Molecular characterization and spatiotemporal expression of prohormone convertase 2 in the Pacific abalone, Haliotis discus hannai.

Prohormone convertases (PCs) are subtilisin-like proteases responsible for the intracellular processing of prohormones and proneuropeptides in vertebrates and invertebrates. The full-length PC2 cDNA sequence was cloned from pleuropedal ganglion of Haliotis discus hannai, consisted of 2254-bp with an open reading frame of 1989-bp and encoded a protein of 662 amino acid residues. The architecture of Hdh PC2 displayed key features of PCs, including a signal peptide, a pro-segment domain with sites for autocatalytic activation, a catalytic domain, and a pro-protein domain (P-domain). It shares the highest homology of its amino acid sequence with the PC2 from H. asinina and to lesser extent with that of Homo sapiens and Rana catesbeiana PC2. Sequence alignment analysis indicated that Hdh PC2 was highly conserved in the catalytic domain, including a catalytic triad of serine proteinases of the subtilisin family at positions Asp-195, His-236, and Ser-412. The cloned sequence contained a canonical integrin binding sequence, and four cysteine residues involved in the formation of an intramolecular disulfide link. Phylogenetic analysis revealed that the Hdh PC2 is robustly clustered with the Has PC2. Quantitative PCR assay demonstrated that the Hdh PC2 was predominantly expressed in the pleuropedal ganglion rather than in other examined tissues. Although PC2 mRNA was expressed throughout the gametogenetic cycle of male and female abalone, the expression level was significantly higher in the ripening stage of female abalone. Also, a significantly higher expression was observed in the pleuropedal ganglion and gonadal tissues at a higher effective accumulative temperature (1000°C). In situ hybridization revealed that the PC2 mRNA expressing neurosecretory cells were distributed in the cortex region of the pleuropedal ganglion. According to the results, it can be concluded that pleuropedal ganglion is the highest site of PC2 activity, and this enzyme might be involved in the abalone reproduction process.

Introduction

Prohormone convertases (PCs) are Ca2+ dependent subtilisin-like endoproteases and are thought to be involved in the post-translational process of hormones, neuropeptides, and other regulatory proteins [1,2]. PCs play a pivotal role to convert an inactive neuropeptide precursor into an active mature peptide by limited proteolysis at multiple basic sites [3-5]. Several subtypes of PCs have been identified by molecular cloning and categorized as members of the subtilisin-like endoproteases family. These enzymes include furin, PC1/3, PC2, PC4, PACE4, PC5/6, PC7, SKI-1 (Mbtps1), and PC9 [6]. These neuropeptide proteases are structurally and functionally related to yeast Kex2, and are a homologue of bacterial subtilisin-like serine proteases [7,8]. The subtypes of PCs generally seem to be involved in the tissue-specific processing of multiple neuropeptide and peptide hormones. Some PCs (furin and PACE4) exhibited a ubiquitous tissue distribution, whereas the expression of others, including PC1 and PC2, is restricted to neural and endocrine cells [9]. Although each of these subtypes has distinct characteristics and specificities, similar biochemical properties are found among the members of PCs in both vertebrates and invertebrates [6]. The cDNA architecture of PCs contains an N-terminal signal peptide, a pro-peptide segment, a catalytic domain, a pro-protein domain (P-domain), and a carboxy terminal region with high sequence variability among different subtypes of PCs [10-12]. PC2 is responsible for the maturation of precursor molecules by endoproteolytic cleavage at pairs of basic amino acid residues in the regulated secretory pathway of neuroendocrine cells [13]. In Xenopus, PC2 plays a crucial role in the processing of proopiomelanocoretin (POMC) to α-MSH [13]. It is also involved in the processing of egg-laying hormone-related precursors in atrial-gland secretory cells of Aplysia [14]. Toullec et al.[15] reported that PC2 is the key endoprotease responsible for the maturation of crustacean hyperglycemic hormone (CHH). Homologues of PC2 have been characterized in only few invertebrates, including the nematode Caenorhabditis elegans [16], gastropod mollusk species Lymnaea stagnalis [17], Aplysia californica [14], H. asinina [18], arthropod species Lucilia cuprina [19], Drosophila melanogaster [20], Orconectes limosus [15], and Penaeus monodon [21].

The abalone is a marine gastropod species widely distributed throughout temperate and tropical coastal regions [22]. Of the Haliotis species, H. discus hannai is a highly valued seafood in the southern coasts of China, Japan, Taiwan, and Korea because of the presence of health-beneficial bioactive molecules [23]. Although many neuroendocrine hormones have been reported in H. discus hannai, the enzymes involved in post-translational modification of neuroendocrine hormones in Pacific abalone are lacking. Hence, the present study was conducted to isolate and molecularly characterize the PC2 in H. discus hannai.

Materials and methods

Experimental animals and sample collection

An adult female abalone (H. discus hannai) with shell length of 10.5 cm and total body weight of 148.2 g were collected from Naesan, Gogun-myeon, Jindo Island (34°31'16.2"N 126°22'28.7"E) and transferred to the laboratory in the Department of Fisheries Science, Chonnam National University. The animals were anesthetized with ethyl 3-aminobenzoate methane sulfonate (MS-222: 1g/L; Sigma-Aldrich, St. Louis, MO, USA) and the pleuropedal ganglion, cerebral ganglion, branchial ganglion, digestive gland, testis, ovary, gill, and mantle were collected. Each collected sample was frozen immediately in liquid nitrogen, and then stored at −80°C for total RNA isolation.

For preparing the cryosection, the pleuropedal ganglion was washed in phosphate buffered saline (PBS; pH 7.4) and immersion fixed it in 4% paraformaldehyde (PFA) overnight. A brief procedure of cryosection preparation from pleuropedal ganglion tissue was described by Sharker et al. [24].

Animal experiments were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee of Chonnam National University (CNU IACUC) and according to Article 14th of the Korean Animal Protection Law of the Korean government, and the animals were cared for in accordance with the Guidelines for Animal Experiments of Chonnam National University. No specific permissions are required to work with invertebrates in South Korea. Similarly, no permissions were needed for the collection of H. discus hannai from sample sites because they were not harvested from the protected area and this species is not an endangered or protected species.

RNA isolation and cDNA synthesis

Total RNA was extracted from each tissue of Pacific abalone using an RNeasy mini kit (Qiagen, Hilden, Germany) and treated with RNase-free DNase (Promega, Madison, WI, USA) to eliminate the genomic DNA contamination. The concentration and integrity were then detected by spectrophotometry (NanoDrop® NP 1000 spectrophotometer) and electrophoresis on a 1% (w/v) agarose gel. Total RNA (1 μg) was reverse transcribed to cDNA using Superscript® III First-Strand synthesis kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol.

Cloning and sequencing of PC2

In order to isolate and characterize PC2 cDNA, reverse transcription (RT) primers (sense: 5′- AGAGCTGGTCGTATGTAAGG -3′ and antisense: 5′- GCTACTCCTCCACTCTGTC -3′), were designed based on the H. asinina PC2 cDNA sequence (GenBank accession no. EU684323.1). PCR amplification was performed in a final reaction volume of 20 μL containing 1 μL (20 pmol) each of forward and reverse primers, 4 μL of 5× Phusion HF buffer (1×), 2 μL of dNTP (200 μM), 0.5 μL of 1 U Phusion DNA polymerase, 10.5 μL sterile distilled water (dH2O), and 1 μL of the synthesized cDNA from the pleuropedal ganglion as a template. The cycling condition was as follows: 5 min at 94°C, followed by 35 cycles of 2 min at 94°C, 30 s at 58°C, 30 s at 72°C, with a final dissociation step of 5 min at 72°C. The amplified PCR products were separated on 1.2% agarose gel electrophoresis and purified using a Wizard SV gel and PCR clean-up kit (Promega). The purified PCR products were then ligated into the pTOP Blunt V2 vector (Enzynomics, Daejeon, Korea), and transformed into competent E. coli DH5α cells (Enzynomics). Plasmid DNA was extracted from the positive clones with a plasmid miniprep kit (Qiagen) and sequenced using the Macrogen Online Sequencing System (Macrogen, Seoul, Korea). Rapid amplification of 5′ and 3′ cDNA ends (RACE) were performed with a SMARTer® RACE 5′/3′ Kit (Clontech Laboratories, Inc., USA) according to the manufacturer’s recommendation. Gene-specific primer sequences (GSPs), including a 15-bp overlap with the 5′-end of the GSP sequence (antisense primer: 5′-GATTACGCCAAGCTTGCTGGTCCAGCATTCTCAAGTCTGCAAC-3′, sense primer: 5′- GATTACGCCAAGCTTGTTGCAGACTTGAGAATGCTGGACCAGC-3′), a universal primer mix (UPM): 5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′, and SeqAmp DNA Polymerase in a final volume of 50 μL were used to conduct the RACE PCRs. Touchdown PCR was performed with 25 cycles for 3′-RACE and 30 cycles for 5′-RACE PCR following the kit instructions. Purification of RACE PCR products was done using NucleoSpin Gel and PCR Clean-Up kit and ligated them into the linearized pRACE vector, transformed them into Stellar Competent Cells supplied with the kit, and then sequenced them with the Macrogen Online Sequencing System (Macrogen, Seoul, Korea). Finally, the sequenced RACE products were assembled by overlapping with the initial fragment.

Sequence analysis

To analyze the PC2 protein sequence of H. discus hannai, multiple online software programs were used. Basic Local Alignment Search Tool (BLASTP) (http://www.ncbi.nlm.nih.gov/BLAST/) was used to identify the protein homology of PC2 protein with the PC2 of other species. Predictions of N-linked glycosylation motifs and serine/threonine phosphorylation sites were performed with the NetNGlyc 1.0 server and NetPhosK 1.0 server, respectively. SignalP 4.1 (www.cbs.dtu.dk/services/SignalP/) was used to infer the N-terminal signal peptide, and the bonding state of cysteines in the protein sequence was determined using CYSPRED [25]. Physical and chemical properties associated with the primary sequence of the protein were calculated using ProtParam (http://expasy.org/tools/protparam.html), and subcellular localization was determined with Protcomp (http://www.softberry.com/berry.phtml). Multiple alignments of the deduced amino acid sequences of PC2 protein were accomplished with Clustal Omega [26,27]. Jalview, version 2.10.0 (www.jalview.org) was used for editing and visualizing the aligned sequence [28].

Phylogenetic analysis

To construct a phylogenetic tree, PC2 protein sequences from invertebrates and vertebrates were retrieved from the NCBI database using the BLASTP algorithm. The sequences were aligned using Clustal Omega [26,27]. The tree was generated with MEGA software (version 6.06) using a neighbor-joining method with 1,000 bootstrapping replicates [29].

Quantitative PCR (qPCR) analysis

The tissue expression pattern of PC2 mRNA was analyzed by qPCR assay using the 2× qPCRBIO SyGreen Mix Lo-Rox kit (PCR Biosystems, Ltd., London, UK) according to the manufacturer’s protocol. Gene-specific primers (forward: 5′-ATGTAAGGAGGTCGAAGTGC-3′ and reverse: 5′-GTCTAGTATGTGGTACGCTTC-3′) and primers (forward: 5′- TGTCCGTTTCACCAACAAGG-3′ and reverse: 5′- AGATGGAATCAAGTTTCAATT -3′) from ribosomal protein L-5 gene (RPL-5, JX002679.1) of H. discus hannai were used to normalize the expression of the target gene. The 20 μL reaction mixtures comprised 1 μL cDNA template of each tissue, 1 μL (10 pmol) of each forward and reverse primer, 10 μL SyGreen Mix, and 7 μL PCR-grade water. PCR was performed under the following conditions: pre-incubation at 94°C for 5 min, followed by three-step amplification at 95°C for 2 min, 60°C for 30 s, and 72°C for 30 s for 40 cycles. Three replicates (N = 3) were done for each qPCR product. The relative gene expression was analyzed on the basis of the 2−ΔΔct method [30].

Expression of PC2 mRNA in gonads during gametogenesis

qPCR assay was performed to assess the expression levels of PC2 mRNA in the gonads at different stages. The stages of the gonad were classified according to a previous study [31]. qPCR assay and analysis of relative mRNA levels were performed as previously described.

Expression of PC2 mRNA in neural ganglia and gonad at Effective Accumulated Temperature (EAT)

The mature abalones were obtained from the hatchery and kept in the tanks with filtered seawater and continuous aeration at 9.5°C for one month. The sample preparation and expression level of PC2 mRNA transcript at different EAT was found according to the method described by [31]. One microliter of cDNA template from the neural ganglia and gonadal tissues at different EAT were used to do the qPCR assay.

In Situ Hybridization (ISH)

DIG-labeled antisense and sense RNA probes were prepared from the coding region of the PC2 nucleotide sequence by in vitro transcription following previous studies in H. discus hannai [24,31]. The pleuropedal ganglion tissue sections were pre-hybridized with hybridization buffer and yeast total RNA (50 μL) for 2 h, followed by overnight hybridization with the RNA probe at 65°C. The hybridized tissue sections were sequentially washed, and then non-specific binding was blocked with 10% calf serum for 1 h at room temperature. The sections were incubated at 4°C overnight with alkaline phosphatase-conjugated anti-digoxigenin-Ap-Fab fragments antibody (diluted 1:500 in blocking solution [Roche]) to detect the hybridization signal. Finally, the sections were treated with the labeling mix (2 ml alkaline tris buffer, 9 μl nitroblue tetrazolium, 7 μl 5-bromo-4-chloro-3-indolyl phosphate disodium salt) and incubated in a dark and humid chamber for at least 1 h to observe the color. After optimal color development, the sections were observed and photographed using a stereo microscope (SMZ1500, Nikon, Tokyo, Japan).

Nuclear fast red counterstain

Antisense probe hybridized ISH slides were counterstained using nuclear fast red (Sigma- Aldrich, USA). Slides were rinsed with distilled water and then incubated in nuclear fast red solution for 5 min followed by washing in tap water for 3 min. Slides were dehydrated using ascending series of ethanol, dipped in histo-clear (National diagnostics, USA) for 3 min, and finally cover-slipped with permount mounting medium.

Statistical analysis

Data were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons using SPSS (version 16.0) to detect the differences in relative mRNA expression levels. All the data are presented as mean ± SD, and a difference of p < 0.05 was regarded as statistically significant.

Results

Cloning and characterization of PC2 from Pacific abalone

The full-length PC2 cDNA sequence was obtained from the pleuropedal ganglion and referred to as Hdh PC2. The sequence data have been deposited in the GenBank database under the accession number MN822082. A total of 2254-bp cDNA transcript of PC2 contained a 143-bp 5′-untranslated region (UTR) and a 122-bp 3′-UTR with a canonical polyadenylation signal sequence (AATAAA) located 13-bp upstream of the poly-A tail. The open reading frame showed a complete coding sequence of 1989-bp that encodes a putative protein of 662 amino acids with a theoretical molecular mass of 73.38 kDa and an isoelectric point of 6.91 (Fig 1).

Fig 1

The nucleotide and deduced amino-acid sequences encoding a PC2 of Pacific abalone.

The initiation and termination codon (asterisks), and the classical polyadenylation signal are in the bold font. The N-terminal signal peptide is underlined with dots. The potential N-linked glycosylation and phosphorylation sites are shown by circles and triangles, respectively. Four cysteine residues (Cys-240, Cys-253, CYS-347, and Cys-498) that form a disulfide link are shaded in green. The active-site residues (ASP, His, and Ser) are circled, and the ASP residue stabilizing the oxyanion is boxed. The canonical integrin-binding motif is denoted by a green background. The pro-region, catalytic site, and P-domain are delimited by a broken line with arrows, a solid line, and a broken line, respectively.

In silico analysis (protcomp, http://www.softberry.com/berry.phtml) indicated that the sub-cellular localization of this deduced protein is in the membrane bound golgi network. The cloned sequence contained a 29-amino acid NH2-terminal signal peptide, a pro-segment region, a catalytic domain, and a pro-protein domain (P-domain) with a variable C-terminal region. The three active sites residue (D195, H 236, S412) consisting of a catalytic triad of serine protinases of the subtilisin family were found in this sequence. The ASP338 residue was believed to be involved in the oxyanion stabilization. A canonical integrin binding signatures (RGD) were present in the P-domain of Pacific abalone PC2. Three potential N-linked glycosylation motifs (Asn-281, Asn-311, and Asn-403), and four cysteine residues (Cys-240, Cys-253, Cys-347, and Cys-498), were identified which could potentially form an intrachain disulfide link. The threonine and serine residues at positions 166S, 231T, 377S, 381S, 444T, 462S, and 505T serve as potential sites for phosphorylation by protein kinase A or C. A BLASTP search indicated that this translated protein sequence showed the highest homology (95%) with the H. asinina PC2 (Has PC2). It also exhibited 73%, 71%, 66%, and 61% identity with A. californica, L. stagnalis, Mizuhopecten yessoensis, and Limulus polyphemus PC2, respectively.

Multiple sequence alignment analysis demonstrated that the potential cleavage site indicating the pro-segment region was conserved remarkably among different invertebrate species. The catalytic triad and oxyanion hole residues were also well conserved in the PC2 sequences (Fig 2).

Fig 2

Comparative alignment of the predicted Hdh PC2 amino-acid sequences of the Pacific abalone with those of other invertebrate PC2.

The pro-domain indicating the cleavage site is denoted by a diamond circle. The catalytic triad active-site residues and the cognate integrin-binding residue are indicated by black arrowheads and asterisks, respectively. Plus sign (+) represents the oxyanion hole residue.

The integrin binding sequence Arg547 and Gly548 were conserved in all organisms, whereas the ASP549 residue was replaced by a Cys residue in P. canaliculata, L. stagnalis, and A. californica, and a Tyr residue in H. asinina and H. rubra.

The constructed phylogenetic tree revealed several distinct clades. Hdh PC2 is contained in the gastropod PC2 clade and is more closely related to Has PC2. The H. discus hannai serine protease was used as a outgroup (Fig 3).

Fig 3

Molecular phylogenetic analysis of Hdh PC2 using a neighbor-joining method after Clustal Omega alignment.

The 1000 bootstrap replicates to construct the phylogenetic tree. The 0.20 scale bar indicates the number of amino acid substitutions per site. The Hdh PC2 in this study is highlighted in the bold font.

qPCR assay was performed to investigate the mRNA expression profile of Hdh PC2 in neural ganglia (cerebral ganglion, branchial ganglion, pleuropedal ganglion), digestive gland, gonad (testis, ovary), gill, and mantle using gene-specific and ribosomal protein L-5 (RPL-5) primers. The RPL-5 gene (JX002679.1) of H. discus hannai was used as internal control based on its expression stability. The results of the qPCR showed that the relative mRNA abundance of Hdh PC2 was significantly (p < 0.05) higher in the pleuropedal ganglion than in other examined tissues (Fig 4).

Fig 4

Different mRNA expression levels of Hdh PC2 (means ± SD, N = 3) in various tissues were quantified using qPCR.

Data were compared with the value of the branchial ganglion, which was assigned a relative value of 1. Different letters indicate significant differences (p < 0.05).

The Hdh PC2 mRNA was expressed differently in the gonad at different gametogenesis stages of Pacific abalone. In female, PC2 mRNA was expressed moderately in the degenerative, spent, and active stages, but a significantly higher level of expression was found in the ripening stage (Fig 5).

Fig 5

Quantitative PCR analysis of Hdh PC2 mRNA expression in the gonads (ovary and testis) at different gametogenetic stages.

Asterisks indicate significant differences (p < 0.05). DS, Degenerative stage; AS, Active stage; RS, Ripening stage; SS, Spent stage.

Although the relative mRNA expression level showed a rising tendency in the male reproductive cycle, there were no statistical differences between the different gametogenetic stages.

The expression levels of Hdh PC2 mRNA in the neural ganglia and gonad was investigated by qPCR at different effective accumulative temperatures (EAT). It has been shown that the pleuropedal ganglion, testis, and ovary exhibited significantly higher expression at 1000°C (Fig 6). There were no significant differences observed in other ganglia at different EAT.

Fig 6

Expression pattern of Hdh PC2 mRNA in neural ganglia and gonads at different Effective Accumulative Temperatures (EAT).

The mRNA levels were quantified by qPCR. Asterisks indicate significant differences (p < 0.05).

The site of PC2 mRNA expression in the pleuropedal ganglion section was found by in situ hybridization with a DIG-labeled antisense probe. The positive hybridization signal for PC2 mRNA transcript was found in cells shown in purple color (Fig 7A, 7B, 7C and 7D).

Fig 7

In situ detection of Hdh PC2 mRNA in the pleuropedal ganglion of Pacific abalone.

(A) Positively stained neurosecretory cells expressing the Hdh PC2 mRNA in the cortex region is indicated by arrowheads; (B) Medium magnification of A; (C) High magnification showing hybridized Hdh PC2 mRNA in neurosecretory cells; (D) Medium magnification of the section showing a positive hybridization signal in the other part of the cortex region; (E) Hybridized with the Hdh PC2 sense riboprobe showing no hybridization signal; (F) Fast red counterstaining of section C demonstrated hybridized neurosecretory cells. Co, Cortex; Me, Medullae. Scale bars, 100 μm.

These types of signals were not visualized in the negative control section, because of the absence of an antisense probe in the hybridization mix during incubation (Fig 7E). The results of fast red counterstaining indicated that the positive signal was likely localized in the neurosecretory cells of the cortex region (Fig 7F).

Discussion

Prohormone convertases act as a molecular switch for the processing of biologically inactive polypeptide precursors to active peptides by limited endoproteolysis. This proteinase determines the cell type and time at which mature products are derived from a given inactive precursor protein, thereby profoundly affecting cellular communication, differentiation, and metabolic activity [9]. In mollusks, the PC2 was first reported in the cerebral ganglion of the central nervous system of the freshwater snail, L. stagnalis [17]. To date, reports on the molecular characterization and expression profile of PC2 in H. discus hannai has been lacking. For the first time, this study demonstrated the mRNA sequence encoding the PC2 from the pleuropedal ganglion of H. discus hannai. Similar to other PCs, the structural profile of Hdh PC2 possesses several recognition motifs, including a hydrophobic signal peptide, a pro-segment, a subtilisin-homologous catalytic region, a P-domain, and a variable C-terminal region (Fig 1). The catalytic domain contained Asp, His, and Ser active site residues, which seem to be involved in transition-state stabilization [32]. The catalytically important residue Asp338, which is thought to be important for oxyanion stabilization during catalysis [33] as well as for interaction with the specific binding neuroendocrine polypeptide 7B2 in endoplasmic reticulum [34,35]. The presence of tyrosine sulfation, N-linked glycosylation, and phosphorylation motif might be crucial for preventing PC2 degradation in ER [36]. In the P-domain, the integrin-recognition sequence (RGD) plays a critical role in the intracellular sorting of enzymes into secretory granules as well as for controlling the stability of the enzyme within the ER [37]. Three putative N-linked glycosylation motifs were evident in Hdh PC2 (Fig 1), predicting it to be a glycoprotein. The predicted protein might be localized in the membrane bound golgi network which is in agreement with the results of previous studies [6].

The outcome of multiple sequence alignment indicated that the Hdh PC2 showed high degree of sequence identity in the catalytic region, proving that these residues are crucial in the catalytic activity of the enzyme (Fig 2). This result is consistent with previous reports [18,38].

The constructed phylogenetic tree revealed that the Hdh PC2 is robustly clustered with the Has PC2 and is most similar to other molluscan PC2s (Fig 3). Similar reports have been published by Cummins et al. [18], who observed that the PC2 of H. asinina is most closely related to H. rubra, L. stagnalis, and A. californica homologues.

The tissue-specific expression and relative mRNA expression of Hdh PC2 were determined using a qPCR assay. In the present study, a significantly higher expression was found in the pleuropedal ganglion than in other examined tissues (Fig 4). These results suggest that pleuropedal ganglion could be the main site of PC2 activity in abalone.

In order to explore the physiological activities of PC2 in H. discus hannai reproduction, the expression profile of PC2 mRNA was analyzed at different phases of the reproductive cycle. The results showed that the expression level of PC2 is higher in the ripening stage, suggesting that PC2 might be involved in reproductive regulation of the Pacific abalone. The level of a follicle-stimulating hormone (FSH) and luteinizing hormone (LH) would increase via the conversion of a prohormone into a mature peptide during the reproductive season of the freshwater snail [39]. Liu and Sun [40] reported that the egg-laying hormone usually existing as a biologically inactive precursor, needed to be converted into an active form by protease cleavage, such as prohormone convertase. PCs may play an important role in the processing of gonadotropin-releasing hormone, which is essential for the maturation of the gonads [41].

In abalone, effective accumulative temperature (EAT) is an influential factor for the regulation of gonadal maturation and spawning [42]. To date, no reports on the PC2 mRNA expression in tissues at different EAT in the abalone species have been published. In this study, the mRNA abundance of PC2 was highest in pleuropedal ganglion and gonadal tissues at higher EAT (Fig 6). The results suggest that the rate of gonadal development and quantity of gametes increases with increasing EAT.

Previously, the distribution and expression of PC2 has been studied in the clawed frog [13], bullfrog [43], and medaka [38] by using in situ hybridization. An in situ hybridization experiment with the antisense mRNA in H. asinina PC2 revealed that PC2 mRNA transcripts were present in the cerebral and pleuropedal ganglia [18]. The Lymnaea PC2 mRNA was predominantly expressed in the central nervous system [17]. In this study, in situ hybridization of PC2 was shown to be expressed in the neurosecretory cells of the pleuropedal ganglion. All these data suggest that the PC2 enzyme might be synthesized in neural ganglia and be essential for intracellular processing of the prohormone that is involved in the gonadal maturation of abalone.

(PDF)

Click here for additional data file.

27 Feb 2020

PONE-D-20-03317

Molecular characterization and spatiotemporal expression of prohormone convertase 2 in the Pacific abalone, Haliotis discus hannai

PLOS ONE

Dear Dr Kang Hee Kho,

Thank you for submitting your manuscript to PLOS ONE. Despite the difficulties in getting a second reviewer, the reviewer 1 has performed a very detail and constructive evaluation to which I fully aggre. After careful consideration, we both feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that convincingly addresses all the points indicated by the reviewer.

We would appreciate receiving your revised manuscript by April 1st. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Maria Gasset, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional location information of the collection site, including geographic coordinates for the data set if available.

3. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the collection site access and, if no permits were required, a brief statement explaining why.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript by Sharker and colleagues describes the identification and functional characterization of a prohormone convertase from the pleuropedal ganglion of the abalone Haliotis discus hannai. Although most of the analyses have been carried out quite efficiently, there are several points of this manuscript that require attention. I feel like the text could be improved by removing the unnecessary section about the structural modeling (it is unclear why this was performed by the authors since the results have not been discussed) and removing the parts concerning semi-quantitative PCR (which was just used as a preliminary analysis for qRT-PCR). Please find my detailed report attached below.

Line 143: This section is largely deficient in terms of the data provided. First, how were such sequences selected? Were all the sequences available in public databases used? Why were two different phylogenetic inference mathods (NJ and ME) used? In figure 3, the authors only reported the NJ tree, so it is needless to include the mention of the ME tree here.

Lines 149-150: too little information has been provided. It is important to specify which were the top scoring templates used for modeling (i.e. are other similar 3D structure available in the PDB database?).

Lines 171-172: “The melting temperature was 95°C for 10 s, 65°C for 1 min, and 97°C for 1 s as a default setting.”. This sentence seems out of place, as the cycling conditions have been described above. What are the authors referring to? I guess this sentence was supposed to describe the melting curve analysis, but its description is completely wrong.

Line 217: “This is the Fig 1 title.” -> ???

Line 226: “In silico analysis indicated that the deduced protein might be localized in the plasma membrane.” -> This is not very clear, considering that the following sentences do not describe any transmembrane domain. Which in silico analyses specifically indicate a plasma membrane localization? Based on literature data, what would be the expected subcellular localization of PC2? Is it common to find PC2 associated with the plasma membrane?

Line 256: “monophyletc outgroup”? What do the authors mean by this? This should be simply defined as “outgroup”.

Lines 265-266: “with a C-score between 2 and 4” -> NO. The C-score ranges from -4 and 2 and a given model is only characterized by a unique c-score, not by a range.

Lines 267-270: several critical information are missing here. Reporting proQ and ERRAT scores is quite useless if the authors do not report which structural templates were used for modeling. More in general, it looks like the structural modeling part had little sense in this manuscript, as it was not discussed in any meaningful way. My impression is that the authors were not very expert in the use of I-TASSER (which is a very easy-to-use online tool) and that their ability to discuss the outcome of the modeling process was very limited. Since the 3D structure of PC2 is not discussed in any way in this manuscript and the authors obviously have little idea about what they are doing here, I suggest that this part should be entirely removed, since it is pointless for the aims and scopes of this manuscript. The discussion found in lines 342-344 is very poor and uninformative. What was the reason to include structural modeling data in this manuscript is this is actually completely irrelevant for the discussion of the findings?

The semi-quantitative PCR analysis can be removed from the text. Obviously, this was just performed as a preliminary analysis to set-up the q-PCR analysis, which is a much superior method. Please remove this part (from the materials and methods and from the results section) and only leave the qPCR results.

Line 348: this should be expanded. What types of hormones are usually produced by this organ? Note that most of the readers of PlosONE are not familiar with abalone anatomy.

Line 546: CLUSTALW -> wasn’ ClustalOmega used (see materials and methods)

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

13 Mar 2020

Reviewer #1: The manuscript by Sharker and colleagues describes the identification and functional characterization of a prohormone convertase from the pleuropedal ganglion of the abalone Haliotis discus hannai. Although most of the analyses have been carried out quite efficiently, there are several points of this manuscript that require attention. I feel like the text could be improved by removing the unnecessary section about the structural modeling (it is unclear why this was performed by the authors since the results have not been discussed) and removing the parts concerning semi-quantitative PCR (which was just used as a preliminary analysis for qRT-PCR). Please find my detailed report attached below.

Line 143: This section is largely deficient in terms of the data provided. First, how were such sequences selected? Were all the sequences available in public databases used? Why were two different phylogenetic inference mathods (NJ and ME) used? In figure 3, the authors only reported the NJ tree, so it is needless to include the mention of the ME tree here.

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Therefore, we have added such information. To construct a phylogenetic tree, PC2 protein sequences from invertebrates and vertebrates were retrieved from the NCBI database using the BLASTP algorithm. This sentence is incorporated into lines151-152. Based on your valuable suggestion, I omitted the minimum evolution method from the line number 154.

Lines 149-150: too little information has been provided. It is important to specify which were the top scoring templates used for modeling (i.e. are other similar 3D structure available in the PDB database?).

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Therefore, we have revised it accordingly and omitted from the abstract (line number 38-40) materials and methods (line number 155-160), and result (line number 266-275)section.

Lines 171-172: “The melting temperature was 95°C for 10 s, 65°C for 1 min, and 97°C for 1 s as a default setting.”. This sentence seems out of place, as the cycling conditions have been described above. What are the authors referring to? I guess this sentence was supposed to describe the melting curve analysis, but its description is completely wrong.

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Therefore we revised it and omitted this sentence from the line number 182.

Line 217: “This is the Fig 1 title.” -> ???

Response: Based on the journal format, I incorporated the Fig. legend.

Line 226: “In silico analysis indicated that the deduced protein might be localized in the plasma membrane.” -> This is not very clear, considering that the following sentences do not describe any transmembrane domain. Which in silico analyses specifically indicate a plasma membrane localization? Based on literature data, what would be the expected subcellular localization of PC2? Is it common to find PC2 associated with the plasma membrane?

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Therefore, we have added such information. In silico analysis (protcomp, http://linux1.softberry.com/berry.phtml) indicated that the sub-cellular localization of this deduced protein is in the plasma membrane. This sentence is incorporated into lines 233-234.

Line 256: “monophyletc outgroup”? What do the authors mean by this? This should be simply defined as “outgroup”.

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Therefore, we revised it accordingly as shown in line number 261.

Lines 265-266: “with a C-score between 2 and 4” -> NO. The C-score ranges from -4 and 2 and a given model is only characterized by a unique c-score, not by a range.

Lines 267-270: several critical information are missing here. Reporting proQ and ERRAT scores is quite useless if the authors do not report which structural templates were used for modeling. More in general, it looks like the structural modeling part had little sense in this manuscript, as it was not discussed in any meaningful way. My impression is that the authors were not very expert in the use of I-TASSER (which is a very easy-to-use online tool) and that their ability to discuss the outcome of the modeling process was very limited. Since the 3D structure of PC2 is not discussed in any way in this manuscript and the authors obviously have little idea about what they are doing here, I suggest that this part should be entirely removed, since it is pointless for the aims and scopes of this manuscript. The discussion found in lines 342-344 is very poor and uninformative. What was the reason to include structural modeling data in this manuscript is this is actually completely irrelevant for the discussion of the findings? The semi-quantitative PCR analysis can be removed from the text. Obviously, this was just performed as a preliminary analysis to set-up the q-PCR analysis, which is a much superior method. Please remove this part (from the materials and methods and from the results section) and only leave the qPCR results.

Response: Based on your valuable suggestion, I omitted the 3D structure of PC2 and semi quantitative PCR from materials and methods, results, and discussion section. I also incorporated the following sentence in the line number 289-291.

qPCR assay was performed to investigate the mRNA expression profile of Hdh PC2 in neural ganglia (cerebral ganglia, branchial ganglia, pleuropedal ganglia), digestive gland, gonad (testis, ovary), gill, and mantle using gene-specific and ribosomal protein L-5 (RPL-5) primers.

Line 348: this should be expanded. What types of hormones are usually produced by this organ? Note that most of the readers of PlosONE are not familiar with abalone anatomy.

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Please see the following sentences

Neuroendocrine hormone and their receptor such as GnRH (Kim et al., 2017), GnRH receptor (Sharker et al., unpublished), serotonin receptor (Sharker et al., 2020) and also steroid enzymes 17β HSD-11 (Sharker et al., unpublished) are synthesized from pleuropedal ganglion. PC2 (Neuroendocrine/prohormone convertase) seems to be involved in the posttranslational process of neuroendocrine hormone.

Line 546: CLUSTALW -> wasn’ ClustalOmega used (see materials and methods)

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Therefore we have inserted it as shown in line number 548.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: The manuscript style meets the PLOS ONE's style requirements.

2. In your Methods section, please provide additional location information of the collection site, including geographic coordinates for the data set if available.

Response: Based on your valuable suggestion, I incorporated the location of collection site in the line number 86.

3. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the collection site access and, if no permits were required, a brief statement explaining why.

Response: Based on your valuable suggestion, we have added such information in the line number 95-101.

Animal experiments were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee of Chonnam National University (CNU IACUC) and according to Article 14th of the Korean Animal Protection Law of the Korean government, and the animals were cared for in accordance with the Guidelines for Animal Experiments of Chonnam National University. No specific permissions are required to work with invertebrates in South Korea. Similarly, no permissions were needed for the collection of H. discus hannai from sample sites because they were not harvested from the protected area and this species is not an endangered or protected species.

Ethical approval information of abalone

All vertebrate animal research requires approval from the institution's animal care and usage committee. However, this is not necessarily for invertebrates. Abalone (Haliotis discus hannai) is an invertebrate gastropod mollusk. So, abalone does not require approval from the authority.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Response: I incorporated the gel figure as supporting information.

Submitted filename: Response to reviewers.docx

Click here for additional data file.

18 Mar 2020

PONE-D-20-03317R1

Molecular characterization and spatiotemporal expression of prohormone convertase 2 in the Pacific abalone, Haliotis discus hannai

PLOS ONE

Dear Dr Kang Hee Kho,

Thank you for submitting your revised manuscript to PLOS ONE. After careful consideration, we feel that it still needs a few minor corrections. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by May 02 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Maria Gasset, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thank you for providing a revised version of this manuscript. I feel like the manuscript has been significantly improved with the removal of the 3D modeling part and a better definition of some key passages of the main text.

There are however some important points that still require attention.

1) The authors mention the use of Softberry to predict the subcellular localization of this protein, but provided a link to an outdated version of this portal. The authors should state that the tools used for this prediction is ProtComp 9.0 and provide the appropriate reference. Moreover, it appears that the subcellular localization of the protein is not the plasma membrane, but the Golgi apparatus. I have retrieved the sequence myself using the accession ID provided by the authors and verified that the predicted subcellular localization is Golgi. This would make much more sense than having a transmembrane localization, as proteolytic processing often happens in the Golgi network (see for example https://doi.org/10.1074/jbc.M507193200. I would urge the authors to correct this result and add necessary literature references to works that report the expected subcellular localization of similar proteases.

2) The authors updated their phylogenetic tree and mentioned that the sequences added were detected through BLASTp. Which selection criteria were used? Any specific threshold of primary sequence homology? The authors should explain whether other paralogous genes were present and how these were excluded.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Marco Gerdol

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

19 Mar 2020

Reviewer #1: Thank you for providing a revised version of this manuscript. I feel like the manuscript has been significantly improved with the removal of the 3D modeling part and a better definition of some key passages of the main text.

There are however some important points that still require attention.

1) The authors mention the use of Softberry to predict the subcellular localization of this protein, but provided a link to an outdated version of this portal. The authors should state that the tools used for this prediction is ProtComp 9.0 and provide the appropriate reference. Moreover, it appears that the subcellular localization of the protein is not the plasma membrane, but the Golgi apparatus. I have retrieved the sequence myself using the accession ID provided by the authors and verified that the predicted subcellular localization is Golgi. This would make much more sense than having a transmembrane localization, as proteolytic processing often happens in the Golgi network (see for example https://doi.org/10.1074/jbc.M507193200. I would urge the authors to correct this result and add necessary literature references to works that report the expected subcellular localization of similar proteases.

Response: We thank the reviewer for pointing this out and we agree with the reviewer. Therefore, we have added such information. In silico analysis (protcomp, http://www.softberry.com/berry.phtml) indicated that the sub-cellular localization of this deduced protein is in the membrane bound golgi network. This sentence is incorporated into lines 216-217. We have also added ‘The predicted protein might be localized in the membrane bound golgi network which is in agreement with the results of previous studies [6]’ in the line number 306-307.

2) The authors updated their phylogenetic tree and mentioned that the sequences added were detected through BLASTp. Which selection criteria were used? Any specific threshold of primary sequence homology? The authors should explain whether other paralogous genes were present and how these were excluded.

Response: Thank you very much for your valuable comments. We did not consider any specific threshold for selecting sequence homology. Based on your valuable suggestions, we included paralogous genes of PCs and reconstructed the phylogenetic tree. We have added following information in the line numbers 241-243 and inserted the reconstructed phylogenetic tree figure (Fig. 3)

‘The constructed phylogenetic tree revealed several distinct clades. Hdh PC2 is contained in the gastropod PC2 clade and is more closely related to Has PC2’.

Submitted filename: Response to reviewers.docx

Click here for additional data file.

23 Mar 2020

Molecular characterization and spatiotemporal expression of prohormone convertase 2 in the Pacific abalone, Haliotis discus hannai

PONE-D-20-03317R2

Dear Dr. Kang Hee Kho,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Maria Gasset, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thank. All my concerns have been appropriately addressed. In my opinion the manuscript is now accepyable for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

27 Mar 2020

PONE-D-20-03317R2

Molecular characterization and spatiotemporal expression of prohormone convertase 2 in the Pacific abalone, Haliotis discus hannai

Dear Dr. Kho:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Maria Gasset

Academic Editor

PLOS ONE