Literature DB >> 32313428

Gene expression kinetics of the yellow head virus in experimentally infected Litopenaeus vannamei.

Yenelli Cedano-Thomas1, Jorge De La Rosa-Vélez1, Jean Robert Bonami2, Francisco Vargas-Albores3.   

Abstract

The yellow head virus (YHV) has been reported to be one of most pathogenic viruses for cultivated shrimp; however, serious problems have only been reported in farms in south and southeastern Asian. Recently, a YHV strain was detected in Litopenaeus vannamei cultivated in Mexican farms that lacked virus-associated mortalities or epizooties, and the animals were apparently healthy. The identity of the virus was confirmed by sequencing replicative and structural protein-encoding regions and comparing with homologous virus sequences. Phylogenic relationships and genetic distances were also determined and, although some differences were observed, an influence on virulence was uncertain. In addition, the expression levels of several transcripts (3CLPRO, POL, GP64 and GP116) were evaluated by quantitative real-time polymerase chain reaction during an experimental infection. Although the transcript showed varying kinetics, viral genes were expressed in infected L. vannamei, demonstrating the replicative capability of this YHV strain.
© 2009 The Authors. Aquaculture Research © 2009 Blackwell Publishing Ltd.

Entities:  

Keywords:  3CLPRO; Nidovirales; Roniviridae; YHV; expression kinetics; glycoproteins; polymerase

Year:  2009        PMID: 32313428      PMCID: PMC7159739          DOI: 10.1111/j.1365-2109.2009.02434.x

Source DB:  PubMed          Journal:  Aquac Res        ISSN: 1355-557X            Impact factor:   2.082


Introduction

Shrimp aquaculture has undergone a rapid expansion in recent decades. However, bacterial and viral infections represent a major constraint affecting the industry due to significant economic losses. The yellow head virus (YHV) and the white spot syndrome virus have been reported to be the most dangerous viruses for cultivated shrimp (Durand, Tang & Lightner 2000), and besides virulence, the epizooties are typically associated with poor management and/or environmental conditions. Yellow head virus epizooties cause up to 100% mortality 3–5 days after virus introduction (Wongteerasupaya, Sriurairatana, Vicker, Akrajamorn, Boonsaeng, Panyim, Tassanakajon, Withyachumnarnkul & Flegel 1995), and an effective treatment is not available. In addition to its high virulence and infectiveness, YHV is a very risky virus (Boonyaratpalin, Supamattaya, Kasornchandra, Direkbusaracom, Aekpanithanpong & Chantanachookin 1993), as it is also able to naturally infect other shrimp populations, which can then act as natural reservoirs (Lu, Tapay, Brock & Loh 1994; Ma, Overstreet & Jovonovich 2009). Based on its morphology, YHV was originally classified as a Baculovirus (Boonyaratpalin ). However, by genomic taxonomy, YHV is classified as an Okavirus, a member of the Roniviridae family that characteristically has a (+)ssRNA genome (Cowley, Dimmock, Wongteerasupaya, Boonsaeng, Panyim & Walker 1999; Cowley, Dimmock, Spann & Walker 2000; Sittidilokratna, Hodgson, Cowley, Jitrapakdee, Boonsaeng, Panyim & Walker 2002; González, Gomez‐Puertas, Cavanagh, Gorbalenya & Enjuanes 2003; Gorbalenya, Enjuanes, Ziebuhr & Snijder 2006; Pasternak, Spaan & Snijder 2006). The insertion of YHV into Nidovirales was supported by similarities in both its genomic organization and its replication mechanism (1997, 2006, 2008). In Nidovirales, including YHV, the key biochemical machinery for virus replication is typically encoded by a large discontinuous open reading frame (ORF), referred to as ORF1a and ORF1b, which overlap in a small area containing a−1 ribosomal frameshift (2000, 2006, 2002). Other genomic regions include ORF2, which encodes the nucleocapsid and envelope proteins (2002, 2004, 2006, 2003, 2006); ORF3, which encodes the precursors for the envelope glycoproteins GP116 and GP64 (2002, 2003); and ORF4, which is interrupted by multiple stop codons (1997, 2008). Even though considerable progress has been made in the characterization of the YHV genome (Sittidilokratna ), information on viral gene expression during infection is limited. Using specific monoclonal antibodies, expression of the envelope (GP64 and GP116) and nucleocapsid (N) proteins was monitored in five species of prawns (Macrobrachium rosenbergii, Macrobrachium lanchesteri, Macrobrachium sintangense, Palaemon styliferus and Penaeus serrifer) that had been experimentally infected (Longyant, Sithigorngul, Chaivisuthangkura, Rukpratanporn, Sithigorngul & Menasveta 2005). Penaeus serrifer, P. styliferus and M. sintangense exhibited mild to moderate YHV infection symptoms 3 days postinjection, and the infection severity was significantly reduced after 10 days. Conversely, M. rosenbergii and M. lanchesteri did not show symptoms, even though viral proteins were detected in the first hour post‐infection, suggesting a natural resistance to YHV infection and/or the ability to efficiently eliminate the virus. A similar response was observed in Penaeus (Metapenaeus) affinis and Pseudocalea brevicornis, suggesting that some prawns are able to gradually eliminate the virus by an unknown mechanism (Longyant, Sattaman, Chaivisuthangkura, Rukpratanporn, Sithigorngul & Sithigorngul 2006). Interestingly, experimentally infected Litopenaeus vannamei and Litopenaeus stylirostris show symptoms and mortality profiles similar ot those of naturally infected cultivated Penaeus monodon (Lu, Tapay, Loh, Brock & Gose 1995; Spann, Cowley, Walker & Lester 1997; Pantoja & Lightner 2003). The establishment of viral replication kinetics from early stages of infection is fundamental to understanding the infectious capacity of YHV including those strains that apparently do not affect cultured shrimp. A YHV strain (YHV‐Lv) was isolated from L. vannamei cultivated in Mexican farms without virus‐associated mortalities or epizooties, and with the animals apparently being healthy (de la Rosa‐Velez, Cedano‐Thomas, Cid‐Becerra, Mendez‐Payan, Vega‐Perez, Zambrano‐Garcia & Bonami 2006). Therefore, the aim of this study was to sequence the genome of the YHV‐Lv strain and compare it with the sequences of virulent strains to determine genomic differences that could explain the lack of infectivity and/or virulence in L. vannamei. In addition, the replication capability of the YHV‐Lv strain was determined by monitoring the expression of genes involved in viral replication and those encoding structural proteins during development of the experimental infection.

Materials and methods

YHV isolates

The American YHV strain (YHV‐Lv) was obtained from apparently healthy YHV‐positive L. vannamei cultivated in shrimp farms from the Pacific coast of México (de la Rosa‐Velez ). The Asian YHV strain (YHV‐Pm), recovered from P. monodon during a YHV epizooty in Thailand in 1996 and reproduced in Litopenaeus setiferus, was provided by the Ecosystemes Lagunaires Laboratory, Université Montpellier 2, France.

Sequencing

To determine genomic sequences, 11 primer sets were designed based on the GenBank sequences for YHV and GAV (GenBank accession nos. AF227196, AF148846, AY052786; DQ067891, AF540644). These regions correspond to genes associated with viral replication, such as the chymotrypsin‐like protease 3CLPRO (3CLPRO), peptide 1 (PEP1), RNA‐dependent RNA polymerase, helicase (HEL) and structural components, including motif 1 (M1), nucleocapsid protein p20 and the spike glycoprotein that contains glycoproteins GP116 and GP64, as well as the no‐encoding ORF4. In addition, the overlapping region (ORF1a/1b) was amplified with primers published by Sittidilokratna (Table 1).
Table 1

 Primers used for PCR amplification and sequencing of YHV fragments

ORFCodified proteinPrimer nameSequence T a (°C)Location
1aProtease 3CLPRO 3CLPRO–F qPCR 5′‐TGCTCTCGGTTACACGCAGACC‐3′588321–8342
3CLPRO–R qPCR 5′‐AGGTCAGCAATACGGATCTGTG‐3′9466–9445
1a/1bReplicative polyprotein (fragment)ORF1a/1b‐F * 5′‐TGCTTTGACCGTGTTGACGTCGATGAAGAC‐3′5611 985–12 014
ORF1a/1b‐R * 5′‐TGACGGTCTTCGTGTAGTTTAGTGTATGCGACTGG‐3′13 605–13 571
1bPeptide1PEP1‐F5′‐CGTATTGCATCGAACGTCACTG‐3′5612 945–12 966
PEP1‐R5′‐CAAGATCACTAATAACGCCTGATGC‐3′13 829–13 805
PolymerasePOL‐F qPCR 5′‐GCATCGGCATCACTAAACTCCC‐3′5614 004–14 025
POL‐R qPCR 5′‐CAATGGAAGAGAAGACTCGCTCG‐3′14 981–14 959
HelicaseHEL1‐F5′‐CTCCTTAGTTTCATTGCTGCTCG‐3′5616 253–16 275
HEL1‐R5′‐ATGTGTGGACAGTGTAGATGGGG‐3′17 414–17 392
HEL2‐F5′‐CATCTTCGCTACTCTCCAGTCAACC‐3′5616 894–16 918
HEL2‐R5′‐TTTTCACCACCTTTACCGCCCCAG‐3′17 958–17 935
HEL3‐F5′‐ATGTAGCCGTCAGTCGTTTCCG‐3′5617 493–17 514
HEL3‐R5′‐GAATGCTTGGATGATACCGTCG‐3′18 556–18 535
2NucleocapsidN‐F5′‐AACGAAGTGACTATGCGCCTTCCA‐3′5720 266–20 289
N‐R5′‐ATGATATGCGAGCCTGGTGCAGAA‐3′21 316–21 293
3Glycoprotein 116GP116‐F qPCR 5′‐GCCCATGATAGACATAAGCTCACAC‐3′6621 549–21 573
GP116‐R qPCR 5′‐ACATCATGTTGTAACGGCAATCG‐3′22 629–22 607
Glycoprotein 64GP64‐F qPCR 5′‐CAGGTGCCGTTTGGATTTCTG‐3′5624 847–24 867
GP64‐R qPCR 5′‐CGTCGCATTGTGTGATAACTGG‐3′25 770–25 749
4NoneORF4‐F5′‐ACACAGGCACTACCGTTTCTC‐3′4226 347–26 365
ORF4‐R5′‐TTTTTTTTTTTTTTTTTTTTTTTTT‐3′

The location in the YHV genome (GenBank accession no. EU987200) is indicated.

Sittidilokratna .

T a, primer annealing temperature; qPCR, quantitative PCR; PCR, polymerase chain reaction; ORF, open reading frame.

Primers used for PCR amplification and sequencing of YHV fragments The location in the YHV genome (GenBank accession no. EU987200) is indicated. Sittidilokratna . T a, primer annealing temperature; qPCR, quantitative PCR; PCR, polymerase chain reaction; ORF, open reading frame. Pleopods from animals infected with YHV‐Lv or YHV‐Pm were homogenized, total RNA was purified by TRIzol (Gibco BRL, San Francisco, CA, USA) and cDNA was synthesized using oligo‐dT and reverse transcriptase SuperScript™ II (Invitrogen, Carlsbad, CA, USA), following the manufacturer's instructions. Viral genes were amplified by polymerase chain reaction (PCR) (iCyclerTM thermocycler, Bio‐Rad, Carlsbad, CA, USA) using specific primers. The final reaction volume of 25 μL contained 2.75 μL 10 × PCR buffer (50 mM KCl, 10 mM Tris‐HCl; pH 8.3), 1 μL of 10 mM dNTPs, 0.75 μL of 50 mM MgCl2, 1 μL of 10 mM each primer, 0.25 μL of Taq DNA polymerase 5 U μL−1 (Go‐Taq®, Madison, WI, USA) and 2 μL cDNA. The optimal annealing temperature for each primer pair was determined previously by gradient temperature, and the PCR conditions were: one cycle of 94 °C/5 min; 30 cycles of 94 °C/30 s, primer annealing temperature/30 s and 72 °C/1 min; followed by extension at 72 °C for 7 min. Polymerase chain reaction products were separated by electrophoresis in a 1% agarose gel, stained with ethidium bromide (1 μg mL−1) and visualized under UV light. Polymerase chain reaction products were purified using the Wizard® PCR Preps DNA Purification System (Promega, Madison, WI, USA), and thoroughly sequenced in both directions by SeqXcel® (DNA Sequencing Services, San Diego, CA, USA). The sequences from each strain were edited using Chromas Pro V 1.14 before comparison using discontinuous megablast against the nr/nt nucleotide database (NCBI, http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). Fragments amplified with primer pairs HEL1, HEL2 and HEL3 were assembled using the program bioedit v7.0.9 (Hall 1999).

Sequences comparison

All sequences from YHV‐Lv and YHV‐Pm were aligned using clustal x (Thompson, Gibson, Plewniak, Jeanmougin & Higgins 1997) and compared individually with the corresponding viral region from other YHV strains (Cholburi, Thailand and Chachoengsao) isolated from Thailand farms (GenBank accession nos. EU487200, AF148846, AY052786, EF156405, AF148846, DQ067891 and AF540644) and sequences from GAV (GenBank accession no. AF227196), another member of the Nidovirales family. Sequences from the severe acute respiratory syndrome (SARS) virus (GenBank accession nos. DQ898174 and AY502924) and transmissible gastroenteritis virus (TGV) (GenBank accession nos. AY335549, DQ201447 and Y00560) were also included as external groups. Genetic distances were calculated using the program mega 4.1 (Kumar, Tamura & Nei 2004), and phylogenic trees were generated for each amplified region following the neighbour‐joining method (Saitou & Nei 1987) with a bootstrap of 1000 repeats.

Inoculum doses and detection in different tissues

To estimate the adequate viral inoculum for 100% survival up to 96 h, different dilutions (1:2–1:50) of homogenized pleopods were prepared from YHV‐Lv‐infected shrimp (L. vannamei) as described previously (de la Rosa‐Velez ). Groups of 10 juvenile shrimp L. vannamei were inoculated in the third abdominal segment with 20 μL of different viral dilutions of YHV‐Lv. As a control, 10 animals were inoculated with negative‐YHV shrimp tissue. Typical symptoms of YHV infection and mortality were monitored up to 125 h postinoculation. To determine the best tissue for the detection of viral genes, 10 juveniles (18–20 g) were infected with YHV‐Lv, and samples from haemocytes, the haepatopancreas, muscle, gill, intestine and pleopods were taken at different times post‐inoculation. Total RNA was isolated from each tissue, and cDNA was synthesized as above. Peptide 1, as a representative viral replication gene, was amplified by PCR, using the following conditions: one cycle of 94 °C/5 min; 30 cycles of 94, 56 °C/30 s and 72 °C/1 min; followed by extension at 72 °C for 7 min. Polymerase chain reaction products were separated by electrophoresis in 7.5% acrylamide gels and silver stained (Sanguinetti, Dias Neto & Simpson 1994).

YHV‐Lv gene expression kinetics

Amplified and sequenced fragments corresponding to the polymerase, the protease 3CLPRO and two glycoproteins (GP116 and GP64) were cloned into pCR2.1®‐TOPO® vector, and these vectors were used to transform One Shot® Mach1™‐T1R Competent Cells (TOPO TA Cloning®, Invitrogen). After being expanded in LB medium, the plasmid was purified using the Wizard® SV 96 Plasmid DNA Purification System (Promega) and its concentration and quality were estimated by optical density at 260 and 280 nm. To confirm, each insert was sequenced in both directions by Millegen® Biotechnologies (Labège, France), and was then used to prepare standard curves for quantitative real‐time polymerase chain reaction (qPCR). To follow viral infection, 150 shrimp (average weight, 20 g) were inoculated in the third abdominal segment with 20 μL of a 1:25 viral dilution. Pleopods from 10 L. vannamei were sampled at different times (1.5, 3, 6, 12, 24, 48, 72 and 96 h) and pooled, and total RNA was purified. In addition, pleopods from five animals were sampled at 24, 48, 72 and 96 h, and the total RNA was individually purified. In both cases, cDNA was synthesized by reverse transcriptase, as described above. Quantitative real‐time polymerase chain reaction was performed using a Lightcycler® system (Roche Molecular Biomedicals, Indianapolis, IN, USA). 0.5 μL of each primer (3CLPRO, POL, GP116 and GP64) was separately mixed with 2 μL of Master Mix SYBR Green (Qiagen, Valencia, CA, USA) and 1 μL of cDNA, in triplicate. The PCR protocol was: one denaturing cycle (95 °C/600 s), 40 amplification cycles (95 °C/15 s, 55 °C/20 s for 3CLPRO, POL and GP64; or 68 °C/20 s for GP116) and one elongation cycle (72 °C/20 s). Melting curve analysis was performed using 0.5 °C increments from 65 to 95 °C.

Results and discussion

Yellow head virus has been responsible for devastating mortalities in cultured shrimp, causing a negative impact on this industry. Although P. monodon is the most affected shrimp, other penaeids have also been reported to be susceptible to different grades of virulence. For example, when a mixed culture of P. monodon, Pterocarpus indicus and Penaeus merguensis was affected by YHV, significant mortalities were observed only in P. monodon, and this phenomenon was explained as a host specificity (Mohan, Shankar, Kulkarni & Sudha 1998). In addition, YHV has been found in non‐cultivable shrimp (P. merguiensis, Acetes sp., P. styliferus and P. ensis) without typical disease symptoms (Durand ). This apparent host specificity and wide distribution in natural non‐cultivable shrimp populations is indicative of the immense natural reservoirs and their role in YHV dissemination. An apparently non‐virulent strain of YHV, YHV‐Lv, was recovered from healthy L. vannamei cultivated in Mexican farms, where YHV‐associated epizooties have not been reported (de la Rosa‐Velez ), leading to questions about the different virulence of YHV‐Lv and other YHV strains. Also, the Asian strain, YHV‐Pm, was recovered from P. monodon during a YHV epizooty in Thailand, in 1996, and it has been experimentally reproduced in L. setiferus. The first step was to sequence several portions of the viral genome. The genomic regions (3CLPRO, POL, HEL, GP64, GP116, N, PEP1, ORF1a/1b and M1) to be sequenced were selected based on the importance of these genes in viral metabolism, the availability of similar sequences and/or similarity to related viruses (2000, 2002, 2003, 2006, 2003). In addition, primers published by Sittidilokratna were used for amplification and sequencing of the region containing the slippage and involving an RNA pseudo knot located immediately downstream of this slippery sequence. The optimal annealing temperature was determined by temperature gradient, for each primer pair. Most annealed between 56 and 58 °C, while temperatures of 42 and 66 °C were used for ORF4 and GP116 respectively (Table 1). After PCR, the corresponding fragments were sequenced as many times as necessary to obtain complete and error‐free sequences. The sequences amplified with primer pairs HEL1, HEL2 and HEL3 were assembled by overlapping extremes. The sequences were deposited in GenBank with accession nos. DQ978355 to DQ978363 and EU977577 to EU977584. The amplified sequences corresponding to GP116, N, POL, 3CLPRO and ORF4 were identical in both Lv and Pm strains and only slight differences were observed in GP64 (0.1%), ORF1ab (0.43%) and HEL‐M1 (0.04%).

Sequence analysis and phylogenic comparison

Each sequence from YHV‐Lv and YHV‐Pm was compared with those reported for other strains (Cholburi, Thailand and Chachoengsao), and sequences of GAV were included as references. When available, sequences from either the SARS virus or TGV were included as an external group. After CLUSTAL alignment, genetic distances were determined (Table 2) and phylogenic trees (Fig. 1) were generated using neighbour joining and bootstrap. In both cases, a close phylogenic relationship could be established among YHV strains, forming a compact group (genetic distances 0.0085–0.0182), which is associated with GAV but different from the external groups. In sum, all determined sequences from YHV‐Lv and YHV‐Pm were identical (99.93% similar), and both showed high similarity (98%) to the corresponding sequences reported for other strains of YHV (Cholburi and Chachoengsao). There is also a moderate similarity to GAV, another Nidovirales. Thus, the high similarity found in a large portion of the virus genome confirms the identity of the YHV strain isolated in Mexican farms.
Table 2

 Genetic distance of YHV‐LvA strain isolated from Mexican farms and reported YHV strains, GAV and coronavirus by Jukes–Cantor method

Genomic regionYHV ChachoengsaoYHV CholburiGAVCoronavirus
3CLPRO 0.0231NA0.22421.0273
ORF1a/1b0.0244NA0.21171.1079
PEP10.0179NA0.2352NA
POL0.0149NA0.15230.9304
HEL‐M10.0208NA0.19990.9778
N0.01500.00750.22321.0573
GP1160.01980.01110.49081.1350
GP640.01040.00690.2614NA
ORF40.0041NA0.1501NA

NA, not available sequence; YHV, yellow head virus; ORF, open reading frame; PEP1, peptide 1.

Figure 1

 Phylogenic analysis. Sequenced genomic regions of YHV‐Lv were compared with available sequences of YHV strains and the sequence of GAV. Coronavirus was included as an external group. The tree was constructed using the neighbour‐joining method (bootstrap=1000). YHV, yellow head virus.

Genetic distance of YHV‐LvA strain isolated from Mexican farms and reported YHV strains, GAV and coronavirus by Jukes–Cantor method NA, not available sequence; YHV, yellow head virus; ORF, open reading frame; PEP1, peptide 1. Phylogenic analysis. Sequenced genomic regions of YHV‐Lv were compared with available sequences of YHV strains and the sequence of GAV. Coronavirus was included as an external group. The tree was constructed using the neighbour‐joining method (bootstrap=1000). YHV, yellow head virus. The Nidovirales glycoproteins (GPs) have a central role in the induction of the host immune response and are targets for protective immunity (Spaan, Cavanagh & Horzinek 1988). They have also been demonstrated to determine virulence (Phillips, Chua, Lavi & Weiss 1999; Almazan, Gonzalez, Penzes, Izeta, Calvo, Plana‐Duran & Enjuanes 2000) because they are key proteins in the recognition of host cells and the fusion of the virus to the cellular membrane (1997, 2003, 2006). Similar functions have been reported for the surface glycoproteins GP64 and GP116 of YHV and GAV (2002, 2003). Focusing the genomic analysis on the GP116‐encoding region, significant differences could be observed between any YHV strain and the less aggressive pathogen GAV, suggesting the role of this protein in virulence. The YHV‐Lv GP116‐encoding region seems to be more similar to the Cholburi than the Chachoengsao corresponding genomic region. Interestingly, the Chachoengsao strain was responsible for epizooties in Thailand (Wijegoonawardane, Cowley, Phan, Hodgson, Nielsen, Kiatpathomchai & Walker 2008), while there have not been reports of extended damage associated with the Cholburi strain. Additionally, several low pathogenic genotypes of YHV have been identified in India, Malaysia, Mozambique, Thailand and Philippines (Sittidilokratna ), and in an earlier work, the authors associated such a behaviour with detectable differences in the GP116 N‐terminal region (Sittidilokratna, Chotwiwatthanakun, Wijegoonawardane, Unajak, Boonnad, Wangnai, Jitrapakdee, Cowley & Walker 2009).

Experimental infection

Because the YHV‐Lv strain shows low infectivity towards L. vannamei under natural conditions, experimental inoculation was used to confirm the occurence of the viral replication. To determine viral gene expression through an experimental infection, the viral doses for inoculation were established as the maximal viral dilution able to induce all disease symptoms, but still showing 100% survival of animals up to 96 h. This assay was performed by inoculation of 90 apparently healthy animals with different viral dilutions (10 animals per dilution) and the time for maintaining 100% of living animals was recorded. As expected, with high doses (up to dilution 1:10), mortality was observed in the first 36 h; however, when dilutions 1:20 and 1:30 were used, the first death of an animal was recorded at 84 and 108 h respectively. By non‐linear regression analysis, the 1:24 dilution was determined to be the highest viral concentration where 100% survival could be observed at 96 h after inoculation (Fig. 2), and then this dilution was used in all subsequent experiments.
Figure 2

 Determination of viral doses. Different viral dilution was inoculated and the time for maintaining 100% of living animals was recorded. The maximal viral dilution to reach 100% survival up to 96 h postinoculation (discontinue line) was estimated from a non‐linear regression (solid line).

Determination of viral doses. Different viral dilution was inoculated and the time for maintaining 100% of living animals was recorded. The maximal viral dilution to reach 100% survival up to 96 h postinoculation (discontinue line) was estimated from a non‐linear regression (solid line). Next, the best tissue for sampling was determined by inoculation of 10 animals with 20 μL of adequate viral dilutions, and the amplification of the PEP1 gene was performed in haemocytes, the haepatopancreas, muscle, gill, gut and pleopods obtained at 24 and 96 h postinoculation. Polymerase chain reaction products were separated on acrylamide gels and silver stained, which is a fast, inexpensive and sensitive method (Fig. 3a). Amplification was not observed in the haepatopancreas and gut (Fig. 3b), while a moderate signal was obtained in the muscle and gill. However, intense amplification of the PEP1 gene was observed in pleopods from 36 to 96 h (Fig. 3c) and haemocytes at 24 and 96 h (Fig. 3d). Although haemocytes and pleopods showed the most intense signal, the isolation of total RNA from haemocytes requires a careful manipulation of the sample to avoid degranulation or cellular lysis. Thus, pleopods were selected as the sampling tissue for monitoring the expression of 3CLPRO, POL, GP116 and GP64 as a measurement of the replicative capability of the YHV‐Lv.
Figure 3

 Detection of yellow head virus (YHV) genes in shrimp tissues. Polymerase chain reaction products were separated by electrophoresis in 7.5% acrylamide gels and silver stained. (a) Summary of YHV detection in different tissues by amplification of peptide 1; band intensity is represented by ‘+’. (b) M, muscle; I, Gut; G, gill and H, haepatopancreas. (c) Pleopods at 4–96 h. (d) Haemocytes at 24, 36 and 96 h.

Detection of yellow head virus (YHV) genes in shrimp tissues. Polymerase chain reaction products were separated by electrophoresis in 7.5% acrylamide gels and silver stained. (a) Summary of YHV detection in different tissues by amplification of peptide 1; band intensity is represented by ‘+’. (b) M, muscle; I, Gut; G, gill and H, haepatopancreas. (c) Pleopods at 4–96 h. (d) Haemocytes at 24, 36 and 96 h. The selected genes, 3CLPRO, POL, GP116 and GP64, are relevant in viral replication and interaction with the host cell. In Nidovirales, 3CLPRO is responsible for the post‐translational release of key proteins for replication (2002, 2006, 2008, 2000, 2003), while the polymerase is the most conserved gene and thus has been used to propose a common ancestor for all Nidovirales (2000, 1997, 2002). As in all Nidovirales studied, the structural glycoproteins, GP116 and GP64, are involved in the interaction with host cells (2003, 2006, 2003), and specifically, GP116 has been associated with the pathogenic behaviour of several YHV strains (Sittidilokratna ). According to the results shown in Fig. 4, three phases could be defined: (a) the first phase from 1.5 to 24 h postinoculation; (b) the second phase from 24 to 72 h postinoculation, is characterized by a fast increment in gene expression (> two orders); and (c) the third phase from 72 to 96 h postinoculation, shows a slow increment in gene expression. The gene expression profile is compatible with the viral replication model, initially proposed by Ellis and Delbruck (1939). The first phase, associated with virus adsorption and/or penetration, and the third phase, related to virus assembly and release, characteristically show low gene expression, while the second phase is differentiated by a fast increment in gene expression probably due to virus replication.
Figure 4

 Expression of 3CLPRO, POL, GP116 and GP64 transcripts at different times (1.5–96 h postinoculation), quantified by SYBR Green qPCR in 10 animal‐pool samples. The inserts show the quantification of five individual shrimp samples, evaluated from 24 to 96 h.

Expression of 3CLPRO, POL, GP116 and GP64 transcripts at different times (1.5–96 h postinoculation), quantified by SYBR Green qPCR in 10 animal‐pool samples. The inserts show the quantification of five individual shrimp samples, evaluated from 24 to 96 h. In addition, five shrimp were sampled during the second phase (24, 48 and 72 h postinoculation) and analysed individually. Although comparable expression profiles could be established, quantitative differences were detected (Fig. 4) among individuals and, consequently, high dispersion was obtained. For example, at 96 h postinfection, the number of copies of GP64 ranged from 105 to 108, although discrete dispersion was observed for GP116 (105–106) and 3CLPRO (107–108). Then the curve slope from 24 to 72 h, representing the expression rate, was calculated for each gene and each shrimp. Equimolecular concentrations of 3CLPRO and POL coding sequences are expected because they are transcribed together as the replicase polyprotein 1ab, which is encoded by two large overlapping ORFs (ORF1a/1b) that contain the −1 ribosomal frame shift. After transcription, 3CLPRO and POL functional proteins are produced by site‐specific cleavage of the replicase polyprotein 1ab. However, 3CLPRO was highly expressed almost immediately after viral inoculation, increasing to 2.08 × 105 copies μL−1 at 1.5 h, while POL showed a modest expression (≅102 copies μL−1). Afterwards both transcripts displayed similar increasing rates, but maintained the 3CLPRO/POL ratio around 103. Likewise, GP116 and GP64 are encoded by ORF3, but different concentrations of their corresponding transcripts were detected, mainly between 24 and 48 h, when the concentration of the GP64 transcript rapidly increased (Fig. 4). These disparities could not be explained due to the poorly understood replication and transcription mechanisms in Nidovirales where sub‐genomic mRNA and double‐stranded RNA intermediates, as well as the poorly described non‐structural proteins seem to be implicated (2007, 2006). The importance of 3CLPRO for Nidovirales replication has been corroborated by the silencing of this gene in YHVinfected P. monodon, which caused a strong inhibition of viral replication, whereas silencing GP116 and GP64 was less efficient (2005, 2007, 2006, 2003). As shown in Fig. 4, 3CLPRO is highly expressed early, perhaps because this protein is required for creating other functional viral proteins by proteolytic cleavage (Ziebuhr ). On the other hand, transcripts of the structural glycoproteins GP116 and GP64 also showed different concentrations. This could be due to differences in the hydrolytic action of RNases where polyA tails have a degradation‐protective role (1997, 2006). Although each gene showed different expression rates, the mean of the five genes expression rate is the sum of the events that occur during the viral replication. In this way, two shrimp (Org 3 and Org 5) showed a lower viral expression rate (Fig. 5) and this could be associated with individual resistance to virus attachment. Expression of viral genes is associated with viral replication and disease severity; hence, organisms with high viral replication should be more susceptible than those with lower rates of virus replication. Considering that viral replication is complete 24–72 h after inoculation, the slope in this time frame is representative of the gene expression rate and could be used as a measurement of viral susceptibility. Although further experiments are required, viral replication analysis could be used to establish shrimp infection status and expression levels associated with disease.
Figure 5

 Expression rates of 3CLPRO, POL, GP116 and GP64 monitored in five shrimp during the viral replication phase (24–72 h). The mean of the expression rates is also graphed.

Expression rates of 3CLPRO, POL, GP116 and GP64 monitored in five shrimp during the viral replication phase (24–72 h). The mean of the expression rates is also graphed.
  32 in total

1.  Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome.

Authors:  F Almazán; J M González; Z Pénzes; A Izeta; E Calvo; J Plana-Durán; L Enjuanes
Journal:  Proc Natl Acad Sci U S A       Date:  2000-05-09       Impact factor: 11.205

2.  YHV-protease dsRNA inhibits YHV replication in Penaeus monodon and prevents mortality.

Authors:  Supansa Yodmuang; Witoon Tirasophon; Yaowaluck Roshorm; Wanlop Chinnirunvong; Sakol Panyim
Journal:  Biochem Biophys Res Commun       Date:  2006-01-19       Impact factor: 3.575

3.  Yellow head virus from Thailand and gill-associated virus from Australia are closely related but distinct prawn viruses.

Authors:  J A Cowley; C M Dimmock; C Wongteerasupaya; V Boonsaeng; S Panyim; P J Walker
Journal:  Dis Aquat Organ       Date:  1999-05-12       Impact factor: 1.802

4.  Rapid silver staining and recovery of PCR products separated on polyacrylamide gels.

Authors:  C J Sanguinetti; E Dias Neto; A J Simpson
Journal:  Biotechniques       Date:  1994-11       Impact factor: 1.993

5.  Therapeutic inhibition of yellow head virus multiplication in infected shrimps by YHV-protease dsRNA.

Authors:  Witoon Tirasophon; Supansa Yodmuang; Wanlop Chinnirunvong; Nongluk Plongthongkum; Sakol Panyim
Journal:  Antiviral Res       Date:  2006-12-04       Impact factor: 5.970

6.  A virulent isolate of yellow head nidovirus contains a deformed envelope glycoprotein gp116.

Authors:  Nusra Sittidilokratna; Charoonroj Chotwiwatthanakun; Priyanjalie K M Wijegoonawardane; Sasimanas Unajak; Anutara Boonnad; Watcharakorn Wangnai; Sarawut Jitrapakdee; Jeff A Cowley; Peter J Walker
Journal:  Virology       Date:  2008-12-02       Impact factor: 3.616

7.  The gene encoding the nucleocapsid protein of Gill-associated nidovirus of Penaeus monodon prawns is located upstream of the glycoprotein gene.

Authors:  Jeff A Cowley; Lee C Cadogan; Kirsten M Spann; Nusra Sittidilokratna; Peter J Walker
Journal:  J Virol       Date:  2004-08       Impact factor: 5.103

8.  Identification and analysis of gp116 and gp64 structural glycoproteins of yellow head nidovirus of Penaeus monodon shrimp.

Authors:  Sarawut Jitrapakdee; Sasimanas Unajak; Nusra Sittidilokratna; Richard A J Hodgson; Jeff A Cowley; Peter J Walker; Sakol Panyim; Vichai Boonsaeng
Journal:  J Gen Virol       Date:  2003-04       Impact factor: 3.891

9.  RNA transcription analysis and completion of the genome sequence of yellow head nidovirus.

Authors:  Nusra Sittidilokratna; Sirintip Dangtip; Jeff A Cowley; Peter J Walker
Journal:  Virus Res       Date:  2008-06-11       Impact factor: 3.303

10.  Genetic diversity in the yellow head nidovirus complex.

Authors:  Priyanjalie K M Wijegoonawardane; Jeff A Cowley; Thuy Phan; Richard A J Hodgson; Linda Nielsen; Wansika Kiatpathomchai; Peter J Walker
Journal:  Virology       Date:  2008-09-02       Impact factor: 3.616

View more
  1 in total

Review 1.  Viral Shrimp Diseases Listed by the OIE: A Review.

Authors:  Dain Lee; Young-Bin Yu; Jae-Ho Choi; A-Hyun Jo; Su-Min Hong; Ju-Chan Kang; Jun-Hwan Kim
Journal:  Viruses       Date:  2022-03-12       Impact factor: 5.048

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.