Literature DB >> 32296287

Hydnaceous fungi of China 8. Morphological and molecular identification of three new species of Sarcodon and a new record from southwest China.

Yan-Hong Mu1,2, Ya-Ping Hu3, Yu-Lian Wei1, Hai-Sheng Yuan1.   

Abstract

Three new stipitate hydnoid fungi, Sarcodon coactus, S. grosselepidotus and S. lidongensis, are described and illustrated, based on morphological characteristics and nuc ITS rDNA + nuc LSU rDNA sequence analyses and a new record, S. leucopus, from China is reported. S. coactus is characterised by ellipsoid to round basidiocarps, reddish-brown to dark brown, felted pileal surface with white and incurved margins, simple-septate and partly short-celled generative hyphae and irregular subglobose, thin-walled, brown basidiospores with tuberculate ornamentation (tuberculi up to 1 μm long). S. grosselepidotus is characterised by infundibuliform to round, occasionally deeply fissured pileus, pale orange to dark ruby pileal surface with ascending and coarse scales, simple-septate generative hyphae and irregular ellipsoid to globose, thin-walled, brown basidiospores with tuberculate ornamentation (tuberculi up to 0.7 μm long). S. lidongensis is characterised by plano-convex to somewhat depressed and regular orbicular pileus, light brown to dark brown pileal surface with adhering squamose and purplish-brown, incurved and occasionally incised margin, cylindrical or broadened below stipe, simple-septate generative hyphae and irregular ellipsoid to subglobose, thin-walled basidiospores with tuberculate ornamentation (tuberculi up to 1 μm long). The absence of the clamp connection is the common morphological characteristic of these three new species; however, S. leucopus, a new record from China, has frequently clamped generative hyphae. Molecular analyses confirm the phylogenetic positions of three new and the new record species. The discriminating characters of these three new species and closely related species are discussed and a key to the species of Sarcodon from China is provided. Yan-Hong Mu, Ya-Ping Hu, Yu-Lian Wei, Hai-Sheng Yuan.

Entities:  

Keywords:  Bankeraceae ; Thelephorales ; ITS and LSU; new species and record; taxonomy

Year:  2020        PMID: 32296287      PMCID: PMC7148386          DOI: 10.3897/mycokeys.66.49910

Source DB:  PubMed          Journal:  MycoKeys        ISSN: 1314-4049            Impact factor:   2.984


Introduction

The genus Quél. ex P. Karst. (1881), together with Coker and Beers ex Pouzar (1955), P. Karst. (1896) and P. Karst. (1881), belong to , of . They are a group of stipitate hydnoid fungi that inhabit the soil (Maas Geesteranus 1975). Species of are ectomycorrhizal fungi which associate with many kinds of angiosperm and gymnosperm trees, especially with and , such as , , , and (Maas Geesteranus 1975; Harrison 1984; Baird 1986; Baird et al. 2013) and usually occur in natural and comparatively undisturbed forests (Arnolds 1989). They can obtain energy from and transport nutrients to the host plants and are of great ecological significance in promoting forest vegetation recovery (Gardes and Bruns 1996; Erland and Taylor 1999). These fungi are vulnerable to impact due to changes in the environment, such as habitat loss, nitrogen deposition, decrease of host tree species and subsequently increased ground temperatures (Arnolds 1989; Otto 1992; Vesterholt et al. 2000; Newton et al. 2002; Arnolds 2010; Baird et al. 2013). In Europe, stipitate hydnoid fungi have been considered one of the most endangered groups of macrofungi and have been included in Red Data Lists (Hrouda 1999; Walleyn and Verbeken 2000; Hrouda 2005; Nitare 2006; Senn-Irlet et al. 2007), which have been used as indicators that forests need to be protected (Ainsworth 2005; Nitare 2019). The genus is characterised by solitary to gregarious, stipitate, pileate basidiocarps, hydnaceous hymenophore, the monomitic hyphal system owning inflating or not inflating hyphae, the presence or absence of clamp connections and irregular ellipsoid to globose, tuberculate basidiospores which are brown in mass. Besides, the dry basidiocarps often produce farinaceous to fragrant or acidic odour (Maas Geesteranus 1971; Baird 1986; Arnolds 2003; Baird et al. 2013). In morphology, is closely related to , but the former usually has soft and fleshy basidiocarps and the latter has hard and corky basidiocarps (Maas Geesteranus 1971; Larsson et al. 2019). The macro-morphology of these two genera often depends on their environmental parameters, such as precipitation, temperature or obstructions. Additionally, the variable growth of basidiocarps makes it difficult to distinguish each other. Therefore, it is essential to support and confirm their identities using molecular sequence data (Baird et al. 2013). Recent molecular phylogenetic analyses reveal that and form paraphyletic lineage and suggest using the spore length as the delimitation between the two genera. species had spore lengths in the range 4.45−6.95 µm, while the corresponding range for was 7.4−9 µm (Larsson et al. 2019). Most species of have been reported from the northern temperate hemisphere (Maas Geesteranus 1971, 1975; Baird 1986; Stalpers 1993; Pegler et al. 1997; Dai 2011) and are commonly found in North America (Harrison 1964, 1984; Baird 1985, 1986; Baird et al. 2013), Netherlands (Maas Geesteranus 1956, 1976), Spain (Pérez-De-Gregorio et al. 2011), France (Pieri and Rivoire 1994), Russia (Baird 1985) and Italy (Caclalli and Caroti 2005). Some species have also been recorded from southern hemisphere, such as New Zealand (Maas Geesteranus 1964, 1971, 1975) and Australia (Mleczko et al. 2011; Magnago et al. 2015; Hahn et al. 2018). Around 59 species have been described or transferred to the genus according to Index Fungorum (http://www.indexfungorum.org/) and MycoBank, but only five taxa have been reported from China (Dai 2011). In addition, some species of have medicinal functions, for instance, lowering cholesterol, antioxidant, antibacterial, anti-tumour, improving immunity etc. (Wu et al. 2019). Investigations of hydnaceous fungi in China have been carried out in recent decades and many specimens have been collected. During the study of these specimens, three undescribed species and a new record species have been identified using morphological characters and phylogenetic analyses of nuc rDNA ITS1-5.8S-ITS2 combined with nuc 28S rDNA sequences. Here, we describe them in this paper.

Materials and methods

Morphological studies

Specimens are deposited at the herbarium of the Institute of Applied Ecology, Chinese Academy of Sciences (IFP). Microscopic procedures follow Mu et al. (2019). Microscopic studies used sections mounted in Cotton Blue (CB): 0.1 mg aniline blue dissolved in 60 g pure lactic acid; CB− = acyanophilous. Amyloid and dextrinoid reactions were tested in Melzer’s reagent (IKI): 1.5 g KI (potassium iodide), 0.5 g I (crystalline iodine), 22 g chloral hydrate, 20 ml distilled water; IKI− = neither amyloid nor dextrinoid reaction. Sections were mounted in 5% KOH (potassium hydroxide) and studied at magnifications up to 1000× using a Nikon Eclipse E600 microscope (Tokyo, Japan) with phase contrast illumination. Dimensions were estimated subjectively with an accuracy of 0.1 μm. In presenting basidiospore size ranges, 5% of the measurements at each end of the range are given in parentheses. The following abbreviations are used in the text: Lm = mean spore length, Wm = mean spore width, Q = range of length/width ratios for specimens studied and n = total number of basidiospores measured from a given number of specimens. The surface morphology for the basidiospores was observed with a Phenom Prox scanning electron microscope (ESEM, Phenom Prox, FEI, The Netherlands) at an accelerating voltage of 10 kV. A thin layer of gold was coated on the samples to avoid charging. Special colour terms are from Rayner (1970) and Munsell (2015).

Molecular procedures and phylogenetic analyses

Fungal taxa and strains used in this study are listed in Table 1. Phire Plant Direct PCR Kit (Thermo Fisher Scientific) procedures were used to extract total genomic DNA from the basidiocarps. Polymerase chain reactions (PCR) were performed on a Bio-Rad T100 Thermal cycler (Bio-RAD Inc). Amplification reactions were performed in a 30 μl reaction mixture using the following final concentrations or total amounts: 0.9 μl template DNA, 15 μl of 2× Phire Plant PCR buffer, 1.5 μl of each primer, 0.6 μl Phire HS II DNA Polymerase and 10.5 μl ddH2O (double distilled water). The nuc rDNA ITS1-5.8S-ITS2 region (ITS) was amplified with the primers ITS1-F (5' CTTGGTCATTTAGAGGAAGTAA 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') (Baird et al. 2013; Loizides et al. 2016). The 28S nuclear rDNA region was amplified with the primers LROR (5' ACCCGCTGAACTTAAGC 3') and LR7 (5' TACTACCACCAAGATCT 3') (Vizzini et al. 2016). The PCR thermal cycling programme conditions were set as follows: initial denaturation at 98 °C for 5 min, followed by 39 cycles at 98 °C for 30 s, × °C (the annealing temperatures for ITS1-F/ITS4 and LROR/LR7 were 57.2 °C and 47.2 °C, respectively) for 30 s, 72 °C for 30 s and a final extension at 72 °C for 1 min. PCR amplification was confirmed on 1% agarose electrophoresis gels stained with ethidium bromide (Stöger et al. 2006). DNA sequencing was performed at the Beijing Genomics Institute (BGI). All newly generated sequences were submitted to GenBank. Additional ITS rDNA and LSU rDNA sequences in the dataset, used to establish phylogenetic relationships, were downloaded from GenBank (http://www.ncbi.nlm.nih.gov/genbank) and UNITE (https://unite.ut.ee/index.php) (Table 1).
Table 1.

Voucher numbers, geographic origins and GenBank accession numbers for the specimens and included, in boldface, are sequences produced in this study.

SpeciesGeographic originVoucher numberGenBank Accessions
ITS 28S
Amaurodon aquicoeruleu AgererAustraliaIsotype in M AM490944 AM490944
Hydnellum aurantiacum (Batsch) P. Karst.NorwayOF29502 MK602713 MK602713
H. aurantiacum NorwayEBendiksen177-07 MK602712 MK602712
H. auratile (Britzelm.) Maas Geest.NorwayOF242763 MK602715 MK602715
NorwayOF294095 MK602714 MK602714
H. caeruleum (Hornem.) P. Karst.NorwayEBendiksen584-11 MK602719 MK602719
NorwayEBendiksen575-11 MK602718 MK602718
H. complicatum BankerUSAREB-329 KC571712
USAREB-71 KC571711
H. concrescens (Pers.) BankerNorwayO-F-251488 UDB036247
H. cristatum (Bres.) StalpersUSAREB-88 KC571718
USAREB-169 JN135174
H. cumulatum K.A. HarrisonFinlandTU115384 UDB011871 UDB011871
EstoniaTU111191 UDB032402
H. cyanopodium K.A. HarrisonUSASEW 85 AY569027
H. diabolus BankerCanadaKAH13873 AF351863
H. dianthifolium LoizidesItalyML902162HY KX619420
CyprusML61211HY KX619419
H. earlianum BankerUSAREB-75 KC571724
USAREB-375 JN135179
H. ferrugineum (Fr.) P. Karst.SwedenELarsson197-14 MK602722 MK602722
NorwayOF297319 MK602720 MK602720
H. ferrugipes CokerUSAREB-176 KC571727
USAREB-324 KC571728
H. geogenium (Fr.) BankerNorwayOF66379 MK602723 MK602723
NorwayOF296213 MK602724 MK602724
H. gracilipes (P. Karst.) P. Karst.SwedenGB-0113779 MK602727 MK602727
SwedenELarsson219-11 MK602726 MK602726
H. mirabile (Fr.) P. Karst.SwedenSLund140912 MK602730 MK602730
SwedenELarsson170-14 MK602729 MK602729
H. peckii BankerNorwayEBendiksen567-11 MK602733 MK602733
SwedenELarsson174-14 MK602732 MK602732
H. pineticola K.A. HarrisonUSAREB-94 KC571734
H. piperatum Coker ex Maas Geest.USAREB-67 KC571720
USAREB-332 JN135173
H. regium K.A. HarrisonUSASEW 93 AY569031
H. scleropodium K.A. HarrisonUSAREB-352 KC571740
USAREB-3 JN135186
H. scrobiculatum (Fr.) P. Karst.USAREB-78 JN135181
H. spongiosipes (Peck) PouzarUSAREB-52 JN135184
UKRBG Kew K(M)124986 EU784269
H. suaveolens (Scop.) P. Karst.NorwaySSvantesson877 MK602736 MK602736
SwedenELarsson8-14 MK602735 MK602735
H. subsuccosum K.A. HarrisonUSASEW 55 AY569033
Sarcodon amygdaliolens Rubio CasasSpainSC-2011 JN376763
S. aspratus (Berk.) S. Ito DQ448877
AF335110
S. coactus ChinaWei 8094 MN846278 MN846287
ChinaShi 181 MN846279 MN846288
S. fennicus (P. Karst.) P. Karst.SwedenSWesterberg110909 MK602739 MK602739
NorwayOF242833 MK602738 MK602738
S. fuligineoviolaceus (Kalchbr.) Pat.SwedenBNylen130918 MK602741 MK602741
NorwayAMolia160201 MK602742 MK602742
S. fuscoindicus (K.A. Harrison) Maas Geest.USAOSC 113641 EU669230 EU669280
USAOSC 107844 EU669229 EU669279
S. glaucopus Maas Geest. & Nannf.SwedenEdvinson110926 MK602745 MK602745
SwedenJNitare060916 MK602744 MK602744
S. grosselepidotus ChinaYuan 1247 MN846273
ChinaWei 8120 MN846274 MN846283
ChinaWei 8075 MN846276 MN846285
ChinaWei 8128 MN846277 MN846286
ChinaWei 8097 MN846275 MN846284
S. imbricatus (L.) P. Karst.NorwaySSvantesson355 MK602748 MK602748
SwedenELarsson384-10 MK602747 MK602747
S. joeides (Pass.) BatailleSwedenNitare110829 MK602751 MK602751
SwedenKHjortstam17589 MK602750 MK602750
S. lepidus Maas Geest.SwedenJNitare110829 MK602754 MK602754
SwedenRGCarlsson10-065 MK602752 MK602752
S. leucopus (Pers.) Maas Geest. & Nannf.NorwayOF296099 MK602755 MK602755
SwedenPHedberg080811 MK602757 MK602757
S. leucopus ChinaDai 5686 MN846282 MN846291
S. lidongensis ChinaWei 8365 MN846280 MN846289
ChinaWei 8329 MN846281 MN846290
S. lundellii Maas Geest. & Nannf.NorwayOF295814 MK602760 MK602760
NorwayOF242639 MK602759 MK602759
S. martioflavus (Snell, K.A. Harrison & H.A.C. Jacks.) Maas Geest.SwedenADelin110804 MK602763 MK602763
NorwayOF242435 MK602762 MK602762
S. quercinofibulatus Pérez-De-Greg., Macau & J. CarbóItalyJC-20090718.2 JX271818 MK602773
USATENN MG663244
S. scabripes (Peck) BankerMexicoFCME:23240 EU293829
USAREB-351 JN135191
S. scabrosus (Fr.) P. Karst.NorwayOF292320 MK602766 MK602766
NorwayOF360777 MK602765 MK602765
S. squamosus (Schaeff.) P. Karst.NorwayOF295554 MK602769 MK602769
NorwayOF177452 MK602768 MK602768
S. underwoodii BankerUSAREB-358 JN135189
USAREB-119 KC571782
S. versipellis (Fr.) Nikol.SwedenRGCarlsson11-08 MK602772 MK602772
SwedenRGCarlsson13-057 MK602771 MK602771
Sarcodon sp.SL71 EU627610
TPML20130628-34 MF611700
SFC20140822-38 MF611702
ItalyOTU9 MH681180
New CaledoniaCY13_061 KY774274 KY774274
ChinaLL_119 KX008981
MexicoGO-2009-415 KC152220
New ZealandPDD:105158 KP191971 KP191774
Voucher numbers, geographic origins and GenBank accession numbers for the specimens and included, in boldface, are sequences produced in this study. Nuclear ribosomal RNA genes were used to determine the phylogenetic position of the new species. After PCR amplification, the products were sequenced in both directions and the sequences were assembled using DNAMAN 8.0. DNA sequences were aligned with MUSCLE in MEGA7 (Kumar et al. 2016). Alignments were manually adjusted to allow maximum alignment and minimise gaps. Maximum parsimony and Bayesian analysis were applied to the ITS + LSU dataset. All characters were weighted and gaps were treated as missing data. Maximum parsimony analysis (PAUP* version 4.0b10) was used (Swofford 2002). Trees were inferred using the heuristic search option with tree bisection reconnection (TBR) branch swapping and 1,000 random sequence additions. Max-trees were set to 5000 and no-increase, branches of zero length were collapsed and all parsimonious trees were saved. Clade stability was assessed using a bootstrap (BT) analyses with 1,000 replicates (Gaget et al. 2017). Descriptive tree statistics, tree length (TL), consistency index (CI), retention index (RI), rescaled consistency index (RC) and homoplasy index (HI), were calculated for all trees generated under different optimality criteria. Maximum Likelihood (ML) analysis was performed in RAxML v8.2.4 with GTR+I+G model (Stamatakis 2014). The best tree was obtained by executing 1000 rapid bootstrap inferences and thereafter a thorough search was undertaken for the most likely tree using one distinct model/data partition with joint branch length optimisation (Stamatakis et al. 2008). Bayesian analyses with MrBayes 3.2.4 (Cannatella 2015) implementing the Markov Chain Monte Carlo (MCMC) technique and parameters predetermined with MrMODELTEST2.3 (Posada and Crandall 1998; Nylander 2004) were performed and the parameters in MrBayes were set as follows: lset nst = 6, rates = invgamma. Four simultaneous Markov chains were run starting from random trees, keeping one tree every 100th generation until the average standard deviation of split frequencies was below 0.01. The value of burn-in was set to discard 25% of trees when calculating the posterior probabilities. Bayesian posterior probabilities were obtained from the 50% majority rule consensus of the trees kept. Then we used the FigTree v1.3.1 or Treev32 to visualise the resulting trees.

Results

Phylogenetic analyses

The combined ITS-LSU dataset represented 97 taxa and 1328 characters long after being trimmed. was used as the outgroup. The data matrix comprised 800 constant characters, 81 parsimony uninformative variable characters and 447 parsimony informative positions. Maximum parsimony analysis was performed and a strict consensus tree was obtained (TL = 2351, CI = 0.376, RI = 0.728, RC = 0.273, HI = 0.624). Bayesian analysis ran for 8 million generations and resulted in an average standard deviation of split frequencies of 0.004708. The same dataset and alignment were analysed using the ML method and a similar topology was generated. The ML tree is shown in Figure 1. In the phylogenetic tree, nine sampled specimens formed three single clades with high to full support (100% in ML, 99% or 100% in MP and 1.00 BPP) and clustered in the clade that comprised most species of . and , clustered together with moderate support (67% in ML, 67% in MP and 0.99 BPP). clustered with with strong support (96% in ML, 100% in MP and 1.00 BPP). One sampled specimen of clustered with two samples (MK602757 and MK602755) from Sweden with full support (100% in ML, 100% in MP and 1.00 BPP). It confirmed a newly recorded species of from China.
Figure 1.

Maximum likelihood tree illustrating the phylogeny of , , , and related taxa based on ITS and LSU sequence datasets. Branches are labelled with maximum likelihood bootstrap support greater than 50%, parsimony bootstrap proportions greater than 50% and Bayesian posterior probabilities greater than 0.95.

Maximum likelihood tree illustrating the phylogeny of , , , and related taxa based on ITS and LSU sequence datasets. Branches are labelled with maximum likelihood bootstrap support greater than 50%, parsimony bootstrap proportions greater than 50% and Bayesian posterior probabilities greater than 0.95.

Taxonomy

Y.H. Mu & H.S. Yuan sp. nov. F149B8A9-70B1-509D-B706-EFAB4952B890 833889 Figures 2 , 3 , 4
Figure 2.

A basidiocarp of (holotype: IFP 019351).

Figure 3.

SEM of basidiospores of (holotype: IFP 019351).

Figure 4.

Microscopic structures of (drawn from IFP 019351) a basidiospores b section of hymenophoral trama with basidia c hyphae from pileal context.

Diagnoses.

Differs from by slightly shorter and decurrent spines, olivaceous tissues in KOH, simple-septate hyphae in all parts of basidiocarp, narrower basidia with shorter sterigmata and smaller basidiospores.

Type.

China. Yunnan Province, Chuxiong, Zixishan Nat. Res., , 2000 m alt., solitary to gregarious, on the ground in forest, 19.07.2018, Wei 8094 (holotype: IFP 019351).

Etymology.

(Lat.), refers to the felted pileal surface.

Description.

Basidiocarps annual, solitary to gregarious, soft and fleshy when fresh, becoming firm and light in weight upon drying; taste none, odour farinaceous when dry. Pileus planar, ellipsoid when young, later round with age, up to 35 mm across and 4–8 mm thick at centre. Pileal surface reddish-brown (8D5) to dark brown (8F8), azonate, pubescent, floccose to felted when fresh, becoming smooth, rugose, scrobiculate when dry; margin white (7A1) when fresh, greyish-brown (7D3) with age, incurved, rarely lobed. Spine surface white (4A1) to yellowish-white (4A2) when fresh, brownish-orange (5C5) to yellowish-brown (5F6) when dry; spines up to 2.1 mm long, base up to 0.3 mm diam., conical, 3–5 per mm, decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 6 mm thick, light brown (5D5), firm; Stipe central, up to 5.5 cm long and 1.3 cm diam., fleshy, greyish-brown (8D3) to violet brown (10F7) when fresh, becoming hollow with age, greyish-orange (5B3) to dark brown (7F7) upon drying, rugous, columniform or attenuate below with bulbous base when old. Hyphal structure. Hyphal system monomitic; generative hyphae with simple-septa, CB–, IKI–; tissues olivaceous in KOH. Context. Generative hyphae hyaline, thin-walled, rarely branched, simple-septate, inflated, partly short-celled, interwoven, mostly 4–10 μm diam. Spines. Tramal hyphae hyaline, thin-walled, frequently branched, more or less parallel along spines, frequently simple-septate, straight, 2–5 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (3.1–5.2 μm long), simple-septate at base, 16.5–50 × 6.2–9.4 μm; basidioles similar to basidia. Basidiospores irregular subglobose, brown, thin-walled, tuberculate, CB–, IKI–, (5.1–)5.7–7(–7.1) × (4.6–)4.7–5.9(–6) μm, Lm = 6.2 μm, Wm = 5.3 μm, Q = 1.17–1.18 (n = 60/2); tuberculi usually isolated or grouped in 2 or more, bi- to trifurcate-like in shape, up to 1.0 μm long.

Additional specimen examined

– China. Yunnan Province, Maguan County, On the way from Dalishu Township to Damagu Village, , 1616 m alt., solitary, on the ground in forest, 7.08.2017, Shi 181 (IFP 019352). A basidiocarp of (holotype: IFP 019351). SEM of basidiospores of (holotype: IFP 019351). Microscopic structures of (drawn from IFP 019351) a basidiospores b section of hymenophoral trama with basidia c hyphae from pileal context. Y.H. Mu & H.S. Yuan sp. nov. E7E671B0-C24A-580C-B65E-65D45C21D111 833890 Figures 5 , 6 , 7
Figure 5.

Basidiocarps of (holotype: IFP 012529).

Figure 6.

SEM of basidiospores of (holotype: IFP 012529).

Figure 7.

Microscopic structures of (drawn from IFP 012529) a basidiospores b section of hymenophoral trama with basidia c hyphae from pileal context.

Differs from in having shorter and slightly wider spines, fragrant odour, narrower hyphae in context, slightly wider basidia with shorter sterigmata and wider basidiospores. China. Yunnan Province, Chuxiong, Zixishan Nat. Res., , 2000 m alt., solitary or gregarious, on the ground in forest, 1.08.2005, Yuan 1247 (holotype: IFP 012529). (Lat.), from the Latin word grosse and lepidotus, in reference to the coarsely scaled pileal surface. Basidiocarps annual, solitary to gregarious, soft and freshy when fresh, becoming fragile and light in weight upon drying; taste none, odour mildly fragrant when dry. Pileus infundibuliform or circular when young, later planar and ellipsoid to round with age, occasionally deeply fissured, up to 75 mm diam. and 4–8 mm thick at centre. Pileal surface pale orange (6A3) to dark ruby (12F8), azonate, glabrous with ascending, broad and dark brown (9F5) scales when fresh, becoming scabrous, rugose when dry; margin inflexed and wavy, sometimes lobed with age. Spine surface white (4A1) to pale yellow (4A3) when fresh, light brown (6D6) to dark brown (6F8) when dry; spines up to 1.4 mm long, base up to 0.3 mm diam., conical, 4–6 per mm, strongly decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 5 mm thick, greyish-orange (5B5), firm; Stipe central to lateral, up to 9.5 cm long and 2 cm diam., fleshy when fresh, firm upon drying, brownish-yellow (5C7) to dark brown (7F7), creased, inside solid, cylindrical or attenuate below with bulbous base when old. Hyphal structure. Hyphal system monomitic; generative hyphae with simple-septa, CB–, IKI–; tissues olivaceous in KOH. Context. Generative hyphae hyaline, thin-walled, rarely branched, simple-septate, inflated, interwoven, mostly 7–11 μm diam. Spines. Tramal hyphae hyaline, thin-walled, occasionally branched, more or less parallel along spines, frequently simple-septate, straight, 2–5 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2.5–5 μm long), simple-septate at base, 23.5–55.5 × 5.3–8.2 μm; basidioles similar to basidia. Basidiospores irregular ellipsoid to globose, brown, thin-walled, tuberculate, CB–, IKI–, (5–)5.1–6.4(–6.6) × (4–)4.1–5.9(–6) μm, Lm = 5.5 μm, Wm = 4.9 μm, Q = 1.13–1.19 (n = 60/2); tuberculi usually isolated, sometimes grouped in 2 or more, bi- to trifurcate-like in shape, up to 0.7 μm long. – China. Yunnan Province, Chuxiong, Zixishan Nat. Res., , 2000 m alt., solitary to gregarious, on the ground in forest, 19.07.2018, Wei 8075 (IFP 019353), Wei 8097 (IFP 019354), Wei 8120 (IFP 019355) and Wei 8128 (IFP 019356). Basidiocarps of (holotype: IFP 012529). SEM of basidiospores of (holotype: IFP 012529). Microscopic structures of (drawn from IFP 012529) a basidiospores b section of hymenophoral trama with basidia c hyphae from pileal context. Y.H. Mu & H.S. Yuan sp. nov. 027C929B-90BB-5BA4-B092-990294BEAB24 833891 Figures 8 , 9 , 10
Figure 8.

Basidiocarps of (holotype: IFP 019357).

Figure 9.

SEM of basidiospores of (holotype: IFP 019357).

Figure 10.

Microscopic structures of (drawn from IFP 019357) a basidiospores b section of hymenophoral trama with basidia c hyphae from pileal context.

Differs from in having shorter, more or less decurrent spines, the absence of gloeoplerous hyphae, shorter basidia sterigmata and narrower basidiospores. China. Yunnan Province, Lidong County, Qunlong Villa, , 2400 m alt., solitary to concrescent, on the ground in forest, 24.07.2018, Wei 8365 (holotype: IFP 019357). , refers to Lidong County, where the specimens were collected. Basidiocarps annual, simple to concrescent, soft and freshy when fresh, becoming firm and light in weight upon drying; taste bitterish, odour farinaceous when dry. Pileus planar and circular when young, later plano-convex to somewhat depressed and regular orbicular with age, up to 35 mm across and 5–8 mm thick at centre. Pileal surface light brown (6D7) to brown (7E8), azonate, velutinate, then matted, appressed squamose to rimose when fresh, and purplish-brown at the pileal margin, dark brown in centre, becoming scrobiculate and verrucose when dry; margin incurved and occasionally incised with age. Spine surface greyish-orange (6B3) to brown (6E6) when fresh, light brown (6D5) to brown (6E7) when dry; spines up to 1 mm long, base up to 0.2 mm diam., conical, 4–6 per mm, more or less decurrent on stipe, with spines at pileus margin, brittle when dry. Context not duplex, up to 6 mm thick, orange white (5A2) to yellowish-brown (5D6), firm; stipe central, up to 4.5 cm long and 1 cm diam., fleshy when fresh, rigid upon drying, light brown (6D6) to dark brown (6F6), fibrillose, inside solid, cylindrical or broadened below with bulbous base when old. Hyphal structure. Hyphal system monomitic; generative hyphae with simple-septa, CB–, IKI–; tissues olivaceous in KOH. Context. Generative hyphae hyaline, thin-walled, occasionally branched, simple-septate, inflated, interwoven, mostly 5–9 μm diam. Spines. Tramal hyphae hyaline, thin-walled, occasionally branched, more or less parallel along spines, frequently simple-septate, straight, sometimes flexuous and collapsed, 2–4 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2.0–3.0 μm long), simple-septate at base, 19.2–39.3 × 3.0–7.2 μm; basidioles similar to basidia. Basidiospores irregular ellipsoid to subglobose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.1–6(–6.1) × (3.9–)4–5(–5.1) μm, Lm = 5.5 μm, Wm = 4.9 μm, Q = 1.15–1.20 (n = 60/2); tuberculi usually isolated or grouped in 2 or more, bi- to trifurcate-like in shape, up to 1.0 μm long. – China. Yunnan Province, Lidong County, Qunlong Villa, , 2400 m alt., solitary to concrescent, on the ground in forest, 24.07.2018, Wei 8329 (IFP 019358). Basidiocarps of (holotype: IFP 019357). SEM of basidiospores of (holotype: IFP 019357). Microscopic structures of (drawn from IFP 019357) a basidiospores b section of hymenophoral trama with basidia c hyphae from pileal context. (Pers.) Maas Geest. & Nannf., Svensk Botanisk Tidskrift 63: 415, 1969. D881D307-071C-5DC1-94E4-F39136E0A015 Morphological and nuc ITS rDNA + nuc LSU rDNA sequences analyses confirmed the new record species, which is described in detail by Mleczko et al. (2011). This species was recorded by several European countries, such as Estonia, Finland, Bulgaria and Sweden and was frequently placed on the Red List (Rassi et al. 2001; Gärdenfors 2005; Gyosheva et al. 2006; Parmasto 2009).

Specimen examined

– China. Xizang Auto. Reg., Linzhi, Bayi Town, , 3000 m alt., solitary or gregarious, on the ground of alpine forest, 3.08.2004, Dai 5686 (IFP 010196).

Discussion

Three new species of were described, based on the morphological characteristics and molecular data and were the first new species described from China. Phylogenetic analyses of the nuc ITS rDNA + nuc LSU rDNA dataset by ML, MP and Bayes in this study showed a low level of support in the deeper nodes of the topology, but high support at the species level. The result is in keeping with previous reports (Baird et al. 2013; Larsson et al. 2019). The felted pileal surface is the main feature of and this is consistent with and . However, differs from by a larger pileus (up to 50 mm vs. 35 mm in ) with longer spines (up to 4 mm vs. 2.1 mm in ), clamped hyphae and wider hyphae in the context (up to 25 µm) (Maas Geesteranus 1971). resembles in having an azonate pileal surface, central and hollow stipe when old and thin-walled hyphae in trama. However, differs from by slightly longer (up to 3 mm vs. 2.1 mm in ) and not decurrent spines, blue-green tissues in KOH, clamped hyphae in all parts of the basidiocarp, wider basidia (10–11 µm vs. 6.2–9 μm in ) with longer sterigmata (5.4–9 µm vs. 3.1–5.2 μm in ) and larger basidiospores (8.1–9.4 × 5.8–7.2 µm vs. 5.7–7 × 4.7–5.9 μm in ) (Maas Geesteranus 1971). presents a distinct characteristic: pileal surface with ascending and coarse scales, that coincide with that of and (Maas Geesteranus 1975; Baird et al. 2013). However, is differentiated from the new species by having longer spines (up to 8 mm vs. 1.4 mm in ), clamped hyphae in all parts of the basidiocarp, presence of gloeoplerous-like hyphae and larger basidiospores (8–9 × 7–8 μm vs. 5.1–6.4 × 4.1–5.9 μm in ) (Maas Geesteranus 1971; Baird et al. 2013). differs from by having longer spines (up to 3 mm vs. 1.4 mm in ), farinaceous odour, wider hyphae in the context and narrower basidiospores (3.6–4.3 µm vs. 4.1–5.9 μm in ) (Maas Geesteranus 1975). and are closely related in the phylogenetic tree and share similar morphological and anatomical characteristics: solitary to gregarious basidiocarps with round pileus, central and columniform stipe, decurrent spines, context tissue becoming olivaceous in KOH and isolated or grouped tuberculi. However, can be differentiated by infundibuliform basidiocarps, fissured pileus, coarse and scaly pileal surface, shorter spines (up to 1.4 mm vs. 2.1 mm in ) and slightly shorter tuberculi (up to 0.7 μm vs. 1 μm in ). and reveal a close phylogenetic relationship according to the phylogenetic tree. In morphology, is similar to in having a single or gregarious basidiocarp with convex to planar or depressed pileus, brown and scaled pileal surface, central and terete stipe, olivaceous tissues in KOH and basidiospores of similar shape. However, is differentiated by a larger pileus (up to 15 cm across) with longer spines (up to 8 mm vs. 1 mm in ), wider basidia (7–9 μm vs. 3.0–7.2 μm in ) with longer sterigmata (4–5 μm vs. 2–3 μm in ) and larger basidiospores (6–7 × 5–7 μm vs. 4.1–6 × 4–5 μm in ) (Maas Geesteranus 1971; Baird 1986; Baird et al. 2013). is similar to in having simple basidiocarps with plano-convex or depressed pileus, mottling or tear-like pileal surface, appressed scales, central and terete stipe, olivaceous tissue in KOH, inflated and interwoven hyphae in the context and tuberculate basidiospores of similar shape. However, it differs from in having longer, decurrent to strongly decurrent spines (up to 3 mm vs. 1 mm in ), presence of gloeoplerous-like hyphae, longer basidia sterigmata (4–5 μm vs. 2–3 μm in ) and wider basidiospores (5–6 μm vs. 4–5 μm in ) (Baird et al. 2013). The specimens, involved in this study, were collected from the forests dominated by trees such as , , and a small portion of coniferous trees, for instance, . We speculated that these species may form an ectomycorrhizal association with trees. The new record sample was fully identical with described by Mleczko et al. (2011) in morphology and molecular analysis and pine and spruce were primary ectomycorrhizal companions of this fungus.
1Basidiospores lengths in the range 8–10 μm, hyphae with frequent clamp connections in all parts of basidiocarps S. leucopus
Basidiospores lengths in the range 4–7 μm, hyphae without clamp connection in any part of basidiocarps 2
2Pileal surface not scaled, felted when fresh, spines up to 2.1 mm S. coactus
Pileal surface scaled when fresh, spines up to 1.4 mm 3
3Basidiocarps of occasionally deeply fissured pileus, pileal surface with ascending squama S. grosselepidotus
Basidiocarps of not deeply fissured pileus, pileal surface with appressed squama S. lidongensis
  7 in total

1.  Xenopus in Space and Time: Fossils, Node Calibrations, Tip-Dating, and Paleobiogeography.

Authors:  David Cannatella
Journal:  Cytogenet Genome Res       Date:  2015-08-07       Impact factor: 1.636

2.  A rapid bootstrap algorithm for the RAxML Web servers.

Authors:  Alexandros Stamatakis; Paul Hoover; Jacques Rougemont
Journal:  Syst Biol       Date:  2008-10       Impact factor: 15.683

3.  MODELTEST: testing the model of DNA substitution.

Authors:  D Posada; K A Crandall
Journal:  Bioinformatics       Date:  1998       Impact factor: 6.937

4.  MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.

Authors:  Sudhir Kumar; Glen Stecher; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2016-03-22       Impact factor: 16.240

5.  Benthic cyanobacteria: A source of cylindrospermopsin and microcystin in Australian drinking water reservoirs.

Authors:  Virginie Gaget; Andrew R Humpage; Qiong Huang; Paul Monis; Justin D Brookes
Journal:  Water Res       Date:  2017-08-02       Impact factor: 11.236

6.  RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies.

Authors:  Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2014-01-21       Impact factor: 6.937

7.  Reassessment of the generic limits for Hydnellum and Sarcodon (Thelephorales, Basidiomycota).

Authors:  Karl-Henrik Larsson; Sten Svantesson; Diana Miscevic; Urmas Kõljalg; Ellen Larsson
Journal:  MycoKeys       Date:  2019-06-10       Impact factor: 2.984

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.