Distribution of polymorphism rs693 of ApoB gene in a sample of Colombian Caribbeans.

INTRODUCTION: Several studies have reported that the single nucleotide polymorphism rs693 of Apo lipoprotein B gene is associated with high levels of plasma lipids and high body mass index, which are risk factors for cardiovascular diseases. The distribution of this single nucleotide polymorphism and its association with the phenotype depend on the genetic background of each population.
OBJECTIVE: To evaluate the distribution of single nucleotide polymorphism rs693 and its association with lipid profile and body mass index in a sample of Colombian Caribbeans.
METHODS: 108 non-related adult subjects of both gender were included in this study. Body mass index and lipid profile that included total cholesterol, triglycerides, Low Density Lipoprotein and High Density Lipoprotein were determined. The single nucleotide polymorphism rs693 was determined by Polymerase Chain Reaction/Restriction Fragment Length Polymorphism from genomic DNA followed by digestion with the restriction enzyme XbaI. The chi-square test was used to analyze the genotype distribution of rs693 and the genotype-phenotype association was evaluated through different inheritance model.
RESULTS: The genotype frequencies for single nucleotide polymorphism rs693 were CC (45.0%), TT (16.5%) and CT (38.5%). The allele frequencies were C (64.0%) and T (36.0%). The single nucleotide polymorphism was in Hardy-Weinberg equilibrium in the studied sample. No association of the single nucleotide polymorphism rs693 with lipid profile nor the body mass index was found (p >0.05).
CONCLUSION: There is no significant association between single nucleotide polymorphism rs693 and body mass index nor lipid profile, in a sample of Colombian Caribbeans.

Remark

Introduction

Cardiovascular diseases (CVD) are recognized as the leading cause of death worldwide; with a percentage of 30%, equal to that reported for Colombia , . Obesity and dyslipidemia are some of the main CVD risk factors - , the respective indicators are the Body Mass Index (BMI) and lipid profile. The determination of these indicators is important for the prevention, diagnosis and monitoring of cardiovascular disease in an individual - .

Lipid profile comprises determining triglycerides (TG), total cholesterol (TC), cholesterol linked to low density lipoproteins (LDL-C,Low Density Lipoprotein-Cholesterol) and cholesterol linked to High Density Lipoprotein (HDL-C,High Density Lipoprotein-Cholesterol) , . The protein component (apoprotein) plays a pivotal role in the structure and function of the lipoproteins; therefore, variations in the gene encoding the apoprotein can cause structural or functional effects - . Apolipoprotein B (ApoB) is the main protein component of LDL, VLDL (Very Low Density Lipoprotein) and chylomicrons . ApoB is essential for the assembly and secretion of VLDL in the liver and has the domain to bind LDL to its receptor; therefore, it is the key for the transport and metabolism of lipids , . ApoB is encoded by a gene of 43 kpb located on the short arm of chromosome 2 (2p24) and comprises 29 exons and 28 introns , . This gene is polymorphic , and some polymorphisms are related to dyslipidemia - .

One of the most studied polymorphisms has been the single nucleotide polymorphism (SNP) rs693,also called XbaI and C/T7673 . It is located in exon 26 of the apoB gene at codon 2488 and results from the substitution of cytosine by thymine at the third position (ACC → ACT), creating a silent mutation, as both codons encoding threonine. The presence of thymine generates the restriction site and gives the name to the resulting T allele, also known as X+ allele. However, in the absence of T allele, it is identified as C or X- allele .

Although the SNP rs693 does not imply change in the amino acid sequence of the protein, it is associated with dyslipidemia, obesity and cardio-cerebrovascular diseases in populations from Brazil , China and European countries . The association would favor the possibility of using the SNP rs693 as a predictor of risk of these diseases in the indicated populations . However, in other populations, very low association has been found, for example, in Northern India .

The genotypic and allelic distributions of rs693 in the Colombian population are not completely known. Historically, this population has been regarded as the mixture of three main ethnicities: Africans, Amerindians, and Caucasians , . In Andean population from Armenia-Colombia, Loango et al. , evaluated the association between this polymorphism with plasmatic lipids in children and their parents. However, the admixture between the three ethnicities has different extent in each region of Colombia. This is why, the study of rs693 in a sample of Colombian Caribbean population is justified . Furthermore, because clinical implications of the polymorphism rs693 on the cardiovascular risk factors are not universal, it is important to explore this variant in different populations . The present study aims to determine the association of apoB rs693 polymorphism with the lipid profile and BMI in a sample of the Colombian Caribbean population.

Materials and Methods

Study group

This analytical cross-sectional study was performed from an initial group of 331 unrelated adult subjects, both gender, different ages and schooling and born in the Colombian Caribbean like their ancestors to the third degree of consanguinity. After applying a questionnaire and performing a medical interview at Universidad Libre from Barranquilla, smokers, vegetarians, pregnant women, diabetics and all those who were or had been under pharmacological treatment for cardio-cerebrovascular disease, dyslipidemia, hypertension, cancer, liver disease, endocrine disorders or kidney disease were excluded. Thus, the initial group was reduced to 108 subjects (mean age 52 ±11 years), 34 men (31.5%) and 74 women (68.5%).

The study was approved by the local ethics committee at Universidad Libre from Barranquilla and informed written consent was obtained from all study subjects before their participation.

Anthropometric measurements and lipid profile

Anthropometric measurements included the recording of weight and height by standard methods. Body Mass Index (BMI) was determined according to the traditional formula of Quetelet: weight in kilograms divided by the square of the height (Kg/m2). The criteria of the clinical guidelines of the NIH-USA were taken into account to classify the subjects according to the BMI into two categories: normal weight (values ​​range from 18.5 to 24.99 Kg/m2) and overweight/obesity (values ​​≥ 25 Kg/m2) .

For biochemical studies, a blood sample was drawn by venipuncture from an antecubital vein, following an overnight fast, from each subject under study. Serum was collected from all samples after centrifugation at room temperature. Serum levels of total cholesterol (TC), triglycerides (TGC), HDL cholesterol (HDL-C) and LDL cholesterol (LDL-C) were determined by using COBAS C501 equipment (Roche®, Switzerland), following the manufacturer’s instructions.

Genotyping of the SNP rs693

The genomic DNAs of all the subjects were extracted from 600 µL of whole blood with Wizard® Genomic Kit (Promega®, USA) following the manufacturer’s instructions. The genotyping of the SNP rs693 was done ​​by Polymerase Chain Reaction (PCR) followed by digestion with restriction enzyme XbaI. The DNA fragment containing the SNP rs693 was amplified using a sense primer (5 'GGAGACTATTCAGAAGCTAA 3') and an antisense primer (5 'GAAGAGCCTGAAGACTGACT 3'). The PCR reaction was performed in a PTC-100 (MJ Research®,Canada) thermocycler, in a final volume of 25 µL containing 25 mM of each primer, 5 µL of DNA and master mix MangoMix (Bioline®, England) which provided MgCl22.5 mM and 200 mM dNTPs. The PCR conditions consisted of an initial denaturation step at 95° C for 10 min, followed by 30 cycles of denaturation at 95° C for 1 min, annealing at 49° C for 1 min, and extension at 72° C for 1 min, with a final elongation at 72° C for 8 min. The PCR product was a 710 bp band which was digested with the enzyme XbaI (New England Biolabs®,USA) following the instructions of the enzyme manufacturer. The digestion products were then visualized by gel electrophoresis with polyacrylamide 8% and staining with ethidium bromide. When the T allele was present in the restriction site, two bands (433 bp and 277 bp) were obtained. If after the digestion a single band of 710 bp was obtained it was interpreted as CC genotype; if three bands (433 bp, 710 bp and 277pb) were obtained it was interpreted as CT genotype,and if two bands (433 bp and 277 bp) were obtained it was interpreted as TT genotype.

Quality control

The quality of the biochemical tests was verified using commercial serum, normal and abnormal controls (Roche, Switzerland). Reagent controls were used in each amplification to monitor contamination in the molecular analysis. Genotyping was confirmed by repeating at random 40% of the analyzes performed.

Statistical analysis

The Statistical Package for Social Studies SPSS version 20.0 was used to conduct all data analyses. The total population was grouped according to the values of the lipid profile (subjects with normal and abnormal levels) and the BMI (normal weight and overweight/obese). The data obtained are presented as mean ± SD or percentages. Student’s t-test was used to compare means and Chi-square test was applied to compare proportions.

The genotype frequencies and the Hardy-Weinberg were determined with Arlequin version 3.11 software . The data were further grouped according to the three genotypes of the SNP rs693. The chi-square test was used to analyze the distribution of the rs693 genotype and the genotype-phenotype association was evaluated through different inheritance models: co-dominant, dominant, recessive and additive. A value of p <0.05 was considered statistically significant.

Ethics approval and consent to participate

The ethical approval for this study was obtained from local ethics committee at Universidad Libre from Barranquilla. Written informed consent was obtained from all study subjects before their participation.

Results

Anthropometric characteristics and lipid profile

The anthropometric characteristics and the lipid profile of the study subjects classified by gender are presented in Table 1. When comparing means with Student’s t-test, there was statistically significant difference between the average weight (p= 0.007) and height (p= 0.008) between men and women; but not difference was found between the mean age (p= 0.06). The average body mass index (n= 108) was 26.21 ±3.72 Kg/m2and no statistically significant difference was found between the average BMI of women (25.74 ±3.50 Kg/m2) and men (27.25 ±4.00 Kg/m2), (p= 0.3435).

Table 1

Anthropometric characteristics and lipid profile of the subjects under study.

Variable	Gender		(n=108) Mean ± SD
	Female (n=74) Mean ± SD	Male (n=34) Mean ± SD
Age (year)	53 ± 10	50 ± 11	52±11
Height (m)	1.61 ± 0.07	1.71 ± 0,07	1.64 ± 0.08
Weight (kg)	66.71 ± 9.51	79.97 ± 13.54	70.89 ± 12.51
Total cholesterol (mg/dL)	190.35 ± 40.74	178 ± 25.86	186.46 ± 37.04
High Density Lipoprotein-Cholesterol (mg/dL)	47.16 ± 12.02	42.85 ± 9.66	45.81 ± 11.47
Low Density Lipoprotein-Cholesterol (mg/dL)	119.09 ± 34.98	117.88 ± 23.12	118.71 ± 31.62
Triglycerides (mg/dL)	158.91 ± 128.72	131.74 ± 58.76	150.35 ± 111.94
Body mass index (Kg/m2)	25.74 ± 3.50	27.25 ± 4.00	26.21 ± 3.72

Total cholesterol in men) ≥170; in women) ≥180

Triglycerides ≥150;

High Density Lipoprotein-Cholesterol in men ˂40; in women ˂50

Low Density Lipoprotein-Cholesterol ≥100 were considered abnormal values.

With regard to the lipid profile, the averages of the parameters evaluated in all individuals are presented in Table 1. The subjects were grouped according to National Lipid Association recommendations . After using Chi-square test, significant differences were not found between men and women when comparing the corresponding frequencies for each parameter of the lipid profile (p >0.05) (Table 2).

Table 2

Frequency of abnormal body mass index and lipid profile with respect to the gender.

Variables	Gender
	Female n=74 (%)	Male n=34 (%)
Body mass index	40 (54.1)	23 (67.6)
Triglycerides	26 (35.1)	8 (23.5)
Total Cholesterol	44 (59.5)	23 (67.6)
High Density Lipoprotein-Cholesterol	38 (51.4)	18 (52.9)
Low Density Lipoprotein-Cholesterol	53 (71.6)	27 (79.4)

Genotype and allele frequencies of SNP rs693.

Of the 108 genotyped subjects, 49 (45.0%) presented CC genotype; 41 (38.5%) presented CT genotype and the remaining 18 (16.5%) presented TT genotype. These data show that the C allele was majority; in fact, the allele frequencies were 139 (64.0%) for C allele and 77 (36.0%) for the T allele.The distribution of the genotype frequencies was in Hardy-Weinberg equilibrium (p >0.05). Genotype and allele frequencies were compared with other Latin American populations (Table 3).

Table 3

Comparison of the genotypic and allelic frequencies in the present study with other Latin American populations.

Genotype	Colombian Caribbeans (present study) n= 108	Brazilian population 23 n= 192	Mexican population 31 n=246	Colombian Andeans from Armenia 29 n= 148
CC 7673	45.0%	33%	47%	28%*
CT 7673	38.5%	50%	38%	65%*
TT 7673	16.5%	17%	15%	7%
Alleles
C 7673	65%	58%	66%	61%
T 7673	35%	42%	34%	39%

*p <0.05 compared to Caribbeans-Colombia (present study).

Genotype frequencies regarding lipid profile and BMI

The genotype frequencies with respect to lipid profile and BMI are shown in table 4. None of the inheritance models showed a significant increase in the odds of alterations in BMI or lipid profile parameters (Table 4). There were also no significant differences in these outcomes when gender and age variables were included in these models.

Table 4

Analysis of the association between the genotype and alterations in the lipid profile and BMI, depending on the inheritance model. Data are presented as frequencies and percentages of subjects with abnormal values*

Variable (N=108)	Model	Genotype	n	%	OR	CI (95%)
Body Mass Index (n=63)	co-dominant	CC7673	26	41.3	1
		CT7673	26	41.3	0.712	0.321-1.579
		TT7673	11	17.5	0.871	0.309-2.453
	dominant	CC7673	26	41.3	1
		CT7673/ TT7673	37	58.7	0.672	0.311-1.452
	Recessive	CC7673/ CT7673	52	82.5	1
		TT7673	11	17.5	0.871	0.309-2.453
	additive				0.719	0.239-2.164
Triglycerides (n=34)	co-dominant	CC7673	13	38.2	1
		CT7673	16	47.1	0.574	0.251-1.314
		TT7673	5	14.7	1.236	0.402-3.797
	dominant	CC7673	13	38.2	1
		CT7673/ TT7673	21	61.8	0.653	0.285-1.496
	recessive	CC7673/ CT7673	29	85.3
		TT7673	5	14.7	1.236	0.402-3.797
	additive				0.939	0.280-3.151
Total Cholesterol (n=67)	co-dominant	CC7673	30	44.8	1
		CT7673	29	43.3	0.542	0.237-1.241
		TT7673	8	11.9	2.379	0.852-6.639
	dominant	CC7673	30	44.8	1
		CT7673/ TT7673	37	55.2	0.939	0.430-2.048
	recessive	CC7673/ CT7673	59	88.1	1
		TT7673	8	11.9	2.379	0.852-6.639
	additive				1.974	0.662-5.888
High Density Lipoprotein-Cholesterol (n=56)	co-dominant	CC7673	25	44.6	1
		CT7673	24	42.9	0.648	0.295-1.419
		TT7673	7	12.5	1.878	0.667-5.284
	dominant	CC7673	25	44.6	1
		CT7673/ TT7673	31	55.4	0.941	0.441-2.008
	recessive	CC7673/ CT7673	49	87.5	1
		TT7673	7	12.5	1.878	0.667-5.284
	additive				1.637	0.544-4.921
Low Density Lipoprotein-Cholesterol (n=80)	co-dominant	CC7673	33	41.3	1
		CT7673	34	42.5	0.451	0.172-1.182
		TT7673	13	16.3	1.12	0.360-3.486
	dominant	CC7673	33	41.3	1
		CT7673/ TT7673	47	58.8	0.527	0.220-1.258
	recessive	CC7673/ CT7673	67	83.8	1
		TT7673	13	16.3	1.12	0.360-3.486
	additive				0.793	0.241-2.612

* No association of the single nucleotide polymorphism rs693 with lipid profile nor the body mass index was found (p >0.05).

Discussion

Polymorphisms in genes associated with dyslipidemia or obesity may be genetic predictors of CVD in populations where the association is obvious - . In this study, the genotypic and allelic frequencies were determined for the SNP rs693 such as its relationship with lipid profile and BMI in a sample of the Colombian Caribbean population, a product of the ancestral mixture of African black, Amerindian and European white .

Genotypic analysis of polymorphism revealed: first, that in the sample studied the distribution of genotypes was not significantly different from the expected distribution for a population in Hardy-Weinberg equilibrium; second, that all possible genotypes for rs693 (TT, TC and CC) were present; and third, that the TT genotype was minority. Furthermore, the allelic analysis revealed that C was majority (64%) versus T (36%).

The T allele frequency found in this study is in agreement with those reported in a sample of mestizo Colombian Andean population from Armenia-Colombia , in a sample of Brazilian people , and in a sample of Mexican people . However, there are notable differences with respect to the allelic frequencies found in European, Asian and African populations. In European populations, the frequency of T allele is higher (~53%) (32-35), except Norwegians (~27%) , while it is lower in Asians (~12%) - and Africans (~21%) - .

Distribution of genotypes in Colombian Caribbeans differed from that of Colombian Andeans from Armenia . The frequencies of CT and CC were higher in Colombian Andeans and a significant difference was found when the genotype distribution was compared between these two populations. However, no significant differences in genotype frequencies were observed when comparing Colombian Caribbeans to other Latin American populations (Brazilians and Mexicans) , (Table 3). This phenomenon is typical in Colombian population and is the product of historical events that gave rise to it . The admixture between European, African, and Amerindian populations has a different extent in each region of Colombia. In central and Eastern Colombia, including Armenia, European and Amerindian ancestry predominate; in coastal regions, including Caribbean population in the present study, European, Amerindian and African ancestors all significantly contributed to this population .

On the other hand, in the sample studied, the SNP rs693 does not appears to influence plasma lipid levels. Indeed, there was no significant association with the TT and CT genotypes,or the mutant allele T7673; p-value was always >0.05. This finding agrees with that reported in other Colombian study , when they did not find statistically significant differences (TC p= 0.47, HDL-C p= 0.23; LDL-C p= 0.40; TG p= 0.10). It is also in agreement with the findings in a sample of the Brazilian population , and in Indians ; in these cases, in all comparisons p >0.05.

By contrast, our results differ from the findings in Egyptians , who reported association of the T allele with increased cholesterol levels (p= 0.041) and LDL-C (p= 0.021); in a population of Mongolia , when found significant association with triglyceride levels since these were significantly higher in men with genotype CT7673than in men with CC genotype (p= 0.047); in China that CT genotype carriers tend to have high LDL levels, but low levels of HDL-C (p <0.05) and, finally, the results also in China , when reported that subjects with T allele exhibited,significantly higher levels of LDL-C, TC and TG, compared to subjects with C allele (p <0.05).

For BMI, our results showed no significant association with genotypes nor with the mutant T allele (p >0.05). This result agrees with that reported in Colombian mestizos , found no significant differences (p= 0.08) among subjects with T allele and subjects with C allele. Our study agrees with Egyptian subjects , who found no significant differences in BMI of with TT, CT and CC genotypes and the lack of association (p >0.05) . However, our result is discordant with the findings in China, who found significantly higher values ​​(p <0.05) in subjects with T allele than in subjects with C allele .

In this study the genotype-phenotype association with respect to wild-type C allele (X-) was also studied. Unlike the findings about positive association of this allele with coronary artery disease and myocardial infarction , , in this study no association (p >0.05) was found.

The similarity of our results with those of another study conducted in Colombia, in a far and different geographical area leads us to infer that the characteristic ancestral mixture of the two samples studied was the key factor to reproduce the result, despite environmental factors and lifestyle.

Environmental factors, however, can contribute to differences that are mainly due to ethnic variability. Indeed, biochemical phenotypes such as levels of plasma lipids, anthropometric parameters such as weight, demographic variables such as gender and age, environmental conditions such as food or cigarette smoking, and specific factors of the study as the sample size or the criteria for inclusion and exclusion, can influence the differences between the results of this study and others already referenced.

In this study, the wide age range of subjects, the differences in lifestyle and the sample size constituted limitations. However, the findings of this exploratory work should be validated in the future, with a study of a representative sample of the population of the Colombian Caribbean, under the case-control design.

Conclusion

This study suggests that there is no influence of the polymorphism on lipid profile parameters or on BMI.

Contribución del estudio

Introducción

Las enfermedades cardiovasculares (ECV) son reconocidas como la principal causa de muerte a nivel mundial; con una frecuencia del 30%, igual al reportado para Colombia ,. La obesidad y la dislipidemia son algunos de los principales factores de riesgo de las ECV - y los respectivos indicadores son el Índice de Masa Corporal (IMC) y el perfil de lípidos. La determinación de estos indicadores es importante para la prevención, el diagnóstico y el monitoreo de la enfermedad cardiovascular en un individuo -.

El perfil lipídico comprende la determinación de los triglicéridos (TG), el colesterol total (TC, Total Cholesterol), el colesterol unido a las lipoproteínas de baja densidad (LDL-C, Low Density Lipoprotein-Cholesterol) y el colesterol unido a las lipoproteínas de alta densidad (HDL-C, High Density Lipoprotein-Cholesterol) ,. El componente proteínico (apoproteína) juega un papel fundamental en la estructura y función de las lipoproteínas; por lo tanto, las variaciones en el gen que codifica la apoproteína pueden causar efectos estructurales o funcionales ,. La apolipoproteína B (ApoB) es el principal componente proteico de las LDL, VLDL (Very Low Density Lipoprotein) y los quilomicrones . La ApoB es esencial para el ensamblaje y la secreción de VLDL en el hígado y tiene el dominio para unir las LDL a su receptor; por lo tanto, es la clave para el transporte y el metabolismo de los lípidos ,. La ApoB está codificada por un gen de 43 kpb situado en el brazo corto del cromosoma 2 (2p24) y está compuesto por 29 exones y 28 intrones ,. Este gen es polimórfico , y algunos polimorfismos están relacionados con dislipidemia -.

Uno de los polimorfismos más estudiados ha sido el polimorfismo de un solo nucleótido (SNP) rs693, también llamado XbaI y C/T7673. Está localizado en el exón 26 del gen apoB en el codón 2488 y resulta de la sustitución de la citosina por timina en la tercera posición (ACC → ACT), creando una mutación silenciosa, ya que ambos codones codifican la treonina. La presencia de timina genera el sitio de restricción y da el nombre al alelo T resultante, también conocido como alelo X+. Sin embargo, en ausencia del alelo T, se identifica como alelo C o X .

Aunque el SNP rs693 no implica un cambio en la secuencia de aminoácidos de la proteína, se asocia con dislipidemia, obesidad y ECV en poblaciones de Brasil , China y países europeos . La asociación favorecería la posibilidad de utilizar el SNP rs693 como predictor de riesgo de estas enfermedades en las poblaciones indicadas . Sin embargo, en otras poblaciones se ha encontrado una asociación muy baja, por ejemplo, en el norte de la India .

Las distribuciones genotípicas y alélicas de rs693 en la población colombiana no son completamente conocidas. Históricamente, esta población ha sido considerada como la mezcla de tres etnias principales: africanos, amerindios y caucásicos ,. En la población andina de Armenia-Colombia, Loango et al. , evaluaron la asociación de este polimorfismo con los lípidos plasmáticos en los niños y sus padres. Sin embargo, la mezcla entre las tres etnias tiene un alcance diferente en cada región de Colombia. Por ello, es pertinente el estudio de rs693 en una muestra de la población caribeña colombiana . Además, debido a que las implicaciones clínicas del polimorfismo rs693 sobre los factores de riesgo cardiovascular no son universales, es importante explorar esta variante en diferentes poblaciones . El presente estudio tiene como objetivo determinar la asociación del polimorfismo rs693 en apoB con el perfil lipídico y el IMC en una muestra de la población caribeña colombiana.

Materiales y Métodos

Grupo de estudio

Este estudio analítico transversal se realizó a partir de un grupo inicial de 331 sujetos adultos no relacionados entre sí, de ambos sexos, diferentes edades y escolaridad, y nacidos en el caribe colombiano al igual que sus antepasados hasta el tercer grado de consanguinidad. Luego de aplicar un cuestionario y realizar una entrevista médica en la Universidad Libre de Barranquilla, se excluyeron fumadores, vegetarianos, mujeres embarazadas, diabéticos y todos aquellos que estaban o habían estado bajo tratamiento farmacológico por ECV, dislipidemia, hipertensión, cáncer, enfermedad hepática, trastornos endocrinos o enfermedad renal. Así, el grupo inicial se redujo a 108 sujetos (edad media 52 ±11 años), 34 hombres (31.5%) y 74 mujeres (68.5%).

El estudio fue aprobado por el comité de ética local de la Universidad Libre de Barranquilla y se obtuvo el consentimiento informado por escrito de todos los sujetos del estudio antes de su participación.

Medidas antropométricas y perfil lipídico

Las mediciones antropométricas incluyeron el registro del peso y la altura por métodos estándar. El Índice de Masa Corporal (IMC) se determinó de acuerdo con la fórmula tradicional del Quetelet: peso en kilogramos dividido por el cuadrado de la altura (Kg/m2). Se tuvieron en cuenta los criterios de las guías clínicas del NIH-EE.UU. para clasificar a los sujetos según el IMC en dos categorías: peso normal (los valores van de 18.5 a 24.99 Kg/m2) y sobrepeso/obesidad (valores ≥25 Kg/m2) .

Para los estudios bioquímicos, se extrajo una muestra de sangre por venopunción de una vena antecubital, después de un ayuno nocturno, de cada sujeto en estudio. Se recogió suero de todas las muestras después de la centrifugación a temperatura ambiente. Los niveles séricos de colesterol total (TC), triglicéridos (TGC), colesterol HDL (HDL-C) y colesterol LDL (LDL-C) se determinaron utilizando el equipo COBAS C501 (Roche®, Suiza), siguiendo las instrucciones del fabricante.

Genotipado del SNP rs693

Los ADN genómicos de todos los sujetos se extrajeron de 600 µL de sangre total con el Wizard® Genomic Kit (Promega®, USA) siguiendo las instrucciones del fabricante. El genotipado del SNP rs693 fue hecho por reacción en cadena de la polimerasa (PCR) seguido de digestión con la enzima de restricción XbaI. El fragmento de ADN que contiene el SNP rs693 se amplificó utilizando un cebador sentido (5 'GGAGACTATTCAGAAGCTAA 3') y un cebador antisentido (5 'GAAGAGCCTGAAGACTGACT 3'). La reacción de PCR se realizó en un termociclador PTC-100 (MJ Research®, Canadá), en un volumen final de 25 µL que contenía 25 mM de cada primer, 5 µL de ADN y la mezcla maestra MangoMix (Bioline®, Inglaterra) que proporcionó MgCl2 2.5 mM y 200 mM de dNTPs. Las condiciones de la PCR consistieron en un paso de desnaturalización inicial a 95° C durante 10 min, seguido de 30 ciclos de desnaturalización a 95° C durante 1 min, recocido a 49° C durante 1 min, y extensión a 72° C durante 1 min, con una elongación final a 72° C durante 8 min. El producto de la PCR fue una banda de 710 pb que fue digerida con la enzima XbaI (New England Biolabs®, USA) siguiendo las instrucciones del fabricante de la enzima. A continuación, se visualizaron los productos de la digestión mediante electroforesis en gel con poliacrilamida al 8% y tinción con bromuro de etidio. Cuando el alelo T estuvo presente en el sitio de restricción, se obtuvieron dos bandas (433 pb y 277 pb). Si tras la digestión se obtuvo una sola banda de 710 pb se interpretó como genotipo CC; si se obtuvieron tres bandas (433 pb, 710 pb y 277 pb) se interpretó como genotipo CT, y si se obtuvieron dos bandas (433 pb y 277 pb) se interpretó como genotipo TT.

Control de calidad

La calidad de las pruebas bioquímicas se verificó utilizando suero comercial, controles normales y anormales (Roche, Suiza). Se utilizaron controles con reactivos en cada amplificación para controlar la contaminación en el análisis molecular. El genotipado se confirmó repitiendo al azar el 40% de los análisis realizados.

Análisis estadístico

Se utilizó el Statistical Package for Social Studies SPSS versión 20.0 para realizar todos los análisis de datos. La población total se agrupó según los valores del perfil lipídico (sujetos con niveles normales y anormales) y el IMC (peso normal y sobrepeso/obesidad). Los datos obtenidos se presentan como media ± SD o porcentajes. Para comparar las medias se utilizó la prueba de la t de Student y para comparar las proporciones se aplicó la prueba Ji cuadrado.

Las frecuencias del genotipo y el Hardy-Weinberg se determinaron con el programa Arlequin versión 3.11 . Además, los datos se agruparon según los tres genotipos del SNP rs693. Se utilizó la prueba de chi-cuadrado para analizar la distribución del genotipo rs693 y se evaluó la asociación genotipo-fenotipo a través de diferentes modelos de herencia: codominante, dominante, recesivo y aditivo. Se consideró estadísticamente significativo un valor de p <0.05.

Aprobación ética y consentimiento para participar

La aprobación ética de este estudio se obtuvo del comité de ética de la Universidad Libre de Barranquilla. Se obtuvo el consentimiento informado por escrito de todos los sujetos del estudio antes de su participación.

Resultados

Características antropométricas y perfil lipídico

Las características antropométricas y el perfil lipídico de los sujetos de estudio clasificados por género se presentan en la Tabla 1. Al comparar las medias con la prueba de la t de Student, se observó una diferencia estadísticamente significativa entre el peso promedio (p= 0.007) y la altura (p= 0.008) entre hombres y mujeres; pero no se encontró diferencia entre la edad promedio (p= 0.06). El índice de masa corporal promedio (n= 108) fue de 26.21 ± 3.72 Kg/m2 y no se encontró ninguna diferencia estadísticamente significativa entre el IMC promedio de las mujeres (25.74 ± 3.50 Kg/m2) y el de los hombres (27.25 ± 4.00 Kg/m2), (p= 0.3435).

Tabla 1

Características antropométricas y perfil lipídico de los sujetos en estudio.

Variable	Género		(n=108) Mean ± SD
	Femenino (n=74) Media ±DS	Masculino (n=34) Media ±DS
Edad (años)	53 ± 10	50 ± 11	52±11
Estatura (m)	1.61 ± 0.07	1.71 ± 0,07	1.64 ± 0.08
Peso (kg)	66.71 ± 9.51	79.97 ± 13.54	70.89 ± 12.51
Colesterol total (mg/dL)	190.35 ± 40.74	178 ± 25.86	186.46 ± 37.04
Lipoproteína-colesterol de alta densidad (mg/dL)	47.16 ± 12.02	42.85 ± 9.66	45.81 ± 11.47
Lipoproteína-colesterol de baja densidad(mg/dL)	119.09 ± 34.98	117.88 ± 23.12	118.71 ± 31.62
Trigliceridos (mg/dL)	158.91 ± 128.72	131.74 ± 58.76	150.35 ± 111.94
Indice de masa corporal(Kg/m2)	25.74 ± 3.50	27.25 ± 4.00	26.21 ± 3.72

Colesterol total en hombres) ≥170; en mujeres) ≥180

Triglicéridos ≥150;

Lipoproteína-colesterol de alta densidad en hombres ˂40; en mujeres ˂50

Lipoproteína-colesterol de baja densidad ≥100 fueron consideradas valores abnormales.

En cuanto al perfil lipídico, los promedios de los parámetros evaluados en todos los individuos se presentan en la Tabla 1. Los sujetos fueron agrupados de acuerdo con las recomendaciones de la National Lipid Association . Después de utilizar la prueba de Ji-cuadrado, no se encontraron diferencias significativas entre hombres y mujeres al comparar las frecuencias correspondientes para cada parámetro del perfil lipídico (p >0.05) (Tabla 2).

Tabla 2

Frecuencia de IMC y perfil lipídico anormales con respecto al género.

Variables	Sexo
	Femenino n=74 (%)	Masculino n=34 (%)
Indice de masa corporal	40 (54.1)	23 (67.6)
Trigliceridos	26 (35.1)	8 (23.5)
Colesterol total	44 (59.5)	23 (67.6)
Lipoproteína-Colesterol de alta densidad	38 (51.4)	18 (52.9)
Lipoproteína-Colesterol de baja densidad	53 (71.6)	27 (79.4)

Genotipo y frecuencias alélicas del SNP rs693

De los 108 sujetos genotipados, 49 (45.0%) presentaron genotipo CC; 41 (38.5%) presentaron genotipo CT y los 18 restantes (16.5%) presentaron genotipo TT. Estos datos muestran que el alelo C fue mayoritario; de hecho, las frecuencias alélicas fueron 139 (64%) para el alelo C y 77 (36%) para el alelo T. La distribución de las frecuencias del genotipo se halló en equilibrio Hardy-Weinberg (p >0.05). Las frecuencias del genotipo y de los alelos se compararon con las de otras poblaciones latinoamericanas (Tabla 3).

Tabla 3

Comparación de las frecuencias genotípicas y alélicas en el presente estudio con otras poblaciones latinoamericanas.

Genotipo	Caribeños colombianos (presente estudio) n= 108	Población brasilera 23 n= 192	Población mexicana 31 n=246	Colombianos de la región Andina en Armenia 29 n= 148
CC 7673	45.0%	33%	47%	28%*
CT 7673	38.5%	50%	38%	65%*
TT 7673	16.5%	17%	15%	7%
Alelos
C 7673	65.0%	58%	66%	61%
T 7673	35.0%	42%	34%	39%

p <0.05 compación con Caribeños-Colombianos (presente estudio).

Frecuencias de genotipo según el perfil lipídico y el IMC

Las frecuencias del genotipo con respecto al perfil lipídico y al IMC se muestran en la Tabla 4. Ninguno de los modelos de herencia mostró un aumento significativo de las probabilidades de alteraciones en los parámetros de IMC o perfil de lípidos. Tampoco hubo diferencias significativas en estos resultados cuando se incluyeron las variables de sexo y edad en estos modelos (Tabla 4).

Table 4

Análisis de la asociación entre el genotipo y las alteraciones en el perfil lipídico y el IMC, según el modelo de herencia. Los datos se presentan como frecuencias y porcentajes de sujetos con valores anormales*.

Variable (N=108)	Modelo	Genotipo	n	%	OR	IC (95%)
Indice de masa corporal (n=63)	co-dominante	CC7673	26	41.3	1
		CT7673	26	41.3	0.712	0.321-1.579
		TT7673	11	17.5	0.871	0.309-2.453
	dominante	CC7673	26	41.3	1
		CT7673/ TT7673	37	58.7	0.672	0.311-1.452
	Recesivo	CC7673/ CT7673	52	82.5	1
		TT7673	11	17.5	0.871	0.309-2.453
	aditivo				0.719	0.239-2.164
Triglicéridos (n=34)	co-dominante	CC7673	13	38.2	1
		CT7673	16	47.1	0.574	0.251-1.314
		TT7673	5	14.7	1.236	0.402-3.797
	dominante	CC7673	13	38.2	1
		CT7673/ TT7673	21	61.8	0.653	0.285-1.496
	recesivo	CC7673/ CT7673	29	85.3
		TT7673	5	14.7	1.236	0.402-3.797
	aditivo				0.939	0.280-3.151
Colesterol total (n=67)	co-dominante	CC7673	30	44.8	1
		CT7673	29	43.3	0.542	0.237-1.241
		TT7673	8	11.9	2.379	0.852-6.639
	dominante	CC7673	30	44.8	1
		CT7673/ TT7673	37	55.2	0.939	0.430-2.048
	recesivo	CC7673/ CT7673	59	88.1	1
		TT7673	8	11.9	2.379	0.852-6.639
	aditivo				1.974	0.662-5.888
Lipoproteína-Colesterol de alta densidad (n=56)	co-dominante	CC7673	25	44.6	1
		CT7673	24	42.9	0.648	0.295-1.419
		TT7673	7	12.5	1.878	0.667-5.284
	dominante	CC7673	25	44.6	1
		CT7673/ TT7673	31	55.4	0.941	0.441-2.008
	recesivo	CC7673/ CT7673	49	87.5	1
		TT7673	7	12.5	1.878	0.667-5.284
	aditivo				1.637	0.544-4.921
Lipoproteína-Colesterol de baja densidad (n=80)	co-dominante	CC7673	33	41.3	1
		CT7673	34	42.5	0.451	0.172-1.182
		TT7673	13	16.3	1.12	0.360-3.486
	dominante	CC7673	33	41.3	1
		CT7673/ TT7673	47	58.8	0.527	0.220-1.258
	recesivo	CC7673/ CT7673	67	83.8	1
		TT7673	13	16.3	1.12	0.360-3.486
	aditivo				0.793	0.241-2.612

*Los datos se presentan como frecuencias y porcentajes de sujetos con valores anormales.

Discusión

Los polimorfismos en genes asociados con dislipidemia u obesidad pueden ser predictores genéticos de ECV en poblaciones donde la asociación es obvia -. En este estudio, se determinaron las frecuencias genotípicas y alélicas para el SNP rs693 y su relación con el perfil lipídico y el IMC en una muestra de la población caribeña colombiana, producto de la mezcla ancestral de africano, amerindio y blanco europeo .

El análisis genotípico del polimorfismo reveló: primero, que en la muestra estudiada la distribución de genotipos no fue significativamente diferente de la distribución esperada para una población en equilibrio de Hardy-Weinberg; segundo, que todos los genotipos posibles para rs693 (TT, TC y CC) estaban presentes; y tercero, que el genotipo TT presentaba una frecuencia menor. Además, el análisis alélico reveló que el alelo C era mayoritario (64%) versus el alelo T (36%).

La frecuencia del alelo T encontrada en este estudio está de acuerdo con las reportadas en una muestra de población mestiza andina colombiana de Armenia-Colombia por Loango et al. , en una muestra de brasileños estudiados por Scartezini et al. , y en una muestra de mexicanos estudiada por Gallegos-Arreola et al . Sin embargo, existen diferencias notables con respecto a las frecuencias alélicas encontradas en las poblaciones europeas, asiáticas y africanas. En las poblaciones europeas, la frecuencia del alelo T es mayor (~53%) -, excepto los noruegos (~27%) , mientras que es menor en los asiáticos (~12%) - y Africanos (~21%) -.

La distribución de genotipos en los caribeños colombianos fue diferente en comparación con la reportada para colombinos de la región andina ubicados en la ciudad de Armenia . Las frecuencias de los genotipos CT y CC fueron más altas en los colombianos de la región andina y se encontró una diferencia significativa cuando se comparó la distribución del genotipo entre estas dos poblaciones. Sin embargo, no se observaron diferencias significativas en las frecuencias de genotipos al comparar los caribeños colombianos con otras poblaciones latinoamericanas (brasileños y mexicanos) , (Tabla 3). Este fenómeno es típico en la población colombiana y es producto de los eventos históricos que lo originaron . La mezcla entre las poblaciones europeas, africanas y amerindias tiene un alcance diferente en cada región de Colombia. En el centro y este de Colombia, incluida Armenia, predominan los antepasados ​​europeos y amerindios; en las regiones costeras, incluida la población caribeña del presente estudio, los antepasados ​​europeos, amerindios y africanos contribuyeron significativamente a esta población .

Por otro lado, en la muestra estudiada, el SNP rs693 no parece influir en los niveles de lípidos plasmáticos. De hecho, no hubo asociación significativa con los genotipos TT y CT, o el alelo mutante T7673; El valor p siempre fue >0.05. Este hallazgo concuerda con lo reportado por Loango et al. , en otro estudio colombiano, cuando no encontraron diferencias estadísticamente significativas (TC p= 0.47, HDL-C p= 0.23; LDL-C p= 0.40; TG p= 0.10). También está de acuerdo con los hallazgos de Srivastava et al. , en una muestra de la población brasileña, y las de Misra et al. , en indios; en estos casos, en todas las comparaciones p >0.05.

En contraste, nuestros resultados difieren de otros hallazgos: Bogari et al. , quienes informaron asociación del alelo T con niveles elevados de colesterol (p= 0.041) y LDL-C (p= 0.021) en egipcios; Tsunoda et al. , quienes, en una población de Mongolia, encontraron una asociación significativa con los niveles de triglicéridos ya que estos fueron significativamente más altos en hombres con genotipo CT7673 que en hombres con genotipo CC (p= 0.047); Liu et al. , quienes informaron en China que los portadores del genotipo CT tienden a tener niveles altos de LDL, pero niveles bajos de HDL-C (p <0.05) y, finalmente, los resultados de Hu et al. , también en China, quienes informaron que los sujetos con alelo T exhibieron niveles significativamente más altos de LDL-C, TC y TG, en comparación con los sujetos con alelo C (p <0.05).

Con respecto al IMC, nuestros resultados no mostraron una asociación significativa ni con los genotipos ni con el alelo T mutante (p >0.05). Este resultado concuerda con el reportado por Loango et al. , quienes, en mestizos colombianos, no encontraron diferencias significativas (p= 0.08) entre los sujetos con alelo T y los sujetos con alelo C. Nuestro estudio concuerda con el de Bogari et al. , quienes no encontraron diferencias significativas en el IMC de sujetos egipcios con genotipos TT, CT y CC y el de Srivastava et al. , quienes informaron falta de asociación (p >0.05). Sin embargo, nuestro resultado es discordante con los hallazgos de Hu et al. , en China, quienes encontraron valores significativamente más altos (p <0.05) en sujetos con alelo T que en sujetos con alelo C.

En este estudio también se estudió la asociación genotipo-fenotipo con respecto al alelo C de tipo salvaje (X-). A diferencia de los hallazgos de Scartezini et al. , y Bohn et al. , que informaron una asociación positiva de este alelo con enfermedad de la arteria coronaria e infarto de miocardio, respectivamente, en este estudio no se encontró asociación (p >0.05).

La similitud de nuestros resultados con los de otro estudio realizado en Colombia, en un área geográfica lejana y diferente, nos lleva a inferir que la mezcla ancestral característica de las dos muestras estudiadas fue el factor clave para reproducir el resultado, a pesar de los factores ambientales y el estilo de vida.

Los factores ambientales pueden contribuir a las diferencias que se deben principalmente a la variabilidad étnica. De hecho, los fenotipos bioquímicos, como los niveles de lípidos plasmáticos, los parámetros antropométricos como el peso, las variables demográficas como el sexo y la edad, las condiciones ambientales como el consumo de alimentos o cigarrillos y los factores específicos del estudio como el tamaño de la muestra o los criterios de inclusión y exclusión, puede influir en las diferencias entre los resultados de este estudio y otros ya mencionados.

En este estudio, existieron limitaciones tales como el amplio rango de edad de los sujetos, las diferencias en el estilo de vida y el tamaño de la muestra. Sin embargo, los resultados de este trabajo exploratorio deben validarse en un futuro estudio con una muestra representativa de la población del Caribe colombiano, bajo el diseño de casos y controles.

Conclusión

Este estudio sugiere que no hay influencia del polimorfismo en los parámetros del perfil lipídico o en el IMC.

1) Why was this study conducted?

The present study was done to explore the association of SNP C/T7673 with dyslipidemia and overweight/obesity in a sample of the Colombian Caribbean population. The development of this study contributed to the field of potential biomarkers of risk of cardiovascular disease (CVD) in the Colombian population.

2) What were the most relevant results of the study?

The distribution of SNP C/T7673 is in Hardy-Weinberg equilibrium in the studied population and the genotypic frequencies are similar to those reported by studies conducted in other Colombian populations and Latin American countries. Finally, it is suggested that the SNP C/T7673 does not influence the lipid profile and BMI in the studied population.

3) What do these results contribute?

In Colombia, there are few studies on the possible association of polymorphism C/T7673 with dyslipidemias and overweight/obesity. These results contribute to new knowledge of biomarkers to identify the risk of CVD.

1) Por que se hizo este estudio?

Este estudio se realizó con el propósito de explorar la asociación del SNP C/T7673 con dislipidemias y sobrepeso/obesidad en una muestra de la población del Caribe Colombiano. El desarrollo de este estudio contribuyó al campo de potenciales biomarcadores de riesgo de enfermedades cardiovasculares (ECV) en población colombiana.

2) Cuales fueron los resultados mas relevantes?

La distribución del SNP C/T7673se encuentra en equilibrio de Hardy-Weinberg en la población de estudio y las frecuencias genotípicas son similares a las reportadas por estudios realizados en otras poblaciones colombianas y países latinoamericanos. Finalmente, se sugiere que el SNP C/T7673 no influye sobre los parámetros del perfil lipídico y el IMC en la población estudiada.

3) Que significan los hallazgos?

En Colombia, existen escasos estudios sobre la posible asociación del polimorfismo C/T7673con dislipidemias y sobrepeso/obesidad. Estos resultados aportan nuevo conocimiento sobre biomarcadores para la identificación de riesgo de ECV.