Species Variety, Antibiotic Susceptibility Patterns and Prevalence of Enterotoxin Genes in Staphylococci Isolated from Foodstuff in Central Iran.

BACKGROUND: The presence and diversity of Staphylococcus species and their enterotoxin-encoding genes in foodstuffs have not been comprehensively studied in some developing countries. This study aimed to assess the frequency of Staphylococcus spp. and their related virulence factors in foodstuffs in Isfahan, Iran.
METHODS: Overall, 139 foodstuff samples, collected from Isfahan City (center of Iran) from Sep 2015 to Oct 2016, were processed for the presence of Staphylococcus spp. using standard bacteriological procedures and sequence analysis of 16S rRNA gene. Antimicrobial susceptibilities and prevalence of mecA and toxin-encoded genes (sea, seb, sed, see and tsst1 ) were tested for all of the Staphylococcal isolates.
RESULTS: Forty-four Gram-positive cocci were recovered from 139 dairy and meat samples. The most prevalent species were S. vitulinus 25.0% (11/44) and S. aureus 20.5% (9/44); respectively. The most prevalent antimicrobial resistance was noted towards penicillin, cefoxitin and tetracycline. The sec, sea, see and tsst1 genes were found in 19%, 9.5%, 3.5%, and 3.5% of the isolates, respectively.
CONCLUSION: Numerous virulence factors were detected in different Staphylococcus spp. isolated from foodstuffs, more attention should be paid to the presence of the bacteria. Proper hygienic and management practices should be considered in order to increase food safety and prevent extra treatment costs. Copyright© Iranian Public Health Association & Tehran University of Medical Sciences.

Introduction

Food-borne diseases (FBD) are defined by WHO as “diseases of infectious or toxic nature or thought to be caused by food or water consumption” (1). Symptoms vary widely, depending on the etiological agents with diarrhea and vomiting as the most common symptoms (2). Among FBDs, food-borne infections are caused by many microbial pathogens that can contaminate foods. Food-borne poisoning is caused by poisonous chemicals, microbial toxin, or other harmful substances that are present in food (3). On the whole, FBDs are responsible for nearly 76 million illnesses, 325,000 hospitalizations, and 5,200 deaths each year in the world. They account for 14 million illnesses, 60,000 hospitalizations, and 1,800 deaths annually (4).

Staphylococcus strains produce toxins resulting in symptoms ranging from gastrointestinal disorders to paralysis and death (5). Although staphylococcal contamination can be readily eradicated by heat treatment of food, it remains a major cause of FBD (5). Staphylococcus aureus is able to grow in a wide range of temperatures, pH and NaCl concentrations (5, 6). Their resilience in being able to grow under a wide range of temperature, pH and osmolality justifies how S. aureus can be readily present in foodstuffs especially those often manipulated during processing, e.g. sausages, salads, cream-filled bakery items, sandwich equipment and dairy products (5).

Staphylococcal food poisoning (SFP), widely assigned to toxigenic Staphylococcus, takes place following ingestion of at least 1.0 μg of enterotoxin in food (7). The most remarkable virulence factors associated with staphylococci are the heat-stable enterotoxins (SEs) secreted by certain strains. The Staphylococcus Enterotoxins (SEs) are divided into five classical serological types: Staphylococcus Enterotoxin A (SEA), Staphylococcus Enterotoxin B (SEB), Staphylococcus Enterotoxin C (SEC), Staphylococcus Enterotoxin D (SED) and Staphylococcus Enterotoxin E (SEE). However, recently other enterotoxins were reported in the literature, including SEG, SHE, SEI, SER, SES, SET and the enterotoxin-like proteins such as SElK, SElN, SElO, SE1P, SE1Q and SElU (7, 8). Reliable detection of SE genes serves a twofold function. Firstly, it aids genotyping of the coagulase-positive staphylococci (CPS) for epidemiological studies. Secondly, it provides an assessment of the possible occurrence of SE genes in strains of Coagulase-Negative Staphylococci (CNS) often used as starters in food fermentation (8, 9).

The aim of the present study was to investigate the prevalence of Staphylococcus isolates and the toxin sea, seb, sed, see and tsst1 genes as well as their antimicrobial susceptibility patterns in isolates from a variety of food sources collected in Isfahan, Iran.

Materials and Methods

Sampling and identification

In a previous study (10), we had sampled 55 confectionaries for isolation and identification of Staphylococcus species. Forty isolates were recovered samples that belonged to different species (30% (12/40) S. aureus, 17/5% (7/40) S. succinus subsp. casei, 15 (6/40) S. warneri, 7.5% (3/40) S. carnosus, 5% (2/40) S. pasteuri, 5% (2/40) S. vitulinus, 5% (2/40) S. sciuri. 5% (2/40) S. epidermidis, 2.5% (1/40) S. succinus subsp. succinus, 2.5% (1/40) S. lugdonensis, 2.5% (1/40) S. saprophyticus and 2.5% (1/40) S. gallinarum). In the present study, from Sep 2015 to Oct 2016, 139 other foodstuff samples including dairy products (cheese, cottage and yogurt) and meat products (sausages, and hamburgers) belonging to 18 different brands were collected from 29 stores in various parts of Isfahan city (center of Iran). The samples were then processed within 12h of their collection in microbiology laboratory of Isfahan Infection Diseases and Tropical Medicine Research Center. Isolation of Staphylococcus species was performed as written in our prior study (10).

Antimicrobial susceptibility test

The Clinical and Laboratory Standard Institute (CLSI, 2017) reference method for disk diffusion was used for antimicrobial susceptibility test of all Staphylococcus isolates (11). The following antibiotics were tested using the standard antibiotic disks (Mast Group, UK) (concentrations are expressed in μg ml−1): penicillin (10 units), cefoxitin (30), gentamicin (10), tetracycline (30), ciprofloxacin (5), clindamycin (2), trimethoprimsulfamethoxazole (1.25/23.75), chloramphenicol (30), rifampin (5), linezolid (30), levofloxacin (5), and erythromycin (15).

DNA Extraction for Molecular Assays

DNA of all isolates was extracted using boiling method (12). In brief, a few colonies of each isolate were added to 100 μl of TE buffer (10 mM Tris, 1 mM EDTA, pH 7.8) and boiled for 15 min at 100 °C. After centrifugation at 9,000 × g for 5 min at 4 °C, supernatant fluid was transferred into a new sterile tube and stored at −20 °C.

Molecular Identification of Staphylococcus Species

The Staphylococcus spp. isolated from dairy and meat products and identified phenotypically according to conventional methods were further analyzed to the species level by sequence analysis of 16S rRNA gene (13). The sequence data were analysis by the Clustal W v2.0 software and Gen-Bank database (14).

Identification of mecA gene

A PCR reaction was carried out for the amplification of the 310 bp fragment of mecA gene using primers as was shown in Table 1. The PCR reaction mixture (25μL) contained: 4μL of DNA template, 2.5 μL of PCR buffer (×10), 0.75 μL MgCl2 (50 mM), 0.5 μL of dNTPs (10 mM), 1 μL of each primers (2 μL totally), 0.25 μL of Ex-Taq DNA polymerase (5u/μL) and 15 μL distilled water. The PCR conditions were as follows: Initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 30 sec, annealing at 55 °C for 30 sec and extention at 72 °C for 30 sec, and final extension at 72 °C for 7 min (15).

Table 1:

Primers for Amplification of toxin encoding and 16S rRNA genes of Staphylococcus isolates

Gene	Primer	Oligonucleotida sequence (5–3)	Amplicon size(bp)
sea	SEA-1SEA-2	TTGGAAACGGTTAAAACGAAGAACCTTCCCATCAAAAACA	120
seb	SEB-1SEB-2	GGTACTCTATAAGTGCCTGCTTCGCATCAAACTGACAAACG	475
sec	SEC-1SEC-2	AGAACTAGACATAAAAGCTAGGTCAAAATCGGATTAACATTATCC	267
sed	SED-1SED-2	TTTGGTAATATCTCCTTTAAACGCTATATCTTATAGGGTAAACATC	309
see	SEE-1SEE-2	CCTATAGATAAAGTTAAAACAAGCTAACTTACCGTGGACCCTTC	173
Tsst1	TSST1-1TSST1-2	ATGGCAGCATCAGCTTGATATTTCCAATAACCACCCGTTT	350
mecA	MECA-1MECA-2	GTAGAAATGACTGAACGTCCGATAACCAATTCCACATTGTTTCGGTCTAA	310
16S rRNA	27F515R	AGAGTTTGATCMTGGCTCAGTTACCGCGGCKGCTGGCAC	530

Identification of TSST1 and enterotoxins Genes

All Staphylococcus isolates were tested for toxin genes by two specific multiplex PCRs: (I) 120, 309 and 350 bp fragment of the sea, sed, and tsst1 genes; respectively (16), (II) 475, 267, 173 bp fragment of seb, sec, and see genes (17). Specific primers for amplifying the enterotoxin-encoding genes and tsst1 gene by PCR are shown in Table 1.

Results

Isolation and characterization of the isolates

Overall, 44 Gram-positive cocci with a positive catalase reaction were recovered from the 139 dairy and meat samples initially collected from diverse regions in Isfahan, Iran. 72.73% and 27.27% of Staphylococcus spp. were isolated from meat products and dairy products samples, respectively. Based on 16S rRNA gene sequence analysis, these Staphylococcus spp. isolates belonged to 11 validated species: S. vitulinus 25% (11/44), S. aureus 20% (9/44), S. warneri 9% (4/44), S. epidermidis 9% (4/44), S. equorum 9% (4/44), S. succinus subsp. casei 6.8% (3/44), S. saprophyticus 6.8% (3/44), S. pasteuri 4.5% (2/44), S. gallinarum 4.5% (2/44), S. xylosus 2.3% (1/44) and S. simulans 2.3% (1/44).

Antibiotic susceptibility pattern

The results of antibiotic susceptibility test revealed that, all Staphylococcus spp. isolates were susceptible to rifampicin, levofloxacin, ciprofloxacin and gentamicin.

Penicillin: The prevalent resistance towards penicillin was seen in S. pasteuri (100%), S. succinus sub succinus (100%), S. gallinarum (100%) and S. xylosus (100%). S. epidermidis (83.3%), S. warneri (80%), S. aureus (76.2%), S. equorum subsp. linens (75%), S. saprophyticus (75%), S. sciuri subsp. sciuri (50%), S. succinus subsp. casei (50%) and S. vitulinus (7.7%) were next in rank, respectively.

Tetracycline: The most prevalent tetracycline resistance was seen in S. saprophyticus (50%), S. warneri (50%), S. equorum subsp. linens (25%), S. pasteuri (25%), S. succinus subsp. casei (20%), S. epidermidis(16.7 %), S. vitulinus (14.4%), and S. aureus (14.3%) isolates, respectively.

Cefoxitin: S. sciuri subsp. sciuri (100%), S. succinus sub succinus (100%), S. epidermidis (50%), S. equorum subsp. linens (25%), S. succinus subsp. casei (20%), S. warneri (20%) and S. vitulinus (7.7%) had highest resistance for cefoxitin, respectively.

Erythromycin: S. epidermidis (50%), S. equorum subsp. linens (25%), S. saprophyticus (25%), S. warneri (20%), S. succinus subsp. casei (20%) and S. aureus (4.8%) had the most prevalence of resistance, respectively.

Chloramphenicol: Resistance for chloramphenicol was only seen in S. saprophyticus (50%).

Linezolid: S. pasteuri (25%) and S. aureus (4.8%) were non-susceptible to linezolid.

Clindamycin: 20% of S. warneri isolates and 7.7% of S. vitulinus isolates showed resistance for clindamycin.

Trimethoprim & Sulfamethoxazole: The most prevalent Trimethoprim & Sulfamethoxazole resistance was seen in S. epidermidis (33.3%), S. warneri (30%), S. equorum subsp. linens (25%), and S. succinus subsp. casei (10%), respectively.

Screening of mecA gene

Prevalence of mecA gene in all isolates was 38.5% in S. vitulinus, 33.3% in S. epidermidis, 30% in S. warneri, 25% in S. equorum, 10% in S. succinus subsp. casei and 9.5 % in S. aureus. Others Staphylococcus spp. isolates were negative.

Screening of TSST-1 and enterotoxins Genes

All isolates were screened for enterotoxin production and tsst-1 genses by specific PCR (Table 1). sea gene was found in 8 (9.5%) of the 84 isolates of Staphylococcus spp. The sec gene was found in 16 (19%) of the 84 isolates of Staphylococcus spp. Three (3.5%) of the 84 isolates of Staphylococcus spp. were positive for see gene. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. of Staphylococcus spp. Among all isolates, tsst-1 gene was only found in S. aureus (9.5%) and S. saprophyticus (25%). The seb and sed genes were not found in any of the Staphylococcus spp. isolates (Table 2).

Table 2:

Identification of enterotoxin-encoding genes and TSST-1 of Staphylococcus isolates in foodstuff product by molecular methods

Specie	No. of Isolates	sea (%)	seb (%)	sec (%)	sed (%)	see (%)	tsst1 (%)
S. warneri	10	-	-	30	-	-	-
S. succinus sub succinus	1	-	-	-	-	-	-
S. succinus sub casei	10	10	-	-	-	-	-
S. vitulinus	13	-	-	7.7	-	7.7	-
S. pasteuri	4	-	-	25	-	-	-
S. aureus	21	23.8	-	28.6	-	4.8	9.5
S. lugdunensis	1	100	-	-	-	-	-
S. saprophyticus	4	-	-	25	-	-	25
S. epidermidis	6	-	-	17.7	-	-	-
S. gallinarum	3	-	-	33.3	-	-	-
S. carnosus	3	-	-	33.3	-	-	-
S. equorum	4	-	-	25	-	25	-
S. xylosus	1	-	-	-	-	-	-
S. simulans	1	-	-	-	-	-	-
S. sciuri subsp. sciuri	2	50	-	-	-	-	-

Discussion

SFP is an intoxication that results from the consumption of foods containing sufficient amounts of one or several of the preformed SE (18, 19). Foods frequently contaminated with SE include meat and meat products, poultry and egg products, milk and dairy products, bakeries, and sandwich fillings (2, 20). The disease is usually self-limiting and typically resolves within 24–48 h after the onset. However, in some cases, the affliction can be severe enough to lead to hospitalization, particularly in cases involving the elderly, infants, and those with frail health (2, 21).

Identification of Staphylococcus species is quite significant for epidemiological investigations as well as to assess virulence factors such as enterotoxin production and the development of specific management practices to prevent SFPs caused by CNSs (22). V1 region is the best region to differentiate between S. aureus and CNSs (23). In this study, from 139 foodstuff samples collected, 44 (31.6%) isolates belonged to 11 different species and subspecies of Staphylococcus. Prevalence of S. aureus was 20/5%, which was lower than those reported by others (19% to 48.7% range) (24–28). Molecular analysis showed that 27.4% (23/84) of the isolates carried one or more SE genes. Four SE genotypes were detected. The most commonly detected SE genes were sec, sea, see and tsst with 19, 9.5, 3.5 and 3.5 percent occurrence, respectively. The frequent detection of SE genes among Staphylococcus spp. taken from different sources has already been demonstrated by various research groups (28–30). Our results are in agreement with these studies that demonstrated the enterotoxigenicity of more than 40% of the isolates of S. aureus collected from various food products. In contrary to our finding, in China, the most frequently seen SE genes was sea (86.5%, 45/52). Four SE gene profiles were observed, including sea (86.5%), sec-she (5.8%), seb (n=3.8%), and seg-sei (n=3.8%) (31). This discrepancy in frequency rate of SE genes suggests that probably some factors such as differences in food products, diagnostic methods and geographical distribution, may be effective in the variation of results.

Staphylococcus aureus has been known to be frequently resistant to antibiotic therapy due to their capacity to produce an exopolysaccharide barrier and a substantial quantity of antibiotic neutralizing enzyme that limits the antibiotic action (9, 32). Overall, 27% of the isolates were sensitive to all the tested antibiotics and 45% of the strains were shown to be intermediate (according to CLSI, 2017) and resistant to at least 4 antibiotics (data not shown). The isolates collected from dairy products were demonstrated to be most sensitive to the tested antibiotics (80%). No resistance to rifampicin, levofloxacin, ciprofloxacin, gentamicin and clindamycin was observed, while a relatively small percentage of the isolates demonstrated resistance to cefoxitin (14.3%), erythromycin (10.8%), and chloramphenicol (2.4%).

Similar to our finding, the most remarkable resistance was reported against penicillin (96.2%, 50/52) and followed by resistance to tetracycline (28.8%, 15/52) (31). Furthermore, a high level of penicillin-resistance (71.4%) was reported among S. aureus isolates from food samples (33).

In addition, in Brazil, where 227 CoNS isolates were recovered from 35 cheese samples, antibiotic susceptibility pattern of isolates showed a high level of resistance against penicillin (78.5%), and erythromycin (67.8%) which is inconsistent with our results (34).

Conclusion

Characterization of Staphylococcus species and enterotoxin-encoding genes is crucial for epidemiological investigations. Detection of enterotoxin-encoding genes and antibiotic resistance in staphylococcal spp. isolated from food indicated that food may represent a potential health risk.

Ethical considerations

Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.