin

Immunohistological analysis

Fibroblasts were fixed with 4% paraformaldehyde 72 hours after treatment with 10 ng/mL TGF-β1 and 25 ng/mL FGF23. Fixed cells were stained with primary antibody (1% of α-SMA [ab7817, Abcam, Cambridge, UK] and 0.4% of vimentine [ab92547, Abcam] in TPBS/BSA solution) at 4°C overnight. Samples were then incubated in a goat anti-mouse IgG secondary antibody for 1 hr at room temperature. The slides were rinsed in DPBS and counterstained with 4,6-diamidino-2-phenylindole (DAPI) in mounting medium (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Images were captured on a fluorescence microscope (Keyence, Osaka, Japan)

Statistical analysis

Data are presented as mean ± standard error (SEM) of independent experiments. Statistical analyses were performed between two groups by Wilcoxon–Mann-Whitney U test and among multiple groups by one-way analysis of variance (ANOVA) followed by Kruskal-Wallis test. A p value of <0.05 was considered significant.

Results

FGF23 mRNA expression was upregulated in PAB rat fibrotic heart

We comprehensively analyzed the expression profiles of 29215 rat genes in the right ventricles of control and PAB rats using the Affymetrix GeneChip® Rat Gene 1.0 ST Array (Affymetrix). The expression levels of 19 genes in the F+ group were up-regulated more than 1.5-fold relative to their levels in the F- group (Table 2). Among these genes, we focused on fibrosis growth factor (FGF) 23 because a previous study had reported that FGF23 plays an important role in cardiac hypertrophy [8]. We found, however, that the expression levels of FGF23 mRNA in the F- group were equivalent to those in the sham-operated group, suggesting that hypertrophy itself is not a key factor in increasing the expression levels of FGF23 mRNA in the rat heart. PAB did not change the expression levels of other members of the FGF superfamily (S1 Fig). The FGF23 up-regulation in the F+ group was also confirmed through real-time PCR (Fig 1A). Although no clear changes in any FGF receptors (FGFRs) were observed through microarray analysis, the expression levels of FGFR1 mRNA were significantly higher in the F+ group compared to the F- group in RT-PCR analysis (Fig 1B). In contrast, the expression levels of FGFR2, FGFR3 and FGFR4 were comparable between the F+ group and the F- group (Fig 1B). Levels of α-Klotho, which is known to work as an FGF23 receptor with FGFR1 in the kidney, were comparable among the three groups (Fig 1C).
Table 2

Fold changes of gene expression levels.

Gene symbolF-/ShamF+/ShamF+/F-
FMGC729730.91.771.97
Hbb0.861.631.89
Olr7110.861.611.87
Hbb/Hbb0.891.641.85
RGD15602421.152.111.83
Nppa0.931.671.79
Thbs41.322.21.66
Mcpt20.991.611.63
Cpa30.991.61.61
Serpina3n0.981.561.6
RGD15594590.971.551.6
Eraf0.891.411.59
Olr15980.841.341.58
Olr8501.161.841.58
Ncam11.151.811.58
Fgf231.011.591.57
Tmem1190.961.481.54
Hba-a20.871.351.54
Olr14180.731.11.52

Microarray analysis in right ventricular without fibrosis (F-) or with fibrosis (F+). F-/sham: Fold changes of F- from sham-operated group. F+/sham: Fold changes of F+ from sham-operated group. F+/F-: Fold changes of F+ from F- group.

Fig 1

Relative mRNA expression levels in right ventricles of pulmonary artery banding model rats.

(A) Expression of FGF23. (B) Expression of FGFR1, 2, 3 and 4. (C) Expression of Klotho. Values are means ± SEM; n = 4–6 for each.

Relative mRNA expression levels in right ventricles of pulmonary artery banding model rats.

(A) Expression of FGF23. (B) Expression of FGFR1, 2, 3 and 4. (C) Expression of Klotho. Values are means ± SEM; n = 4–6 for each. Microarray analysis in right ventricular without fibrosis (F-) or with fibrosis (F+). F-/sham: Fold changes of F- from sham-operated group. F+/sham: Fold changes of F+ from sham-operated group. F+/F-: Fold changes of F+ from F- group.

FGF23 mRNA is more highly expressed in fibroblasts than in cardiomyocytes

We then sought to determine which cell type could be responsible for the up-regulation of FGF23 mRNA in the cardiomyocytes and fibroblasts that were isolated from adult rat ventricles. Real-time PCR analysis revealed that the expression levels of FGF23 mRNA were significantly higher in cardiomyocytes than in fibroblasts (Fig 2A). In contrast, the expression levels of FGFR1 mRNA were significantly lower in cardiomyocytes than in fibroblasts (Fig 2B).
Fig 2

Relative mRNA expression levels in cardiomyocytes and fibroblasts as measured by RT-PCR.

(A) Expression of FGF23. (B) Expression of FGFR1. Values are means ± SEM; n = 6 for each. (*) P <0.05.

Relative mRNA expression levels in cardiomyocytes and fibroblasts as measured by RT-PCR.

(A) Expression of FGF23. (B) Expression of FGFR1. Values are means ± SEM; n = 6 for each. (*) P <0.05.

FGF23 promoted myofibroblast transformation in the presence of TGF-β1

Cultured fibroblasts from adult rat ventricles were treated with TGF-β1 and/or FGF23 for three days. We found that TGF-β1 tended to increase the expression levels of α-SMA mRNA in a dose-dependent manner (Fig 3A), whereas FGF23 did not change the expression levels of α-SMA mRNA up to 50 ng/mL (Fig 3B). We then examined the synergic effect of FGF23 on TGF-β1-induced α-SMA up-regulation. In the presence of 25 ng/mL FGF23 in combination with 25 ng/mL of TGF-β1, the expression levels of α-SMA mRNA were increased (Fig 3C). On the other hand, the expression levels of pro collagen I and III, were not changed in the presence of 25 ng/mL FGF23 in combination with 10 ng/mL of TGF-β1 (Fig 3D and 3E). In the presence of FGF23, α-SMA expression reached maximal levels even with only 10 ng/mL TGF-β1; these α-SMA levels were comparable with those seen in the 50 ng/mL TGF-β1 (Fig 4). Immunohistological analysis revealed that FGF23 alone did not affect the morphology or α-SMA expression of fibroblasts (Fig 5A and 5B). Nevertheless, TGF-β1 treatment clearly increased the size of each fibroblast and tended to increase the ratio of α-SMA-positive cells (Fig 5C). Moreover, α-SMA-positive cells were further increased in fibroblasts treated with both TGF-β1 and FGF23 compared with those treated with TGF-β1 alone (Fig 5D).
Fig 3

mRNA expression levels in fibroblasts as measured by RT-PCR.

(A) α-SMA expression levels after treatment with TGF-β1 (n = 6). (B) α-SMA expression levels after treatment with FGF23 (n = 6). (C) α-SMA expression levels after treatment with combination of FGF23 and TGF-β1 (n = 5). (D) pro collagen I expression levels after treatment with a combination of FGF23 and TGF-β1 (n = 5). (E) pro collagen III expression levels after treatment with a combination of FGF23 and TGF-β1 (n = 5), Values are means ± SEM.

Fig 4

α-SMA mRNA expression levels in fibroblasts treated with FGF23 and various doses of TGF-β1.

Relative α-SMA mRNA expression levels 3 days after treatment with a combination of 25 ng/mL FGF23 and various doses of TGF-β1 as measured by RT-PCR. Values are means ± SEM. n = 5 for each.

Fig 5

Immunohistological staining of fibroblasts.

(A) Control. (B) After treatment with 25 ng/mL FGF23. (C) After treatment with 10 ng/mL TGF-β1. (D) After treatment with both 25 ng/mL FGF23 and 10 ng/mL TGF-β1. Red: α-SMA; Green: vimentine; Blue: nuclear staining with 4, 6-diamidino-2-phenylindole (DAPI). Scale bar indicates 500 μm.

mRNA expression levels in fibroblasts as measured by RT-PCR.

(A) α-SMA expression levels after treatment with TGF-β1 (n = 6). (B) α-SMA expression levels after treatment with FGF23 (n = 6). (C) α-SMA expression levels after treatment with combination of FGF23 and TGF-β1 (n = 5). (D) pro collagen I expression levels after treatment with a combination of FGF23 and TGF-β1 (n = 5). (E) pro collagen III expression levels after treatment with a combination of FGF23 and TGF-β1 (n = 5), Values are means ± SEM.

α-SMA mRNA expression levels in fibroblasts treated with FGF23 and various doses of TGF-β1.

Relative α-SMA mRNA expression levels 3 days after treatment with a combination of 25 ng/mL FGF23 and various doses of TGF-β1 as measured by RT-PCR. Values are means ± SEM. n = 5 for each.

Immunohistological staining of fibroblasts.

(A) Control. (B) After treatment with 25 ng/mL FGF23. (C) After treatment with 10 ng/mL TGF-β1. (D) After treatment with both 25 ng/mL FGF23 and 10 ng/mL TGF-β1. Red: α-SMA; Green: vimentine; Blue: nuclear staining with 4, 6-diamidino-2-phenylindole (DAPI). Scale bar indicates 500 μm.

FGF23-induced α-SMA up-regulation was suppressed by FGFR1 inhibition

The FGFR1 inhibitor SU5402 decreased the α-SMA mRNA expression level in fibroblasts treated with both TGF-β1 and FGF23, but did not affect fibroblasts in the absence of any treatment or in the presence of TGF-β1 alone (Fig 6A). Down-regulation of FGFR1 by siRNA also tended to attenuate the expression levels of α-SMA mRNA in fibroblasts treated with both TGF-β1 and FGF23 (Fig 6B).
Fig 6

Relative α-SMA mRNA expression levels in fibroblasts after inhibition or down-regulation of FGFR1.

Relative α-SMA mRNA expression levels in fibroblasts 3 days after treatment with FGF23 and/or TGF-β1. (A) After treatment with FGFR1 inhibitor SU5402 (n = 5). (B) After down-regulation of FGFR1 (n = 4). N/C: Negative control; F: 25 ng/mL FGF23; T: 10 ng/mL TGF-β1. Values are means ± SEM.

Relative α-SMA mRNA expression levels in fibroblasts after inhibition or down-regulation of FGFR1.

Relative α-SMA mRNA expression levels in fibroblasts 3 days after treatment with FGF23 and/or TGF-β1. (A) After treatment with FGFR1 inhibitor SU5402 (n = 5). (B) After down-regulation of FGFR1 (n = 4). N/C: Negative control; F: 25 ng/mL FGF23; T: 10 ng/mL TGF-β1. Values are means ± SEM.

Discussion

The most significant finding of the present study is that FGF23 can be induced from cardiomyocytes in the rat heart under a profibrotic condition. Our study indicates that hypertrophic stimuli may not be sufficient to induce FGF23 in the heart, although a number of previous studies have demonstrated that FGF23 is associated with myocardial hypertrophy [8-10]. In this regard, Slavic et al. demonstrated that genetic deletion of FGF23 did not affect the pathophysiology of pressure overload-induced cardiac hypertrophy [11]. Hao et al. were the first, to our knowledge, to demonstrate that FGF23 instead promotes myocardial fibrosis in mice through the activation of β-catenin [12]. They showed that FGF23 promotes proliferation, collagen I and III synthesis, and β-catenin activation in an ischemic condition. Importantly, they suggested that endogenous cardiac FGF23 promotes myocardial fibrosis after myocardial infarction or ischemia reperfusion, but not under normal conditions, through induction of paracrine signaling pathways. Furthermore, our results are consistent with those of a recent study by Leifheit-Nestler et al. [13] demonstrating that FGF23 induced from cardiac myocytes promoted cardiac fibrosis via the profibrotic crosstalk between cardiac myocytes and fibroblasts. Although Leifheit-Nestler et al. indicated that FGF23 itself works as a profibrotic factor [13], our results suggested that FGF23 itself did not have profibrotic action but rather synergistically activated fibroblasts in the presence of TGF-β1, which is known to induce myofibroblast trans-differentiation via the Smad-3 and Wnt signaling pathways [14]. It should be noted that Leifheit-Nestler et al. found that the profibrotic effects of FGF23 were weaker than those of TGF-β1 and that they did not examine the possibility of a synergic effect between FGF23 and TGF-β1 [13]. In keeping with Hao et al.’s study [12], we assume that FGF23 promotes fibrosis under profibrotic conditions such as ischemia or hypoxia. Importantly, Leifheit-Nestler et al. demonstrated that FGF23 was elevated in the hearts of human patients with end-stage chronic kidney disease through a comparative analysis of fibrosis-related gene expression profiling in human myocardial tissues [13]. Although trans-differentiation to myofibroblast was suggested, the expression levels of pro collagen I and III mRNAs were not clearly changed in our study. The expression levels of collagen have been reported to be increased early in response to stimuli and then decreased [15, 16]. It is possible that the expression levels of collagen have already peaked out as we measured them at 72 hours after treatments. FGF23 is mainly secreted from osteoblasts and has an endocrine effect on the kidney through activation of FGFR1/klotho co-receptor complexes to regulate phosphate and mineral homeostasis [17]. In addition to its main action, the role of FGF23 in cardiac dysfunction is also attracting considerable attention because an increase in plasma FGF23 levels is associated with the risk of heart failure and circulating FGF23 is considered a possible biomarker for heart failure [18-20]. FGF23 has also been proposed to be secreted from hearts [21, 22]. Moreover, we found that FGF23 is highly expressed in cardiomyocytes compared with fibroblasts. This suggests that FGF23 has a paracrine effect on myofibroblasts in which FGFR1 is highly expressed. In support of that hypothesis, we demonstrated that FGFR1 inhibition or down-regulation affects FGF23 function to promote cardiac fibrosis. Furthermore, we found that the expression levels of FGFR1 mRNA were significantly higher in the fibrotic hearts as measured by RT-PCR analysis, but not as measured by DNA microarray analysis. This discrepant result between RT-PCR and DNA microarray analyses could be due to the lower detection sensitivity of DNA microarray analysis. In keeping with this finding, the paracrine effect of FGF23 has already been demonstrated in other organs such as the kidney [23, 24], vessels [25], and endothelial cells [26]. It would be intriguing to examine how FGF23 could be induced in a profibrotic condition. The present study suggests that hypertrophic stimuli are not sufficient to up-regulate FGF23 mRNA expression levels. Leifheit-Nestler et al. recently demonstrated that the activation of renin-angiotensin II-aldosterone signaling plays an important role in FGF23 induction in the heart and that both signaling pathways synergistically contribute to cardiac remodeling [13]. Although we did not observe any changes in the mRNA expression levels of genes related to renin-angiotensin II-aldosterone signaling in our DNA microarray analysis, further study is required to clarify whether renin-angiotensin II-aldosterone signaling is the sole factor inducing FGF23 in cardiomyocytes. In this regard, our DNA microarray analysis revealed the up-regulation of other genes whose roles in fibrosis have not been examined. Therefore, investigating the interactions between FGF23 and these genes would be an interesting future study. In conclusion, using an animal model that clearly distinguishes between non-fibrotic and fibrotic hypertrophy in the right ventricle, we identified FGF23 as a paracrine factor secreted from cardiomyocytes to promote cardiac fibrosis under a condition in which TGF-β1 is activated. FGF23 could be a possible target of treatments intended to prevent fibrosis following myocardial hypertrophy.

Fold changes of gene expression levels in FGF families.

Microarray analysis in right ventricular without fibrosis (F-) or with fibrosis (F+). (TIF) Click here for additional data file. 20 Jan 2020 PONE-D-19-34439 Fibrosis growth factor 23 is a promoting factor for cardiac fibrosis in the presence of transforming growth factor-β1 PLOS ONE Dear Prof Minamisawa, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Mar 05 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Michael Bader Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements: Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: It is well-known that FGF23 induces LVH, but the molecular mechanism remains unclear. In this manuscript, the authors have identified that FGF23 as a paracrine factor secreted from cardiomyocytes to promote cardiac fibrosis under conditions in which TGF-β1 is activated. It is an interesting article in the field. There are a few of concerns about the manuscript. Major Concern: 1. What is the level of serum FGF23 (including Sham, F-, and F+ groups) in the rat model of cardiac hypertrophy by pulmonary artery banding compared with control rat? 2. What is the level of serum Klotho (including Sham, F-, and F+ groups) in the rat model of cardiac hypertrophy by pulmonary artery banding compared with control rat? 3. Are there any differences of FGF23, FGFR1, 2, 3 and 4, and klotho expressions in fibroblasts verse in cardiomyocytes from Sham, F-, and F+ groups? 4. A panel of fibrosis- or EMT-related gene expressions should be examined in Figure 3, 4 and 6 by real-time RT-PCR analysis, such as Collagen I, TGF-β, α-SMA, Vimentin, and Snail1. Minor Concern: 1. In Table 2, the authors are suggested to clarify the experimental groups (F-/Sham? F+/Sham? and F+/F-?). 2. English editing is needed for publication. Reviewer #2: In the manuscript "Fibrosis growth factor 23 is a promoting factor for cardiac fibrosis in the presence of transforming growth factor-β" by Kazuhiro Kuga et al,the authors investigate that FGF23 and FGFR1 were both highly expressed in the fibrotic hearts of rat. FGF23 synergistically promoted the activation of fibroblasts with TGF-β transforming fibroblasts into myofibroblasts via FGFR1. The findings are relevant to the field. Although the draft is technically sound with appropriate methods of analyses, several questions raised by reviewers and additional issues have not been fully addressed: 1. As far as this reviewer knows, pulmonary artery banding, which was previously established by the authors, was not really a typical mouse model of cardiac remodeling. Did the authors assessed the FGF23 expression, myocardial hypertrophy and cardiac fibrosis in left ventricle? 2. How did the authors come to the total number of samples? Were power analysis done before experiments? The reason for the variable sample sizes should be explained (Such as Fig. 1, n = 4-6 for each group). Were there technical failures that would otherwise affect interpretation or generalizations of the data? 3. The expression levels of FGFR1 mRNA were significantly higher in the fibrotic hearts. However, no change of FGFR1 was observed through the DNA microarray analysis. Please elaborate the possible reasons in the discussion. 4. Since the right ventricle of rat were used for the DNA microarray analysis, why the authors still choose to use the whole ventricle but not the the right ventricle of adult rat for cell isolation? 5. In Fig. 4, α-SMA expression reached maximal levels with 10 ng/mL TGF-β. Is there a dose-dependent effect of TGF-β on α-SMA expression in fibroblasts by using lower dose levels of TGF-β? 6. For Fig. 1C, Fig. 3, Fig. 4 and Fig. 6, are any of these statistically significant? Authors should provide accurate P values for all statistical analyses. 7. Line 176: “…reported that FGF23 plays an important role in cardiac hypertrophy”, where are the references? ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 25 Feb 2020 Dr. Joerg Heber Editor-in-Chief, PLoS One Dear Dr. Heber, We are grateful for the opportunity to revise our manuscript (PONE-D-19-34439), titled “Fibrosis growth factor 23 is a promoting factor for cardiac fibrosis in the presence of transforming growth factor-beta” and for the reviewers’ helpful comments. We were delighted to learn that you and the reviewers consider our work to be important. We have responded to each of the reviewers’ comments in detail (please see our “Responses to the reviewers’ comments”), and have modified the manuscript accordingly. There is one thing for which we must apologize to the editor and the reviewers regarding the unclear explanation of our statistical analysis methods in the previous version. Given the opportunity to reexamine our statistical analysis, we reconsidered the methods we had chosen. Since the sample size was small and the data were not normally distributed, we now consider that a non-parametric test would be more appropriate for our research. Therefore, we reevaluated our data using the Wilcoxon–Mann-Whitney U test or one-way analysis of variance (ANOVA) followed by the Kruskal-Wallis test. Despite this reevaluation, our results were not changed. It is our hope that the present version satisfies all of the editor’s and reviewers’ requests. The authors would like to sincerely thank you and the reviewers for your time and commitment. We believe that the revised version of our manuscript is much improved, and it is our hope that it will be deemed suitable for publication in your esteemed journal. Best regards, Susumu Minamisawa Point-by-point responses to the reviewers’ comments Response to Reviewer 1: We thank Reviewer 1 for his/her thorough review of the manuscript and positive comments on our findings. We have responded to each of Reviewer 1’s criticisms and have modified the manuscript accordingly. It is our hope that the revised version is now deemed acceptable. Major concern 1. What is the level of serum FGF23 (including Sham, F-, and F+ groups) in the rat model of cardiac hypertrophy by pulmonary artery banding compared with control rat? Unfortunately, we did not collect blood from PAB model rats because we only noted the relation between FGF23 and fibrosis after PAB model rats had been sacrificed. Moreover, we think that the paracrine mechanism of FGF23 is important in the present study. Therefore, we think that the measurement of serum FGF23 levels is not critical for our study. We appreciate Reviewer 1's suggestion and would like to examine the serum FGF23 levels in PAB model rats in our future research. 2. What is the level of serum Klotho (including Sham, F-, and F+ groups) in the rat model of cardiac hypertrophy by pulmonary artery banding compared with control rat? Serum Klotho was not measured in PAB model rats for the same reasons mentioned in comment 1. The physiological role of serum Klotho in the heart is unclear, and we do not suspect a mechanism mediated by Klotho. Therefore, we think that Klotho measurement is not critical for our study. 3. Are there any differences of FGF23, FGFR1, 2, 3 and 4, and klotho expressions in fibroblasts verse in cardiomyocytes from Sham, F-, and F+ groups? The expression levels of FGF23, FGFRs and Klotho in PAB rats were not measured separately in cardiomyocytes or fibroblasts, and unfortunately there are no remaining samples of PAB rat hearts. It is possible that the expression levels of FGF23 and FGFR1 are different in PAB rats, and we would like to check this point in our future research. Thank you for this useful comment. 4. A panel of fibrosis- or EMT-related gene expressions should be examined in Figure 3, 4 and 6 by real-time RT-PCR analysis, such as Collagen I, TGF-β, α-SMA, Vimentin, and Snail1. Thank you for your comment. We have added the results of RT-PCR analysis of pro collagen I and III to Fig 3 and added the relevant primer information to Table 1. The expression levels of pro collagen I and III mRNAs were not apparently changed by TGF-�1 and/or FGF23. To clarify the mechanism by which FGF23 contributes to fibrosis, further research is definitely needed. Minor concern 1. In Table 2, the authors are suggested to clarify the experimental groups (F-/Sham? F+/Sham? and F+/F-?). Thank you for this comment. We have added an explanation of this in the footnote to Table 2. 2. English editing is needed for publication. We have had a professional scientific editor who is also a native English speaker carefully review the manuscript a second time. Responses to Reviewer 2: We would like to thank Reviewer 2 for his/her thorough review of the manuscript and positive comments on our findings. We have responded to each of Reviewer 2’s comments and have modified the manuscript accordingly. It is our sincere hope that the revised version is deemed acceptable. General comments 1. As far as this reviewer knows, pulmonary artery banding, which was previously established by the authors, was not really a typical mouse model of cardiac remodeling. Did the authors assessed the FGF23 expression, myocardial hypertrophy and cardiac fibrosis in left ventricle?. We did not measure FGF23 levels in the left ventricle in PAB rats because there were no cases of hypertrophy or fibrosis in the left ventricles of PAB rats. We agree with Reviewer 2 that this should be the next step in investigating FGF23 levels in a typical animal model of left ventricular remodeling, and we hope to pursue this in our future research. 2. How did the authors come to the total number of samples? Were power analysis done before experiments? The reason for the variable sample sizes should be explained (Such as Fig. 1, n = 4-6 for each group). Were there technical failures that would otherwise affect interpretation or generalizations of the data? Thank you for the important comment. The number of samples was four in the F- and sham groups examined for FGFR3 in Fig. 1B as well as in the F+ group examined for Klotho in Fig. 1C, while it was six for all other experimental settings in Fig. 1. The reason why not all sample sizes were N=6 was due to technical error. We did not conduct a power analysis before the experiments. 3. The expression levels of FGFR1 mRNA were significantly higher in the fibrotic hearts. However, no change of FGFR1 was observed through the DNA microarray analysis. Please elaborate the possible reasons in the discussion. The magnitude of the changes in this study were relatively small for DNA microarray analysis. The difference in detection sensitivity is one possible reason why no increase in FGFR1 was detected in microarray analysis although an increase was detected in RT-PCR. We now mention this possibility in the Discussion section of the revised manuscript. 4. Since the right ventricle of rat were used for the DNA microarray analysis, why the authors still choose to use the whole ventricle but not the the right ventricle of adult rat for cell isolation? For the in-vitro experiment using normal adult rats in our laboratory, we expected that the responses to TGF-�1 would not be different between the right and left ventricles. Therefore, we used whole ventricles to obtain the largest possible sample size. 5. In Fig. 4, α-SMA expression reached maximal levels with 10 ng/mL TGF-β. Is there a dose-dependent effect of TGF-β on α-SMA expression in fibroblasts by using lower dose levels of TGF-β? We checked the α-SMA expression in the presence of 1 ng/mL TGF-�� with 25 ng/mL FGF23 in our preliminary study; α-SMA was still increased to almost the same level observed in the presence of 10 ng/mL TGF-� with 25 ng/mL FGF23, suggesting that a much smaller amount of TGF-�1 would be effective in the presence of FGF23. In future research, we would like to confirm the dose dependency using a wider range of dosages. 6. For Fig. 1C, Fig. 3, Fig. 4 and Fig. 6, are any of these statistically significant? Authors should provide accurate P values for all statistical analyses. In Figs 1C, 3, 4 and 6, there was no statistical significance (P>0.05). We added information on the P value to the title of Fig 1 as it had previously been omitted. 7. Line 176: “…reported that FGF23 plays an important role in cardiac hypertrophy”, where are the references? We added the relevant reference (Faul C et. al., J Clin Invest; 2011) on Line 176. 26 Mar 2020 PONE-D-19-34439R1 Fibrosis growth factor 23 is a promoting factor for cardiac fibrosis in the presence of transforming growth factor-β1 PLOS ONE Dear Prof Minamisawa, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript discussing the point still raised by reviewer 1. We would appreciate receiving your revised manuscript by May 10 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Michael Bader Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: (No Response) ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Type I Collagen should be upregulated with othe EMT markers. Why was the Type I collagen not upregulated with alpha-SMA in the experiment? It is not consistent with your hypothesis. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 2 Apr 2020 Point-by-point responses to the reviewers’ comments Response to Reviewer 1: We thank Reviewer 1 for his/her thorough review of the manuscript. We have responded to Reviewer 1’s comment and have modified the manuscript accordingly. It is our hope that the revised version is now deemed acceptable. 1. Type I Collagen should be upregulated with the EMT markers. Why was the Type I collagen not upregulated with alpha-SMA in the experiment? It is not consistent with your hypothesis. Thank you for pointing out the important issue. We also think that collagen should be increased as alpha-SMA is up-regulated. Collagen has been reported to be increased early in response to stimuli and then be decreased (*see the references below). We measured the expression levels of mRNAs at 72 hours after stimuli and this might be too late to catch the changes in the type I collagen expression. We have mentioned this possibility in the Discussion section of the revised manuscript and would like to confirm this in our future research. * Smith RL, Lin J, Trindade MC, Shida J, Kajiyama G, Vu T, et al. Time-dependent effects of intermittent hydrostatic pressure on articular chondrocyte type II collagen and aggrecan mRNA expression. .J Rehabil Res Dev. 2000;37(2):153-61. * Xiaodong Pan, Zhongpu Chen, Rong Huang, Yuyu Yao, and Genshan Ma. Transforming Growth Factor β1 Induces the Expression of Collagen Type I by DNA Methylation in Cardiac Fibroblasts. PLoS One. 2013; 8(4): e60335. doi: 10.1371/journal.pone.0060335 Submitted filename: Response to Reviewers2.doc Click here for additional data file. 3 Apr 2020 Fibrosis growth factor 23 is a promoting factor for cardiac fibrosis in the presence of transforming growth factor-β1 PONE-D-19-34439R2 Dear Dr. Minamisawa, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Michael Bader Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 9 Apr 2020 PONE-D-19-34439R2 Fibrosis growth factor 23 is a promoting factor for cardiac fibrosis in the presence of transforming growth factor-β1 Dear Dr. Minamisawa: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Michael Bader Academic Editor PLOS ONE
  26 in total

1.  FGF23 induces left ventricular hypertrophy.

Authors:  Christian Faul; Ansel P Amaral; Behzad Oskouei; Ming-Chang Hu; Alexis Sloan; Tamara Isakova; Orlando M Gutiérrez; Robier Aguillon-Prada; Joy Lincoln; Joshua M Hare; Peter Mundel; Azorides Morales; Julia Scialla; Michael Fischer; Elsayed Z Soliman; Jing Chen; Alan S Go; Sylvia E Rosas; Lisa Nessel; Raymond R Townsend; Harold I Feldman; Martin St John Sutton; Akinlolu Ojo; Crystal Gadegbeku; Giovana Seno Di Marco; Stefan Reuter; Dominik Kentrup; Klaus Tiemann; Marcus Brand; Joseph A Hill; Orson W Moe; Makoto Kuro-O; John W Kusek; Martin G Keane; Myles Wolf
Journal:  J Clin Invest       Date:  2011-10-10       Impact factor: 14.808

2.  Activation of Cardiac Fibroblast Growth Factor Receptor 4 Causes Left Ventricular Hypertrophy.

Authors:  Alexander Grabner; Ansel P Amaral; Karla Schramm; Saurav Singh; Alexis Sloan; Christopher Yanucil; Jihe Li; Lina A Shehadeh; Joshua M Hare; Valentin David; Aline Martin; Alessia Fornoni; Giovana Seno Di Marco; Dominik Kentrup; Stefan Reuter; Anna B Mayer; Hermann Pavenstädt; Jörg Stypmann; Christian Kuhn; Susanne Hille; Norbert Frey; Maren Leifheit-Nestler; Beatrice Richter; Dieter Haffner; Reimar Abraham; Johannes Bange; Bianca Sperl; Axel Ullrich; Marcus Brand; Myles Wolf; Christian Faul
Journal:  Cell Metab       Date:  2015-10-01       Impact factor: 27.287

3.  Metabolomic profiling analysis reveals chamber-dependent metabolite patterns in the mouse heart.

Authors:  Daisuke Shimura; Gaku Nakai; Qibin Jiao; Kota Osanai; Kasumi Kashikura; Keiko Endo; Tomoyoshi Soga; Nobuhito Goda; Susumu Minamisawa
Journal:  Am J Physiol Heart Circ Physiol       Date:  2013-06-21       Impact factor: 4.733

4.  Transforming growth factor-beta function blocking prevents myocardial fibrosis and diastolic dysfunction in pressure-overloaded rats.

Authors:  Fumitaka Kuwahara; Hisashi Kai; Keisuke Tokuda; Mamiko Kai; Akira Takeshita; Kensuke Egashira; Tsutomu Imaizumi
Journal:  Circulation       Date:  2002-07-02       Impact factor: 29.690

5.  Transcription profiles of the ductus arteriosus in Brown-Norway rats with irregular elastic fiber formation.

Authors:  Yi-Ting Hsieh; Norika Mengchia Liu; Eriko Ohmori; Tomohiro Yokota; Ichige Kajimura; Toru Akaike; Toshio Ohshima; Nobuhito Goda; Susumu Minamisawa
Journal:  Circ J       Date:  2014-03-19       Impact factor: 2.993

6.  FGF23 is synthesised locally by renal tubules and activates injury-primed fibroblasts.

Authors:  Edward R Smith; Sven-Jean Tan; Stephen G Holt; Tim D Hewitson
Journal:  Sci Rep       Date:  2017-06-13       Impact factor: 4.379

7.  Transforming growth factor β1 induces the expression of collagen type I by DNA methylation in cardiac fibroblasts.

Authors:  Xiaodong Pan; Zhongpu Chen; Rong Huang; Yuyu Yao; Genshan Ma
Journal:  PLoS One       Date:  2013-04-01       Impact factor: 3.240

8.  Genetic Ablation of Fgf23 or Klotho Does not Modulate Experimental Heart Hypertrophy Induced by Pressure Overload.

Authors:  Svetlana Slavic; Kristopher Ford; Magalie Modert; Amarela Becirovic; Stephan Handschuh; Andreas Baierl; Nejla Katica; Ute Zeitz; Reinhold G Erben; Olena Andrukhova
Journal:  Sci Rep       Date:  2017-09-12       Impact factor: 4.379

9.  FGF23 promotes myocardial fibrosis in mice through activation of β-catenin.

Authors:  Huixin Hao; Xixian Li; Qingman Li; Hairuo Lin; Zhenhuan Chen; Jiahe Xie; Wanling Xuan; Wangjun Liao; Jianping Bin; Xiaobo Huang; Masafumi Kitakaze; Yulin Liao
Journal:  Oncotarget       Date:  2016-10-04

10.  FGF23/FGFR4-mediated left ventricular hypertrophy is reversible.

Authors:  Alexander Grabner; Karla Schramm; Neerupma Silswal; Matt Hendrix; Christopher Yanucil; Brian Czaya; Saurav Singh; Myles Wolf; Sven Hermann; Jörg Stypmann; Giovana Seno Di Marco; Marcus Brand; Michael J Wacker; Christian Faul
Journal:  Sci Rep       Date:  2017-05-16       Impact factor: 4.379

View more
  7 in total

1.  Fibroblast Growth Factor 23 Stimulates Cardiac Fibroblast Activity through Phospholipase C-Mediated Calcium Signaling.

Authors:  Ting-Wei Lee; Cheng-Chih Chung; Ting-I Lee; Yung-Kuo Lin; Yu-Hsun Kao; Yi-Jen Chen
Journal:  Int J Mol Sci       Date:  2021-12-23       Impact factor: 5.923

2.  FGF23, a novel muscle biomarker detected in the early stages of ALS.

Authors:  Ying Si; Mohamed Kazamel; Michael Benatar; Joanne Wuu; Yuri Kwon; Thaddaeus Kwan; Nan Jiang; Dominik Kentrup; Christian Faul; Lyndsy Alesce; Peter H King
Journal:  Sci Rep       Date:  2021-06-08       Impact factor: 4.379

Review 3.  The Complexity of FGF23 Effects on Cardiomyocytes in Normal and Uremic Milieu.

Authors:  Andreja Figurek; Merita Rroji; Goce Spasovski
Journal:  Cells       Date:  2021-05-20       Impact factor: 6.600

Review 4.  The Multifunctional Contribution of FGF Signaling to Cardiac Development, Homeostasis, Disease and Repair.

Authors:  Farhad Khosravi; Negah Ahmadvand; Saverio Bellusci; Heinrich Sauer
Journal:  Front Cell Dev Biol       Date:  2021-05-14

5.  Characterizing Neonatal Heart Maturation, Regeneration, and Scar Resolution Using Spatial Transcriptomics.

Authors:  Adwiteeya Misra; Cameron D Baker; Elizabeth M Pritchett; Kimberly N Burgos Villar; John M Ashton; Eric M Small
Journal:  J Cardiovasc Dev Dis       Date:  2021-12-21

6.  Biomarkers associated with rhythm status after cardioversion in patients with atrial fibrillation.

Authors:  Pascal B Meyre; Stefanie Aeschbacher; Steffen Blum; Gian Voellmin; Peter M Kastner; Elisa Hennings; Beat A Kaufmann; Michael Kühne; Stefan Osswald; David Conen
Journal:  Sci Rep       Date:  2022-01-31       Impact factor: 4.379

7.  Comprehensive Expression Analysis of Cardiac Fibroblast Growth Factor 23 in Health and Pressure-induced Cardiac Hypertrophy.

Authors:  Fiona Eitner; Beatrice Richter; Saskia Schwänen; Malgorzata Szaroszyk; Isabel Vogt; Andrea Grund; Thomas Thum; Joerg Heineke; Dieter Haffner; Maren Leifheit-Nestler
Journal:  Front Cell Dev Biol       Date:  2022-01-18
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.