Literature DB >> 32268093

TLR9 Sensing of Self-DNA Controls Cell-Mediated Immunity to Listeria Infection via Rapid Conversion of Conventional CD4+ T Cells to Treg.

Joseph S Dolina1, Joey Lee2, Ryan Q Griswold2, Lara Labarta-Bajo3, Sumetha Kannan4, Jason A Greenbaum4, Nawal Bahia El Idrissi5, Margot J Pont6, Michael Croft7, Stephen P Schoenberger8.   

Abstract

CD4+ T lymphocytes are crucial for controlling a range of innate and adaptive immune effectors. For CD8+ cytotoxic T lymphocyte (CTL) responses, CD4+ T cells can function as helpers (TH) to amplify magnitude and functionality or as regulatory cells (Treg) capable of profound inhibition. It is unclear what determines differentiation to these phenotypes and whether pathogens provoke alternate programs. We find that, depending on the size of initial dose, Listeria infection drives CD4+ T cells to act as TH or induces rapid polyclonal conversion to immunosuppressive Treg. Conversion to Treg depends on the TLR9 and IL-12 pathways elicited by CD8α+ dendritic cell (DC) sensing of danger-associated neutrophil self-DNA. These findings resolve long-standing questions regarding the conditional requirement for TH amongst pathogens and reveal a remarkable degree of plasticity in the function of CD4+ T cells, which can be quickly converted to Tregin vivo by infection-mediated immune modulation.
Copyright © 2020 The Author(s). Published by Elsevier Inc. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32268093      PMCID: PMC8903023          DOI: 10.1016/j.celrep.2020.01.040

Source DB:  PubMed          Journal:  Cell Rep            Impact factor:   9.995


INTRODUCTION

CD4+ T cells comprise a broad array of phenotypic and functional lymphocyte subsets that assume specialized roles in the generation, differentiation, maintenance, and termination of immune responses (Yamane and Paul, 2013; Zhu et al., 2010). These include T-helper 1 (TH1) cells that produce interferon-γ (IFN-γ) and are involved in responses to intracellular pathogens; TH2 cells that produce interleukin-4 (IL-4), IL-5, and IL-13 for the control of helminth infections; and TH17 cells that produce IL-17A/F in response to extracellular pathogens. The TH1 subset in particular plays a crucial role in the priming and functional development of CD8+ T cell responses through the activation of antigen-presenting cells (APCs) via CD40L (Castellino and Germain, 2006; Haring et al., 2006; Janssen et al., 2003; Khanolkar et al., 2007; Schoenberger et al., 1998; Wiesel and Oxenius, 2012). A long-standing paradox in this regard concerns the conditional requirement for CD4+ T cell help by CD8+ T cell responses, with some immunogens needing CD4+ T cells to generate effective primary and secondary CD8+ T cell responses, while others appear to do so in the absence of CD4+ T cells. Further complicating matters, the same immunogen has been reported to elicit both helper-dependent and helper-independent cytotoxic T lymphocyte (CTL) responses in different studies (Wiesel and Oxenius, 2012). Mechanisms underlying these distinct findings are poorly understood and likely reflect critical differences between experimental systems. Examples of such disparities may include direct activation of APCs or CD8+ T cells by pattern recognition receptors (PRRs) such as the prototypical Toll-like receptor (TLR) system (O’Neill et al., 2013) or various inflammatory cytokines involving type I IFN, IL-2, and IL-6 (Haring et al., 2006; Wiesel and Oxenius, 2012). In addition to a helper role, CD4+ T cells also inhibit CD8+ T cells through their regulatory T cell (Treg) subset, which relies on the expression of the transcription factor (TF) FoxP3 for its development, maintenance, and immunosuppressive function (Hori et al., 2003). Treg are comprised of more stable naturally occurring Treg (nTreg), which develop in the thymus, and a peripheral Treg (pTreg) subset generated from FoxP3− conventional CD4+ T cell precursors (Josefowicz et al., 2012). Both subsets have been implicated in mediating potent immunosuppression to a range of physiologic challenges, including microbial infection, atopy, and cancer, in which their absence leads to lethal autoimmunity in both mice and humans (Vignali et al., 2008). Whereas it is generally accepted that nTreg become committed to a regulatory fate while still in the thymus (Josefowicz et al., 2012), the pathway(s) through which pTreg are generated from conventional CD4+ T cells is less clear, with studies showing that this can occur through stimulation by a number of specific factors, including IL-10 (Bergmann et al., 2007), transforming growth factor b1 (TGF-b1) (Chen et al., 2003), low dose antigen (Kretschmer et al., 2005; Turner et al., 2009), and certain dendritic cell (DC) subsets (Tarbell et al., 2004; Yamazaki et al., 2007, 2008). The stability of pTreg is also a matter of debate (Sakaguchi et al., 2013)—some studies have shown that loss of FoxP3 can allow development to TH subsets (Williams and Rudensky, 2007), while others using alternative lineage-tracking methods argue that such reprogramming does not take place (Miyao et al., 2012). These observations raise the possibility that pTreg define a functionally discrete state that is achievable by naive CD4+ precursors, rather than a specific irreversible cellular fate, as it does for thymically derived nTreg. Such a view immediately raises questions regarding the factors governing their generation in vivo by physiological conditions—which cell types or states can acquire Treg function and how? The same questions are relevant for TH1 cells that provide help for CD8+ T cell responses in light of their variable requirement among different infection models and the demonstration that infection can both stimulate and suppress the immune system (Bach, 2005; Rowe et al., 2012). Given that both subsets can develop from naive cells, we sought to evaluate the quantitative and kinetic parameters that govern the generation of TH1 versus Treg in the context of a pathogenic infection for which a variable dependence on CD4+ T cells has been reported.

RESULTS

Dose-Dependent Priming of CD4+ and CD8+ T Cell Subsets by Listeria

The CD8+ T cell response to the infectious pathogen Listeria monocytogenes (Lm) mirrors the variability reported for many infection models in that depending on the strain, inoculum dosage, route of delivery, and method of CD4+ T cell removal or blockade, these can be shown to be either dependent on or independent of CD4+ T cells (Bevan, 2004; Castellino and Germain, 2006; Khanolkar et al., 2007). We therefore sought to limit the variables to a single parameter—initial infectious dose. We evaluated the kinetics and magnitude of total and Ova257–264 antigen-specific (Ova-specific) CD8+ T cells, conventional (NK1.1−) CD4+ T cells, and regulatory (CD25+FoxP3+) CD4+ T cells (Treg) at various time points following intravenous (i.v.) inoculation of C57BL/6 mice with low dose (LD; 1 × 103 colony-forming units [CFUs]) or high-dose (HD; 1 × 106 CFUs) Lm ΔactA-Ova. Whereas both LD and HD infection produced CD8+ T cell responses that peaked at day 7 post-infection, the larger HD inoculum induced both Ova-specific and polyclonal CD8+ T cell responses of 3-fold greater magnitude (Figure 1A, upper panels). Both the conventional CD4+ T cell and Treg response to HD infection displayed a biphasic pattern (Figure 1A, lower panels), with distinct peaks at days 1 and 7 noticeable for both subsets. Furthermore, the frequency of Treg and fold change in the FoxP3+:FoxP3− ratio within the total CD4+ T cell fraction was noticeably increased at day 1 after HD infection, whereas Treg were decreased by day 7 due to the large expansion of conventional CD4+ T cells at later time points (Figures 1B and 1C).
Figure 1.

Induction of T Cell Responses by LD and HD Listeria Infection

(A–D) Groups of C57BL/6 mice systemically infected with LD or HD Lm DactA-Ova.

(A) Kinetics of total CD8+ T cells, Ova257–264/H-2Kb-tetramer-binding (H-2Kb-Ova+) CD8+ T cells, total CD4+ T cells, and CD25+FoxP3+CD4+ T cells (Treg) in the spleens of infected mice (n = 4–8 per group).

(B) Frequency of CD25+FoxP3+CD4+ Treg within the total CD4+ T cell fraction (n = 7 per group).

(C) Change in FoxP3+:FoxP3− CD4+ T cell ratio after HD Lm ΔactA-Ova infection relative to the naive cohort (D FoxP3+:FoxP3−) (n = 4 per group).

(D) Absolute number of Ova-specific CD8+ T cells and Ova-specific IFN-γ+ effectors at day 7 post-infection ± CD4+ T cell depletion (n = 6 per group).

(E and F) C57BL/6 and Foxp3 mice infected with LD or HD Lm ΔactA-Ova with DT delivery to all animals before and throughout infection.

(E) Absolute number of Ova-specific CD8+ T cells and Ova-specific IFN-g+ effectors at day 7 ± CD4+ T cell depletion (n = 6 per group).

(F) H-2Kb-Ova relative affinity of splenic CD8+ T cells calculated as the geometric mean fluorescence intensity (geoMFI) of Ova257–264/H-2Kb-tetramer to anti- TCRβ FACS stain ratio compared between strain and Lm dosage (n = 10 per group).

(G) Survival of C57BL/6 versus Foxp3 mice infected with WT Lm Ova, with DT injections spanning the immune response (n = 10 per group).

We next determined the requirement of CD4+ T cells in CD8+ T cell generation as a function of initial pathogen dose. Depletion of CD4+ T cells prior to LD infection produced a characteristically smaller primary CD8+ T cell response consistent with a helper function for CD4+ T cells. Interestingly, CD4+ T cell depletion in the setting of HD infection led to a significantly greater primary CD8+ T cell response, as measured by both the number of Ova-specific cells and IFN-γ+ effectors (Figure 1D), and correlated with an increased Treg frequency observed with HD infection at day 1 (Figures 1B and 1C). CD4+ T cells therefore restricted the primary expansion of antigen-specific CD8+ T cells responding to a larger infectious dose of Lm.

Treg Restrict Primary CD8+ T Cell Responses to Higher Bacterial Burden and Impede Host Survival

Given that Treg can impact the development of a number of pathogen-driven responses (Belkaid and Tarbell, 2009; Mills, 2004) and the presence of elevated Treg numbers within 1 day of HD infection, we tested whether FoxP3-expressing Treg could limit the magnitude of the primary CD8+ T cell response. For this we used Foxp3 mice, which allow for the selective depletion of this subset by administration of diphtheria toxin (DT) (Figure S1A). This treatment did not affect the number of activated CD8+ T cells based on effector cytokine production as well as CD44, CD62L, and CD69 expression within 3 days after initial injection (the time at which animals in this study were infected) (Figures S1B–S1E) (Kim et al., 2007). Treg removal in the setting of HD infection mirrored the effect of acute CD4+ T cell depletion in C57BL/6 mice, in which the primary CD8+ T cell response was of significantly increased magnitude as measured by Ova257–264/H-2Kb-tetramer binding and IFN-g production. Superimposing CD4+ T cell depletion onto Treg depletion yielded no additional effects (Figure 1E). These findings suggest that the absence of Treg accounts for the effect of acute CD4+ T cell depletion and that Treg, but not helper, activity is dominant in the CD4+ T cell response observed during HD infection. In the setting of LD infection, removal of Treg also resulted in a significantly greater Ova-specific CD8+ T cell number, indicating that Treg restrain the generation of primary CD8+ T cell responses under these conditions (Figure 1E, left panel). As also reported in the Lm model (Pace et al., 2012), the population of Ova-specific CD8+ T cells primed in the absence of Treg after LD infection were of lower functional avidity, as evidenced by the unchanged absolute number of CD8+ T cells producing IFN-γ in response to the Ova257–264 peptide (Figure 1E, right panel) and reduced affinity to the Ova257–264/H-2Kb-tetramer (Figure 1F). Depletion of CD4+ T cells in DT-treated Foxp3 mice led to a significant reduction in both Ova-specific and IFN- γ+ CTLs, showing that conventional FoxP3−CD4+ T cells were still required to maximize the primary CD8+ T cell response after LD infection. These data indicate that although Treg restrict the primary expansion of CD8+ T cells and influence their functional avidity, the LD response is still substantively dependent on CD4+ T cells, presumably through their actions as TH. Various genetic deletions of pathways involved in innate and/or adaptive arms of the immune system have demonstrated equal significance for host survival against wild-type (WT) Lm strains (Ishii et al., 2005; Pamer, 2004). To determine whether the presence of Treg was indeed limiting for resistance against WT Lm, survival was assessed in C57BL/6 versus Foxp3 mice. Whereas many mice succumbed to infection after lethal challenge with WT Lm Ova when Treg were left intact, depletion of Treg resulted in 100% survival (Figure 1G). Therefore, Treg limit CD8+ T cell responses during exposure to elevated Lm infectious doses that is important for host resistance.

Treg Suppress Primary Responses to Listeria with a Distinct Kinetic Compared to TH

To further understand when Treg were important, delayed CD4+ T cell depletion following HD infection established that suppression of the antigen-specific CD8+ T cell response was extant within 3 to 4 days after initial infection (Figures 2A and 2B). Specific blockade of the CD40-CD40L pathway 1 day before but not 3 days after LD infection resulted in reduced Ova-specific CD8+ T cell responses, consistent with the key role of this pathway in early APC activation. In contrast, CD40-CD40L blockade in the setting of HD infection did not increase the CD8+ T cell response as observed when CD4+ T cells were depleted (Figure 2C). These results demonstrate a clear difference in the role of CD4+ T cells in the priming of CD8+ T cells that is only revealed by varying the initial inoculum dose: CD4+ T cells function as conventional TH to activate or license APCs within the initial 2 days of the LD response (Janssen et al., 2003; Schoenberger et al., 1998), but assume a persistent regulatory function to restrict expansion after HD infection with a different kinetic from that of TH.
Figure 2.

FoxP3+ Treg Suppress Primary CD8+ T Cell Responses with a Different Kinetic Compared to TH

(A–C) C57BL/6 mice infected with LD or HD Lm ΔactA-Ova.

(A and B) (A) Frequency with CD44hi inset (red box) and (B) absolute number of Ova-specific CD8+ T cells 7 days post-infection among total CD44lo-hiCD8+ T cells in the spleens of mice ± CD4+ T cell depletion either prior to infection or at 3, 4, or 5 days post-infection (n = 5–6 per group).

(C) The absolute number of splenic Ova-specific CD8+ T cells at day 7 in mice that had received CD40L-blocking antibody 1 day before or 3 days after infection (n = 6 per group).

(D) C57BL/6 and Foxp3 mice i.v. infected with LD or HD Lm ΔactA-Ova with DT delivery to all animals before and throughout infection. Absolute number of splenic Ova-specific CD8+ T cells at day 7 in animals that had received CD40L-blocking antibody 1 day before infection (n = 6 per group).

In contrast to the effect seen in the setting of LD infection, CD40-CD40L blockade did not significantly reduce the magnitude of the CD8+ T cell response in HD infected animals regardless of Treg depletion (Figure 2D). This further suggested that only HD infection induced a bona fide TH-independent response in the presence or absence of Treg. This appeared to depend on the greater inflammatory capacity of the quantitatively larger initial dose rather than the increased antigen it contains, as supplementing LD infection with additional cell-associated antigen in a non-inflammatory context (Act-mOva H-2kb−/− splenocyte immunization) did not overcome the requirement for TH (Figures S2A and S2B). Taken together, our findings demonstrate that the degree of inflammation associated with the initial infectious dose of Lm determines the requirement for CD4+ T cells in the priming of antigen-specific CD8+ T cells and can discriminate their roles as TH versus Treg.

Acute Infection Induces Rapid Polyclonal Conversion of Conventional CD4+ Cells to Treg

The demonstration that CD4+ Treg actively limit the response magnitude of primary Lm-specific CD8+ T cells (Figure 1E), together with the significant increase in the Treg numbers within 1 day of HD infection (Figure 1A), prompted us to investigate factors responsible for their generation at this early time point. We analyzed correlates of polyclonal T cell activation using the Nr4a1 (Nur77-GFP) mouse, which reports on T cell receptor (TCR)-mediated signaling but not inflammatory stimuli (Moran et al., 2011) in conjunction with induction of the acute activation marker CD69 in conventional CD4+ T cell and FoxP3+ Treg populations as well as in total CD8+ T cells (Figure 3A). Consistent with previous findings, Treg from naive animals displayed a 2-fold higher level of Nur77-GFP reporter expression compared to conventional CD4+ T cells, reflecting the fact that Treg receive stronger TCR signals due to constant engagement of self-antigens in the periphery (Moran et al., 2011). Although each T cell subset displayed a distinct background level of GFP expression, only HD infection resulted in a significantly increased GFP signal across each cell type. Similarly, HD infection resulted in strong polyclonal induction of CD69 expression in all T cell subsets.
Figure 3.

Inflammation-Driven Polyclonal Conversion of Conventional CD4+ T Cells to Treg

(A) TCR engagement and surface CD69 upregulation by conventional CD4+ T cells (FoxP3−), Treg (CD25+FoxP3+), and CD8+ T cell populations in naive (blue) and at 24 h following LD (red) and HD (green) Lm ΔactA-Ova infection of Nr4a1 mice (n = 4 per group).

(B and C) Conventional CD4+EGFP− T cells were isolated from CD45.1+ Foxp3 mice and transferred into C57BL/6 mice followed by a 24-h rest period. The percentage of splenic CD45.1+FoxP3-EGFP− T cells that expressed EGFP under control of the Foxp3 promoter (denoted as FoxP3-EGFP) after assessment of (B) LD and HD Lm ΔactA-Ova day 1 (n = 3–4 per group) and 7 (n = 3 per group), as well as (C) titrated WT Lm Ova day 1 (n = 3–4 per group) infections.

This raised the possibility that the rapid increase in FoxP3+ Treg observed 1 day after HD infection was the product of conversion from conventional CD4+ precursors. To address this, we per- formed adoptive transfer of polyclonal conventional (non-EGFP-expressing) CD4+ T cells from CD45.1+ Foxp3 mice to CD45.2+ mice, which were subsequently infected with LD or HD Lm ΔactA-Ova. This system allowed visualization of the conversion from conventional EGFP− CD4+ T cells to EGFP+ CD4+ Treg in vivo. When the recipients were analyzed 1 day after infection, a substantial fraction of the transferred conventional CD4+ T cells from mice given HD but not LD infection were found to have undergone conversion to phenotypic Treg (FoxP3+), as judged by expression of EGFP (Figure 3B) and FoxP3 (Figures S3A and S3B). The newly converted FoxP3+CD4+ T cells also showed enhanced proliferative potential, as indicated by increased Ki-67 expression (Figure S3C). In further support of these observations, we found that endogenous CD45.2+ conventional CD4+ T cells in recipient animals displayed increased FoxP3 and CD25 expression following HD infection (Figure S3D). Newly converted FoxP3+CD4+ T cells could no longer be detected in the spleens of infected animals by day 7, indicating that rapid conversion is either an unstable phenotype or unidirectional terminal differentiation event. Rapid conversion also occurred after dose titration of non-attenuated WT Lm Ova using the adoptive transfer system described above (Figures 3C and S3E). These data collectively demonstrate that rapid polyclonal conversion of conventional CD4+ T cells to FoxP3+ Treg occurs in a dose-dependent manner following infection with both attenuated and WT Lm strains. We next determined whether the newly converted CD25+ FoxP3+ cells were capable of functionally suppressing CD8+ T cell responses in vitro and in vivo. To test for in vitro suppression, CD45.1+CD4+FoxP3+ (EGFP+) T cells were re-isolated following in vivo conversion and used in a suppression assay for the inhibition of CD3/CD28-driven proliferation of polyclonal CD8+ responder T cells (Tresp). Converted CD45.1+CD4+FoxP3+ T cells significantly suppressed CD8+ Tresp proliferation, while CD45.1+FoxP3− (EGFP−) conventional CD4+ T cells that originated from the same transferred population but that had not undergone conversion were not suppressive (Figure 4A). Two distinct approaches were next taken for assessing the in vivo suppressive capacity of Treg that arise through conversion. The first involved selective removal of stable Treg but not those induced through conversion. To achieve this, we modified the DT-mediated depletion of stable Treg in Foxp3 mice by terminating DT treatment 1 day prior to HD infection in an effort to leave the converted CD4+ T cells intact as the sole source of Treg. When the peak magnitude of antigen-specific CD8+ T cell responses measured in Foxp3 mice treated with DT throughout the experiment (days −3 to 5), affecting both pre-existing and converted Treg, was compared to that observed in mice treated only prior to infection (days −3, −1), approximately half of the total Treg-mediated suppression could be ascribed to the Treg that arose through conversion, which are retained in this latter group (Figure 4B). We then performed a second set of experiments in which only converted Treg would be available for suppressive function in vivo. This involved the transfer of non-DTR/EGFP-expressing conventional CD4+ T cells from CD45.1+ Foxp3 mice (Figure S3F) to Foxp3 mice treated throughout infection with DT. Under these circumstances, Treg arising only through conversion (Figure S3G) displayed approximately half the total suppressive activity of the stable Treg that were depleted by DT (Figure 4C). The inhibitory function of the converted Treg was not only manifest on the reduced proliferative capacity of the antigen-specific CD8+ T cells but also on their capability to produce effector cytokines (Figure 4D). Taken together, these data demonstrate that the Treg arising through conversion of polyclonal conventional CD4+ T cells possess potent suppressive activity in vitro and in vivo.
Figure 4.

Converted Treg Mediate Suppression of CD8+ T Cell Responses to Listeria In Vitro and In Vivo

(A) In vitro CD3/CD28-driven CD45.2+CD8+ Tresp proliferation represented as percent suppression and replication index at day 3 after co-culture of naive CellTrace Violet (CTV)-labeled CD45.2+CD8+ Tresp with graded populations of converted CD45.1+CD4+FoxP3-EGFP+ and non-converted CD45.1+CD4+FoxP3- EGFP− T cells re-isolated from C57BL/6 recipient mice that underwent 24 h HD Lm ΔactA-Ova infection (n = 4 per group).

(B) Absolute number of splenic Ova-specific CD8+ T cells at day 7 post-infection of C57BL/6 and Foxp3 mice infected with HD Lm ΔactA-Ova. FoxP3+ Treg depletion was achieved via limiting DT injection to a pre-infection phase (days −3 to −1) or continuing DT administration during the immune response (days −3 to 5) (n = 4 per group).

(C and D) Naive CD4+EGFP− T cells were isolated from CD45.1+ Foxp3 mice and transferred into C57BL/6 and Foxp3 mice at day −1 that received a full DT regimen relative to a day 0 HD Lm ΔactA-Ova infection. The frequency and absolute number of splenic (C) Ova-specific CD8+ T cells and (D) Ova-specific IFN-g+ effectors together with change in IFN-γ production per cell (Δ 3 103 IFN-γ geoMFI) at day 7 post-infection (n = 4 per group).

TLR9 Expression by CD8α+ DCs Sustains Production of IL-12 and Treg Responses

We then sought to understand the mechanism by which HD infection limited the CD8+ T cell response and drove conventional CD4+ T cell conversion to Treg. No perturbation in the primary CD8+ T cell response magnitude was seen after HD infection of Tlr2−/− and Tlr7−/− mice, two TLRs linked to Lm, as well as of Tlr4−/− mice (irrelevant for Gram-positive bacteria). In contrast, Tlr9 mice (expressing a dysfunctional variant of TLR9 harboring an S359P amino acid substitution) displayed a marked increase in the absolute number of Ova-specific CD8+ T cells generated in the presence of CD4+ T cells (Figure 5A). CD4+ T cell depletion in Tlr9 animals revealed that TLR9 deficiency completely accounted for immunoregulation exerted by CD4+ T cells during HD infection (Figure 5B). In concordance, Tlr9 animals displayed increased numbers of CD4+ and CD8+ effectors but fewer Treg compared to C57BL/6 mice (Figure S4A). These data show that TLR9 is a critical PRR that limits acute activation of CD8+ T cells during HD infection.
Figure 5.

Role of TLR9 and IL-12 (p70) in Treg Conversion

(A and B) Groups of C57BL/6 and TLR-deficient mice infected with LD or HD Lm ΔactA-Ova.

(A) Absolute number of Ova-specific CD8+ T cells at day 7 post-infection with HD Lm ΔactA-Ova compared among splenic isolates of Tlr2−/−, Tlr4−/−, Tlr7−/−, and Tlr9 mice (n = 6–10 per group).

(B) Absolute number of Ova-specific CD8+ T cells at day 7 in the spleens of Tlr9 mice ± CD4+ T cell depletion (n = 6–8 per group).

(C and D) Groups of C57BL/6 and Tlr9 mice systemically infected with HD Lm ΔactA-Ova.

(C) Fold change in serum cytokines and chemokines from 0–6 h post-infection.

(D) Selected serum cytokine/chemokine concentration at 6 h post-infection displaying significance in (C) (n = 6 per group).

(E) Foxp3 mice infected with HD Lm ΔactA-Ova for 24 h. Ingenuity Pathway Analysis (IPA) upstream regulator prediction of differential gene expression profiles comparing total FoxP3-EGFP+ Treg sorted from naive versus infected mice (top 50 significant hits; p = gene network overlap) (n = 4 per group).

(F) Kinetic display of IFN-a2/4, IFN-b, IFN-g, and IL-12 (p70) serum concentration in C57BL/6 and Tlr9 mice after exposure to HD Lm DactA-Ova (n = 6 per group).

To explore the mechanistic link between TLR9 signaling and inflammation-associated suppression of CD8+ T cells, we examined an array of cytokines and chemokines produced within 6 h of HD infection in C57BL/6 and Tlr9 mice. Tlr9 mice did not display any apparent defect in serum CXCL1 (KC) or CXCL2 (MIP-2), suggesting that neutrophil egress from bone marrow was upstream of and not related to TLR9. We also noted a subtle spike in serum IFN-g but consistently decreased CCL2 (MCP-1), CXCL9 (MIG), CXCL10 (IP-10), and IL-12 (p70) in Tlr9 mice, suggesting a mixed phenotype, including an increased type II IFN response in the midst of defective leukocyte recruitment and polarization of TH1 cells (Figures 5C and 5D). The serum proteome readout was then compared with upstream regulators (functional predictions) that actuate differential gene expression profiles of total splenic Treg sorted as EGFP+ from Foxp3 mice after 24 h of exposure to HD Lm ΔactA-Ova. Of the top 50 significant upstream regulators predicted to give rise to the Lm-generated Treg signature, commonalities were found to exist between the causal IFN-α, IFN-β, IFN-γ, and IL-12 (p70) gene network and serum data (Figures 5E and S4B). Kinetic analysis of these cytokines over 24 h revealed a severe defect in the ability of Tlr9 mice to produce IL-12 (p70). The small difference in IFN-γ observed previously at 6 h appeared trivial as inflammation increased from 12 to 24 h, and no strain-specific differences were observed in type I IFN production (Figure 5F). These data suggested that a link existed between IL-12 (p70) production and the conversion of conventional CD4+ cells to Treg. To further elucidate this, transcriptional analysis was performed among sorted FoxP3-EGFP− conventional CD4+ T cells and FoxP3-EGFP+ Treg 24 h after LD or HD infection. Genes differentially expressed relative to the naive state were subjected to Gene Ontology (GO) pathway analysis (Figure S5A). Gene sets from GO pathways having Z scores >Δ1.5 were further characterized by differential expression analysis (Figure S5B). Although LD infection did not reveal global changes in cell function, HD infection showed enrichment for pathways related to activation, proliferation, and survival in both conventional and Treg CD4+ subsets. Conventional CD4+ T cells sorted as EGFP− exhibited a transcriptional profile favoring the development of Treg (Ifng, Stat1, Tnfrsf9, Stat3, Bcl6, Icos, and Card11), suggesting that some of these cells were activated and capable of transitioning to a state supportive of FoxP3 upregulation. Moreover, the FoxP3-EGFP+ Treg clearly initiated a TH1 differentiation program (Tbx21, Il12rb1, Il12rb2, Irf1, Irf8, Stat1, Socs3, and Relb), despite expressing FoxP3. Together, these in silico findings support the conversion of conventional CD4+ T cells to a Treg differentiation program and indicate that a cell type similar to TH1-like Treg expressing Tbx21 (T-bet) contributes to the early accumulation of CD25+FoxP3+ Treg during HD Lm infection. T-bet expression within FoxP3+ Treg is thought to enable focused counter-regulation within a heterogeneous Treg cell population during infection (Levine et al., 2017), but these TH1-like Treg are inherently limited to an incomplete TH1 differentiation due to lack of Il12rb2 expression (Koch et al., 2012). Our data support instead a scenario in which excess IL-12 (p70) exposure driven by TLR9 signaling contributes to transient FoxP3 upregulation in a fully differentiated TH1 cell expressing Tbx21 and Il12rb2 at day 1 following HD Lm infection, leading to acquisition of suppressor function. The cellular source of TLR9 and IL-12 (p70) was next investigated. A significant transient increase in Tlr9 mRNA was seen at day 1 in whole spleens isolated from HD-infected C57BL/6 mice (Figure 6A) and was largely limited to CD11c+ cells (Figure 6B). TLR9 is known to signal through IFN regulatory factor 7 (IRF7) for type I IFN induction and a separate nuclear factor kB (NF-kB) axis relevant for pro-inflammatory cytokine production (O’Neill et al., 2013). Given that multiple NF-kB DNA-binding sites exist within the Il12a and Il12b gene loci (Figures S6A–S6C), we assessed which cells were actively translocating cytoplasmic NF-kB to the nucleus using p65-GFP knockin mice in which GFP is fused to the N terminus of the p65 subunit of canonical NF-kB. We noted that universal transcription of p65-GFP increased in multiple splenic DC and macrophage (Mac) subtypes in these animals after 24 h of HD infection but not in B cells (Figure 6C). Visualization of the subcellular localization of p65-GFP showed that CD8a+ DCs exclusively translocated p65-GFP inside nuclei relative to TLR9lo-hi expression and infection. Plasmacytoid DCs (pDCs) also mobilized p65-GFP to the nucleus, but this did not correlate with intracellular TLR9 expression (Figure 6D). In addition, CD8α+ DC populations isolated from HD-infected C57BL/6 mice primarily produced IL-12 (p40) by flow cytometric analysis, and this was decreased in Tlr9 mice (Figure 6E).
Figure 6.

TLR9/NF-κB-Mediated Induction of IL-12 in CD8α+ DCs

(A and B) Tlr2, Tlr4, Tlr7, and Tlr9 mRNA normalized to Hprt1 mRNA in (A) whole spleen and (B) sorted DC and T cell populations in C57BL/6 mice infected with LD or HD Lm ΔactA-Ova (n = 3 per group).

(C and D) p65-GFP knockin mice challenged for 24 h with HD Lm ΔactA-Ova.

(C) Frequency of p65-GFP and TLR9 expression in B cells, CD8a− DC/Mac, CD8a+ DCs, plasmacytoid DCs (pDCs), CD103+ DCs, red pulp macrophages (RP Macs), and marginal zone Macs (MZ Macs) (n = 3 per group).

(D) Representative ImageStream images displaying TLR9hi APC subcellular localization of p65-GFP (green) and DAPI (red) and quantitative p65-GFP nuclear translocation (n = 3 per group).

(E) C57BL/6 and Tlr9 mice exposed to HD Lm ΔactA-Ova for 24 h. Frequency and absolute number of IL-12 (p40)+ and IFN-β+ APC subsets after PMA/ionomycin stimulation (n = 4 per group).

(F) C57BL/6 and Batf3−/− mice infected with HD Lm ΔactA-Ova for 24 h. Change in FoxP3+:FoxP3− CD4+ T cell ratio at day 1 post-infection relative to the naive state (D FoxP3+:FoxP3−) (n = 7 per group).

To further study the role of the CD8α+ DC subset in Treg conversion, we used BATF3 (basic leucine zipper TF, activating transcription factor [ATF]-like 3)-deficient mice, which have restricted the development of CD103+ and CD8α+ DC populations (Belz and Nutt, 2012). Naive and HD-infected Batf3−/− mice were comparable in having reduced absolute numbers and frequencies of TLR9+CD8α+ DCs (Figures S7A–S7C), and importantly, Batf3−/− mice did not display an increased FoxP3+:FoxP3− ratio compared to the rapid enrichment of Treg consistently observed in C57BL/6 mice after 24 h of HD infection (Figure 6F). In summary, these data collectively support that TLR9 expression by CD8α+ DC controls IL-12 (p70) production proportional to the initial Lm infectious dose, and this is directly or indirectly linked to the conversion of conventional CD4+ T cells into FoxP3-expressing Treg.

IL-12 Triggering by Sequence-Specific CpG Oligodeoxynucleotides Drives Suppression and Enhances FoxP3 Expression

TLR9 is an endosomal PRR capable of recognizing naturally derived cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) in a 2:2 stoichiometry (Ohto et al., 2015). CpG ODNs contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs) present at a 20-fold excess in bacterial genomes and in the 16.6-kb mitochondrial genome, which is essentially of prokaryotic origin (Ries et al., 2013). Eukaryote genomes have otherwise co-evolved to hypermethylate and decrease CpG motif frequency (Krieg et al., 1995) to potentially endow TLR9 with the ability to recognize these motifs as both pathogen- and danger-associated molecular patterns (PAMP and DAMP, respectively). As synthetic CpG ODN type A (CpG-A) is known to stimulate IFN-a release, whereas type B (CpG-B) leads to the production of IL-12 (Heit et al., 2004; Krug et al., 2001), we performed a functional comparison of these ODNs to further our conclusions. We confirmed the latter differential effect on IL-12 (p70) in the absence of infection compared to CpG controls (containing swapped GpC motifs) (Figure S8A). Most important, we found that CpG-B but not CpG-A rapidly increased the frequency of Treg in vivo (Figure 7A). To extend this, CpG-A and CpG-B injections were superim- posed on LD infection to determine the effect on the antigen- specific CD8+ T cell response. CpG-B alone suppressed the pri- mary response of splenic Ova-specific CD8+ T cells in C57BL/6 mice. Moreover, this suppression by CpG-B was mediated by Treg, as the absence of these cells in DT-treated Foxp3 mice negated this effect (Figure 7B). Furthermore, CpG-B was no longer immunosuppressive when IL-12 (p70) was blocked during LD Lm infection (Figure 7C). These data show that direct TLR9 recognition of CpG ODN is linked to rapid IL-12 (p70)-driven Treg expansion and immunosuppression.
Figure 7.

Release of Self-DNA Drives IL-12 (p70) Production, FoxP3 Induction, and Treg Conversion from Conventional CD4+ T Cells

(A) C57BL/6 mice administered 50 μg CpG-A, CpG-B, and CpG control ODNs at days −1 and 0. Frequency of splenic CD25+FoxP3+CD4+ Treg and change in FoxP3+:FoxP3− CD4+ T cell ratio relative to CpG controls (D FoxP3+:FoxP3−) at day 1 (n = 4 per group).

(B) C57BL/6 and Foxp3 mice administered CpG ODNs as in (A) and infected with LD Lm ΔactA-Ova at day 0 and co-delivered a complete DT regimen. Absolute number of splenic Ova-specific CD8+ T cells at day 7 post-infection (n = 6 per group).

(C) Splenic Ova-specific CD8+ T cell response observed in CpG-treated or -infected C57BL/6 as in (B), with blockade of IL-12 (p70) (n = 4 per group).

(D) Quantification of mtDNA (12 s and Trlev), nDNA (Neb and Becn1), and Lm DNA (Ova, mpl, and plcB) in cell- and RNA-free serum samples after HD Lm ΔactA- Ova infection of C57BL/6 mice (n = 6 per group).

(E) Serum ALT concentration within LD versus HD Lm ΔactA-Ova-infected C57BL/6 mice (n = 6 per group).

(F) Effect of neutrophil depletion before HD Lm ΔactA-Ova infection of C57BL/6 mice on mtDNA (12 s and Trlev) in cell- and RNA-free serum samples isolated at 4 h post-infection (n = 6 per group).

(G) Absolute number of splenic Ova-specific CD8+ T cells at day 7 post-infection in C57BL/6 and Foxp3 mice administered a complete DT regimen, systemic HD Lm ΔactA-Ova, and selective DNase I delivery (n = 4 per group).

(H) Survival of untreated versus DNase I-treated C57BL/6 mice infected with WT Lm Ova (n = 10–16 per group).

(I and J) In vitro co-expression of FoxP3 and T-bet in conventional CD4+EGFP− T cells isolated from Foxp3 or Il12rb2−/−Foxp3 mice cultured in the presence or absence of CD3/CD28-mediated activation, rmTGF-b1, and rmIL-12 (p70) (n = 4 per group).

Lastly, we sought the source of DNA to trigger this TLR9-driven pathway. We hypothesized that Lm-derived DNA was irrelevant because direct engulfment of phagosome-restricted listeriolysin O-deficient Lm (Lm DLLO) by activated WT and TLR9-deficient Macs has been shown to lead to robust type I IFN production in vitro (Herskovits et al., 2007). In search of a naturally produced TLR9 ligand, host mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) in addition to Lm DNA itself were measured in cell-free/RNA-free serum samples of mice 0–48 h after HD infection. Circulating mtDNA (12s and Trlev) was detected at a log higher concentration compared to nDNA (Neb and Becn1) and at 2 logs greater than Lm DNA (Ova, mpl, and plcB), with a notable spike occurring at 4 h post-infection (Figure 7D). Release of mtDNA at 4 h into the sera of infected animals did not appear to be related to hepatocyte damage beginning at 6 h post-infection (Figure 7E). Serum mtDNA rather appeared to have arisen from an early 2–4 h neutrophil response shown by depletion of these cells with an anti-Ly6G monoclonal antibody (Figure 7F). The relevance of extracellular self-DNA to the observed inhibition of the CD8+ T cell response was next examined by several strategies. First, we found that the immunosuppression of CD8+ T cell responses to HD infection of C57BL/6 hosts was alleviated by DNase I treatment, but this treatment did not increase the magnitude of the CD8+ T cell response beyond that produced by Treg deletion in DT-treated Foxp3 mice (Figure 7G). Prior work has shown that self-DNA expelled by neutrophils in the form of neutrophil extracellular traps (NETs) is a critical defense mechanism for the rapid clearance of Lm. Disruption of NET integrity via DNase I treatment before and continuously throughout infection was similarly demonstrated to negatively affect the survival of lethally challenged hosts (Chen et al., 2017; Witter et al., 2016). By delaying initiation of DNase I treatment until 1.5 h post-infection to leave the early neutrophil NET response intact, we found that DNase I-treated mice displayed a distinct survival advantage against primary WT Lm Ova infection (Figure 7H). Extracellular self-DNA thus likely acts as a double-edged sword that is critical for defense against Lm, as it is essential for NET integrity, but whose presence leads to TLR9 activation and the subsequent rapid generation of Treg through conversion. Taken together, these results support the notion that self-DNA endogenously released following HD infection mirrors the effects of synthetic CpG-B, in which heightened IL-12 (p70) endows Treg conversion and immunosuppression. The upregulation of FoxP3 in conventional CD4+ T cells has been reported to occur as early as 2–3 days after a combination of TCR, IL-2, and TGF-β1 stimulation in vitro (Pillai et al., 2007; Walker et al., 2003). We questioned whether IL-12 (p70) could enhance FoxP3 expression in this context within 1 day. To address this, conventional CD4+ T cells were sorted as EGFP− from Foxp3 mice and subjected to CD3/CD28 cross-linking in vitro. We found that a 24-h TGF-b1 treatment induced ~20%–40% FoxP3 expression in FoxP3-EGFP− conventional CD4+ T cells. The addition of IL- 12 (p70) to TGF-b1-containing cultures pushed FoxP3 expression to ~50%–60% positivity, whereas IL-12 (p70) addition alone did not support a Treg program. FoxP3 expression seemed to divert into FoxP3lo and FoxP3hi patterns, with IL-12 (p70) primarily enhancing FoxP3lo frequency. Importantly, IL-12 (p70) did not augment FoxP3 expression if cells lacked IL-12Rb2 (Figures 7I and 7J). Exogenous IL-2 addition to the cultures was not necessary, but rather was provided by the conventional CD4+ T cells in autocrine (data not shown). FoxP3-EGFP− conventional CD4+ T cells sorted from CD45.1+ Il12rb2−/−Foxp3 mice similarly displayed reduced expression of FoxP3 compared to WT cells in vivo after transfer to and HD infection of C57BL/6 hosts (Figure S8B). In summation, this report shows that the innate immune system translates perceived danger in the form of self-DNA into IL-12 (p70)-based inflammation, directly contributing to conventional CD4+ T cell conversion to Treg in reshaping cell-mediated adaptive immunity.

DISCUSSION

This study initially sought to resolve the confusing and often- contradictory literature surrounding the role of CD4+ T cells in the generation of CD8+ T cell responses through analysis of an immunogen for which the T cell help requirement has been reported to vary. Our results provide substantial insights in this regard by showing that, depending on the initial infectious dose of a pathogen, CD4+ T cells assume distinct roles as either TH or Treg. At low infectious dose, CD4+ T cells function as classical helpers for the CD8+ T cell response through CD40L-dependent APC activation, whereas infection with higher doses of the same pathogen causes rapid conversion of polyclonal conventional CD4+ T cells to a functional regulatory state in which both pathogen-specific and total CD8+ T cell responses are suppressed. These rapidly converted Treg are distinct from both pTreg and stable nTreg in many key features, including in vitro suppressive potential on a per-cell basis, which appears to be lower than both of the other Treg subsets (Fantini et al., 2007; Fu et al., 2004; Wang et al., 2007), and in their functional persistence, which appears to be limited to 3 or 4 days following generation of these cells. Our findings reveal a hitherto unappreciated rapid sensory plasticity in the immune response that can both quantify a given pathogenic threat and, depending on its magnitude, either direct CD4+ T cells to enhance the generation of CD8+ effectors to control the infection or quickly mount a significant regulatory response through rapid conversion to protect the host from the pathologic effects of systemic inflammation. It is notable that in the latter case, the duration of the regulatory event is nonetheless sufficiently brief to enable the former to occur. These findings shed light on the position occupied by CD4+ T cells in the regulation and functional specialization of adaptive immune responses and on their capacity to integrate the activities of the innate and adaptive arms of the immune response. The generation of Treg via conversion of conventional naive CD4+ T cells has been suggested by a variety of mechanisms, including a study showing that bystander systemic inflammation induced by polyI:C could generate pTreg capable of suppressing CD4+ T cell responses within 7 days in vivo or 5 days in vitro if TGF-b1 was also provided exogenously (Thompson et al., 2016). The present study demonstrates that conversion of conventional CD4+ T cells can occur within 24 h of exposure to an infectious pathogen in vivo in a dose-dependent manner or in vitro via a combination of IL-12 (p70) and TGF-b1 exposure. The difference in conversion time may involve TGF-b1 availability and relative potency of stimulating a single TLR pathway by polyI:C (TLR3) causing a gradual rise in type I IFN, versus CpG motif-specific (TLR9) stimulation of IL-12 (p70) production shown herein to rapidly fluctuate. The common mechanistic link between type I IFN and IL-12 (p70) signaling within a T cell is that both cytokines induce phosphorylation of signal transducer and activator of transcription 1 (pSTAT1) heterodimerization (Gollob et al., 1998; Jacobson et al., 1995; Szabo et al., 1995). Similarly, induction of pSTAT1 homodimerization after conventional T cell exposure to IFN-γ caused a rapid 24-h increase in FoxP3 expression with accompanied in vitro and in vivo suppressive capacity (Wang et al., 2006). It is notable that STAT1-deficient mice develop more severe experimental autoimmune encephalomyelitis due to lack of a suppressor population (presumably nTreg) in the CD25+CD4+ compartment (Nishibori et al., 2004). Although eventual induction of pSTAT1 leads to the upregulation of SMAD7 (refers to homologies to Caenorhabditis elegans Sma and Drosophila Mad gene families) in feedforward inhibition of TGF-β1-induced pSMAD3 binding to conserved non-coding DNA sequence 1 (CNS1) in the Foxp3 promoter, pSTAT1 DNA-binding sites have been found in the proximal Foxp3 promoter supportive of transcription (Kleiter et al., 2010; Ouaked et al., 2009; Zheng et al., 2010). Transdifferentiation of Treg to other functional states has also been demonstrated, with lineage-marked exTreg capable of assuming TH1 or TH17 functional phenotypes, for example (Bailey-Bucktrout et al., 2013; Miyao et al., 2012). Our study is distinct, however, in reporting such a sizeable polyclonal population of CD4+ T cells differentiating from naive CD4+ T cells to FoxP3-expressing Treg with in vivo suppressor function as an immediate consequence of systemically produced IL-12 (p70). The dynamics of this process in terms of both the generation and persistence of these cells as mentioned above is notable, with our phenotypic analysis, adoptive transfer, and depletion studies demonstrating that although the converted Treg and their suppressive effects arise quickly following HD infection, both disappear within 3–4 days, essentially coincident with the full primary expansion of the effector CD8+ T cells needed to contain the progressive infection (Mielke et al., 1988). Perhaps differences in this regard exist in the kinetics in which opposing SMAD7 and pSTAT1 influence Foxp3 transcription and acquisition of suppressor function. Our results clearly demonstrate that converted Treg are not only numerically significant but also, as a population, are endowed with considerable in vivo suppressor capacity, with two distinct assays showing these cells to be roughly equipotent to the stable Treg that exist in the host prior to infection. We also found that the Treg arising through rapid conversion are able to restrict both pathogen-specific CD8+ T cell responses and the cytokine-mediated expansion of polyclonal memory phenotype CD4+ and CD8+ T cells (data not shown) that have long been observed to follow infection or exposure to bacterial components (Tough et al., 2000). As such bystander activation of memory T cells has been implicated in autoimmune conditions such as diabetes and multiple sclerosis, the regulation in the context of infection is crucial (Pane and Coulson, 2015; Pender and Burrows, 2014). The risk posed by unrestrained self-reactive memory T cells would seem to represent a suitable rationale for the response to acute inflammation revealed by our study in which a substantial population of polyclonal naive CD4+ T cells are rapidly pressed into service as regulators. As mentioned above, however, these suppressor cells have a brief lifespan and disappear just as primed pathogen-specific CD8+ T cells needed to control infection expand. FoxP3 is a lineage-defining marker for Treg whose expression is dictated by complex upstream gene expression events shaped by TCR, IL-2, and TGF-β signaling (Gavin et al., 2007; Hill et al., 2007). Although Nur77 induction data suggest that both conventional CD4+ T cells and Treg receive early TCR stimulation, it is difficult to envision from both a numerical and kinetic basis that the large population of FoxP3-expressing Treg derived through conversion is Lm specific, and it is furthermore unlikely that these converted cells are the previously described TH1-like nTreg (Koch et al., 2012) due to presence of both Tbx21 and Il12rb2 transcripts in sorted FoxP3+ cells and responsiveness to IL-12 (p70). More recent studies suggest that self-reactive conventional FoxP3−CD4+ T cells escape thymic deletion and exist in steady-state tolerance in tissue niches alongside antigen-specific FoxP3+ nTreg (Hogquist and Jameson, 2014). Non-deletional tolerance can be lost in the periphery upon exposure to self-antigens experimentally contained within Lm (Legoux et al., 2015). Thus, given that self-reactive conventional CD4+ T cells exist at low numbers during homeostasis and expand upon infection with Lm, we speculate that the excessive inflammation associated with HD infection generates a cytokine network including but not limited to IL-2, IL-12, and TGF-β1, thereby supporting rapid differentiation to FoxP3+ Treg. The splenic CD8α+DEC-205+ DC subset identified as a key APC for conversion in our study is capable of profound intrinsic TGF-β1 production and uniquely specialized to gradually convert conventional CD4+ T cells to pTreg in vivo in the absence of inflammation. Additionally, TLR3 ligation inhibits TGF-β1 secretion and subsequent Treg induction by this DC subtype, possibly linked to the slower kinetic of polyI:C-induced conversion (Yamazaki et al., 2008). In this work, we revealed that CD8α+ DCs are the relevant source of an IL-12 (p70)-driven Treg response via DC TLR9 sensing of extracellular host mtDNA released by the neutrophil response to HD infection. The innate immune system has therefore likely evolved to interpret mtDNA-contained CpG ODNs as a DAMP to appropriately fine-tune downstream adaptive responses via Treg to balance autoimmune reactions to self versus effective pathogen clearance. Complex sepsis syndrome in humans is characterized by a two-phase immune response, where initial hyperinflammation and septic shock are followed by a phase of immune paralysis associated with the incapacity to develop adaptive immunity against secondary infection or latent viral reactivation. Septic patients consistently display elevated serum mtDNA, which can be engulfed by CD11c+ APC and ligate TLR9 to suppress subsequent antigen-specific CD8+ T cell responses in vivo (Schäfer et al., 2016). The dosage of CpG ODNs is indeed critical in shaping CD4+ and CD8+ T cell proliferation, in which high doses constrain expansion and low doses promote or have no effect on T cell responses (Wingender et al., 2006). The majority of circulating DNA found shortly after acute Lm infection is of mitochondrial and neutrophil origin. Neutrophils were first identified to release NETs comprised of nDNA, histones, and granules in a process associated with cell death (Brinkmann et al., 2004). Under certain conditions, neutrophils release NETs comprised of mtDNA within 15 min via hypopolarized mitochondrial movement to the plasma membrane followed by a later 36-h phase in which cells die with NET content becoming enriched in nDNA (Lood et al., 2016; Yousefi et al., 2009). Regardless of the source, whether mtDNA is actively incorporated in NETs or passively released by dying neutrophils, we present evidence that CpG ODNs contained therein are immunomodulatory. With respect to our original question regarding the conditional requirement of CD4+ T cell help for CD8+ T cells, it is worth noting that the antigen-specific CD8+ T cell response induced under conditions of acute inflammation (HD infection) is of a larger comparative magnitude in the absence of CD4+ T cells than that induced by LD infection and yet is still somewhat dependent on T cell help to achieve an optimal response magnitude. This is in contrast to the situation of CD8+ T cell responses in LD infection, which we show to be paradoxically constrained by stable Treg yet nonetheless strongly dependent on TH. Whether these differences are due to cytokine-mediated effects on proliferation or direct activation of APCs remains to be elucidated, but our findings highlight the intrinsic limitations in describing a given CD8+ T cell response as help dependent or independent based solely on response magnitude (Castellino and Germain, 2006; Haring et al., 2006; Khanolkar et al., 2007; Wiesel and Oxenius, 2012). Our findings reveal that TH-independent CD8+ T cell responses are observed when immunogens induce excessive inflammation associated with the infectious dose amidst primary activation (Figures 1D, S2A, and S2B) or secondary challenge, although responses of optimal magnitude and memory functionality are induced when CD4+ T cells are present (data not shown). These observations help to resolve the often-contradictory literature with respect to the TH dependence of CD8+ T cells by revealing that initial pathogen dose plays a large and durable role in the fate and function of the ensuing response. Finally, our findings are of particular relevance for understanding the immunobiology of infection, as well as for the efficacy of vaccine strategies that induce a strong inflammatory response. Elucidation of the cells and signaling pathways that guide rapid conversion of conventional CD4+ T cells to Treg should allow the development of more effective approaches to immune regulation.

STAR★METHODS

Detailed methods are provided in the online version of this paper and include the following:

LEAD CONTACT AND MATERIALS AVAILABILITY

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Dr. Joseph S. Dolina (jdolina@lji.org). This study did not generate new unique reagents.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Animals

Male and female C57BL/6, Batf3−/−, Foxp3 (FoxP3-EGFP), Foxp3, H-2kb−/−, Il12rb2−/−, Tlr2−/−, Tlr4−/−, Tlr7−/−, and Tlr9 mice (The Jackson Laboratory, Bar Harbor, ME) were used in these experiments. Foxp3 mice contain an internal ribosome entry site (IRES), human diphtheria toxin receptor (DTR), and an enhanced green fluorescent protein (EGFP) downstream of the internal stop codon of the Foxp3 locus (Kim et al., 2007). Mice expressing Gallus gallus ovalbumin under the Actb (b-actin) promoter (Act-mOva) were originally obtained from Marc K. Jenkins (University of Minnesota, Minneapolis, MN) and crossed to H-2kb−/− mice on the C57BL/6 background generating Act-mOva H-2kb−/− mice as described previously (Feau et al., 2011; Janssen et al., 2005). Nr4a1 (Nur77-GFP) reporter mice were generated as described (Moran et al., 2011) from the laboratory of Kristin A. Hogquist (University of Minnesota). Homozygous p65-GFP knockin mice acquired from Manolis Pasparakis (University of Cologne, Cologne, Germany) were engineered with GFP fused to the N terminus of the first exon of p65 to avoid interference with C-terminal DNA-binding and transactivating domains thereby preserving NF-kB function (De Lorenzi et al., 2009). Animals used in experiments were 8–12 weeks of age and maintained/bred in the La Jolla Institute for Immunology vivarium under specific pathogen-free conditions in accordance with guidelines of the Association for Assessment and Accreditation of Laboratory Animal Care International.

Infections and immunizations

Listeria monocytogenes (Lm) derived from the wild-type (WT) 10403S background either deficient in the actin assembly-inducing protein alone (Lm ΔactA) or expressing amino acids spanning 138–338 of full-length ovalbumin (WT Lm Ova and Lm ΔactA-Ova) were obtained from the laboratory of Daniel A. Portnoy (University of California, Berkeley, CA). Bacteria were cultured in BBL brain heart infusion medium (Becton, Dickinson and Company, Sparks, MD) at 37°C, back-diluted to log-phase (OD600 = 0.075–0.100), washed, and re-suspended in 1 3 PBS. Primary in vivo infections were conducted via intravenous (i.v.) injection of low dose (LD; 1 × 103 CFU) or high dose (HD; 1 × 106 CFU) Lm DactA or Lm ΔactA-Ova in the caudal vein. For dual immunizations to Lm,5 × 106 Act-mOva H-2kb−/− splenocytes were delivered i.v. concurrent with primary infection as noted. WT Lm Ova infections were delivered i.v. over a 1 × 103-1 × 105 CFU range for short-term in vivo visualization of conventional CD4+ T cell conversion to Treg and a 1 × 104-2.5 × 104 CFU range for extended survival experiments.

METHOD DETAILS

In vivo antibody and small molecule treatments

The GK1.5 hybridoma (ATCC, Manassas, VA) and MR1 hybridoma originally produced by Alejandro Aruffo (Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA) (Noelle et al., 1992) were cultured in CELLine 1000 bioreactors (Wheaton, Millville, NJ) to obtain large quantities of anti-CD4 and anti-CD40L antibodies, respectively. Anti-Ly6G (1A8) and anti-IL-12 (p70) (R2–9A5) were otherwise externally purchased for experiments (BioXCell, West Lebanon, NH). For early CD4+ T cell depletion, anti-CD4 was delivered intraperitoneally (i.p.) in the following regimen: 200 μg at day −5, 100 mg at day −2, and 100 μg at day 5 relative to a day 0 infection. Animals that had CD4 T cells intact during initial infection still received 200 mg anti-CD4 at day 5. For delayed CD4+ T cell depletion, a single bolus of 400 μg anti-CD4 was delivered at days 3, 4, or 5 i.p.. For early CD40L blockade, 150 μg i.p. injections of anti-CD40L were given to animals at days −1 and 2. For delayed CD40L blockade, mice received a single 250 μg i.p. injection of anti-CD40L at day 3 post-infection. Specific depletion of neutrophils was achieved via delivery of 500 μg anti-Ly6G i.p. one day prior to infection. CD25+FoxP3+CD4+ Treg depletion was achieved in Foxp3 mice via i.p. administration of 100 μg/kg diphtheria toxin (DT) from Corynebacterium diphtheriae (Sigma-Aldrich, St. Louis, MO) separated into quadruplicate 25 μg/kg i.p. injections at days −3, −1, 2, and 5 relative to a day 0 infection. In some experiments timing of DT injection was limited to only days −3 and −1 to differentiate early versus late Treg activity in vivo. Agonistic 20-mer CpG oligodeoxynucleotides (ODN) were used to trigger supplementary TLR9 bystander inflammation in vivo as repeated 50 μg i.p. injections at days −1 and 0 in relation to LD Lm ΔactA-Ova infection. ODN 1585 (CpG-A) 5ʹ-ggGGTCAACGTT GAgggggg-3ʹ and ODN 1668 (CpG-B) 5ʹ-tccatgacgttcctgatgct-3ʹ (underlined represents the RRCGYY CpG motif with R as purine and Y as pyrimidine, upper case are phosphodiester bases, and lower case are phosphorothioate bases) were used in these studies (InvivoGen, San Diego, CA). Control ODN counterparts consisting of the same backbone containing GpC dinucleotide motifs were used as references. A mechanistic interrogation of a role for IL-12 in bystander inflammation-induced suppression was conducted with consecutive 300 mg anti-IL-12 (p70) i.p. co-injections alongside CpG-B delivery at days −1 and 0 in similar experiments. TLR9 engagement of endogenous DNA present in the extracellular space of infected animals was conversely digested via repeat i.v. injections of 2000 U DNase I (Roche, Mannheim, Germany) at 1.5, 3, 6, and 24 h after infection. Animals infected with Lm ΔactA- Ova in this context were used to measure the Ova-specific CD8+ T cell response magnitude at day 7 post-infection, described below. This brief exposure of DNase I was also used to evaluate long term survival of subjects lethally challenged with titrated doses of WT Lm Ova.

Alanine aminotransferase assay

Mice were sacrificed by lethal i.p. injection of 500 mg/kg ketamine HCl (Ketathesia; Henry Schein Animal Health, Dublin, OH) and bled via the retro-orbital venous plexus. Blood was collected in BD Microtainer SST tubes (BD Biosciences, Franklin Lakes, NJ) containing polymer gel and 100 U heparin (Fresenius Kabi USA, Schaumburg, IL) at 0, 2, 4, and 6 h post-infection. Sera samples were purified, and alanine aminotransferase (ALT) concentration was determined by mixing 20 μL serum with 200 μL liquid ALT working buffer (Pointe Scientific, Canton, MI). The reaction was incubated for 180 s at 37°C. Absorbance at 340 nm was read at 0, 60, 120, and 180 s time points with a kinetic read function using a SpectraMax M2 Microplate Reader equipped with SoftMax Pro (v5.3b12) software (Molecular Devices, San Jose, CA). ΔOD340/min was used to calculate ALT concentration.

Enzyme-linked immunosorbent assay (ELISA) and multiplex assay

Heparinized blood/serum was collected at 0, 6, 12, and 24 h post-infection as described above. Mouse IFN-a2/4 Platinum ELISA (eBioscience, San Diego, CA), mouse IFN-b VeriKine ELISA (PBL Assay Science, Piscataway, NJ), and mouse IL-12 (p70) as well as human/mouse TGF-b1 ELISA Ready-SET-Go (Invitrogen, Carlsbad, CA) kits were used in these studies according to the manufacturer’s instructions. Absorbance was read at 450 nm using a SpectraMax M2 Microplate Reader equipped with SoftMax Pro (v5.3b12) software (Molecular Devices). Sera were also analyzed using a MILLIPLEX MAP 32-plex mouse cytokine/chemokine panel (EMD Millipore, Billerica, MA) and analyzed on a Luminex MAGPIX System with xPONENT (v4.2) software (Luminex, Austin, TX).

Reverse-transcription/quantitative PCR (RT/Q-PCR)

Total RNA was isolated from whole spleen and cell sorted DC/T cell populations via the Trizol method (Invitrogen). Samples were reverse-transcribed using High Capacity RNA-to-cDNA Master Mix (Applied Biosystems, Foster City, CA). Q-PCR was performed using AB Fast SYBR Green Master Mix on an AB StepOne Plus Real-Time PCR System (Applied Biosystems). QuantiTect primers for Mus musculus Tlr2, Tlr4, Tlr7, and Tlr9 (QIAGEN, Valencia, CA), and self-designed primers for Mus musculus hypoxanthine phosphoribosyltransferase 1 (Hprt1; Fwd, 5ʹ-CTCCGCCGGCTTCCTCCTCA-3ʹ; Rev, 5ʹ-ACCTGGTTCATCATCGCTAATC-3ʹ) were used for detection.

Serum mitochondrial DNA (mtDNA), nuclear DNA (nDNA), and Lm DNA quantification

Cell-free serum was collected as described previously without use of heparin to avoid cellular lysis. RNA-free DNA was isolated using the column-based DNeasy Blood & Tissue kit coupled with 12 mAU proteinase K and 28 U RNase A exposure (QIAGEN), and DNA concentration was determined with high-sensitivity (>10 ng/mL) using the Qubit dsDNA HS Assay kit and Qubit Fluorometer (Invitrogen). All Q-PCR was performed using AB Fast SYBR Green Master Mix on an AB StepOne Plus Real-Time PCR System (Applied Biosystems). The Novagen NovaQUANT Mouse Mitochondrial to Nuclear Ratio kit was used to amplify both mtDNA (12 s and Trlev) and nDNA (Neb and Becn1) target genes in both samples and controls. Target DNA pre-amplification concentration was back-calculated based on 40 3 PCR cycles using titration curves generated from kit-provided WT DNA (LM) and ρ0 DNA (LMBE4) (EMD Millipore). In separate analyses, self-designed primers for ovalbumin model antigen (Ova; Fwd, 5ʹ-GTCAGCAGAGGCTGGAGTGGA-3ʹ; Rev, 5ʹ-GGCGTTGGTTGCGATGTGCT-3ʹ) together with the Lm encoded zinc metalloproteinase (mpl; Fwd, 5ʹ-CCAGTATTCGGCGG GATTGG-3ʹ; Rev, 5ʹ-GACCCACGCACACAGACATC-3ʹ) and broad-substrate range phospholipase C (plcB; Fwd, 5ʹ-GCAACGGAA GACATGGTAGCAA-3ʹ; Rev, 5ʹ-GTAGTCCGCTTTCGCCCTTT-3ʹ) were used to detect Lm ΔactA-Ova-specific target concentration in sera. Purified reference RNA-free DNA was collected via the DNeasy Blood & Tissue kit (QIAGEN) from a Lm ΔactA-Ova midiprep exposed to lysis buffer containing 0.5 mg/mL lysozyme (Thermo Scientific, Rochester, NY), 20 mM Tris∙Cl, and 2 mM EDTA (TE) for 30 min at 37°C followed with 1.2% Triton X-100 TE treatment for 10 min at 25°C. Lm pre-amplification target concentration was back- calculated using Lm genomic titration curves.

Spleen mononuclear cell isolation

Spleens were excised from the abdominal cavities of naive and infected/immunized mice and homogenized through sterile 70 μm cell strainers (Fisher Scientific, Pittsburgh, PA) in RPMI 1640 medium containing 10% fetal bovine serum. Viable mononuclear cells were quantified via Trypan Blue exclusion on a Vi-CELL XR cell viability analyzer (Beckman Coulter, Indianapolis, IN).

In vivo Treg conversion and functional suppression

Conventional CD4+ T cells were isolated from CD45.1+ Foxp3 or CD45.1+ Il12rb2−/−Foxp3 mice using the EasySep Mouse CD4+ T Cell Isolation kit (STEMCELL Technologies Inc., Vancouver, BC, Canada) followed by fluorescent cell sorting and transfer of 3.5 × 106 EGFP− T cells into C57BL/6 and Foxp3 mice. For conversion, separate groups of C57BL/6 mice were left naive or infected with LD or HD Lm ΔactA-Ova. At days 1 and 7 post-infection, the percent of splenic CD45.1+FoxP3-EGFP− cells that expressed EGFP, FoxP3, and Ki-67 was determined. For in vivo suppressor function of converted cells, day 7 CTL responses were analyzed in C57BL/6 and Foxp3 mice that had received a full day −3 to 5 DT regimen and 7.5 × 106 CD45.1+FoxP3-EGFP− T cell transfer.

In vitro T cell suppressor assay

Naive CD45.2+CD8+ T responder cells (Tresp) were negatively sorted using the EasySep Mouse CD8+ T Cell Isolation kit (STEMCELL Technologies Inc.) and stained with CellTrace Violet (CTV; Life Technologies, Carlsbad, CA). CD45.1+CD4+FoxP3-EGFP− T cells that had experienced HD Lm ΔactA-Ova infection for 24 h in C57BL/6 mice were re-isolated using the EasySep Mouse CD4+ T Cell Isolation kit (STEMCELL Technologies Inc.) followed by fluorescent cell sorting CD45.1+CD45.2−FoxP3-EGFP+ and CD45.1+CD45.2−FoxP3-EGFP− cells. 2.5 × 104 CD45.2+CD8+ Tresp were placed in co-culture with graded numbers of sex-matched, magnetic/fluorescent cell sorted CD45.1+FoxP3-EGFP+ (Treg) or EGFP− (conventional) CD4+ T cells and 1.25 mL washed Mouse T-Activator anti-CD3/CD28 Dynabeads (GIBCO) in a 96-well round-bottom plate for 72 h. Cell proliferation of CD45.2+CD8+ Tresp was determined by flow cytometry based on dilution of CTV. Percent suppression was calculated as the percent difference in absolute number of dividing Tresp in wells containing EGFP+ or EGFP– CD4+ T cells to the average absolute number of dividing Tresp in wells without addition of EGFP+ or EGFP– CD4+ T cells. Replication index, representative of only Tresp that had responded to anti-CD3/CD28 stimulation, was also determined for the cultures.

In vitro simulation of Treg conversion

Conventional CD4+ T cells were isolated from CD45.1+ Foxp3 or CD45.1+ Il12rb2−/−Foxp3 mice using the EasySep Mouse CD4+ T Cell Isolation kit (STEMCELL Technologies Inc.) followed by fluorescent cell sorting of EGFP− T cells. 2 3 105 CD4+FoxP3-EGFP− T cells were placed in culture with 5 μL washed Mouse T-Activator anti-CD3/CD28 Dynabeads (GIBCO, Carlsbad, CA) and 1 μg/mL anti-IL-4 (11B11) (BioLegend, San Diego, CA) in a 96-well round-bottom plate for 24 h. Select wells contained 5 ng/mL rmTGF-β1 and 10 ng/mL rmIL-12 (p70) (R&D Systems, Minneapolis, MN). Nuclear FACS staining of EGFP, FoxP3, and T-bet were used to measure conventional CD4+ T cell conversion to phenotypic Treg.

Flow cytometry and fluorescent cell sorting

Cells were stained with fluorochrome-tagged antibodies from BD Biosciences, BioLegend, eBioscience, PBL Assay Science, Rock- land Immunochemicals (Limerick, PA), Thermo Scientific, and Tonbo Biosciences (San Diego, CA) (Table S1). Identification of cells in this study was achieved by a FSC-A versus SSC-A gate set at 30–250K versus 0–200K, respectively, including all leukocytes with the goal of excluding debris/reticulocytes/RBCs. Next, a singlet gate was set from 50–100K FSC-W parameter. A SSC-W singlet gate was not applied to avoid misconstruing blasting T cells as doublets. In general, cell viability within this gate was >97% using Live/Dead Fixable Yellow Dead Cell Stain kit (Invitrogen). For most experiments, live/dead stains were not deemed necessary unless mRNA was analyzed which employed sorting out dead cells from analyzed populations. For T cells, a TCRβ+NK1.1− gate was applied to exclude NK1.1hiTCRβ− NK cells and NK1.1loTCRblo-hi NKT cells. The resultant population contained 100% T cells, and further gates for CD4, CD8a, CD45.1, and CD45.2 were applied per the requirements of individual experiments. CD4+ T cells were subsequently gated as conventional (FoxP3−) versus Treg (CD25+FoxP3+). H-2Kb-Ova (Ova257–264 bound to H-2Kb) iTAg tetramer (MBL International, Woburn, MA) was used to identify Ova-specific CD8+ T cells. Any other analyte staining including but not limited to CD44, CD69, intracellular cytokine detection, and EGFP/GFP expression was based off FMO and isotype controls set at 0.5% positivity in negative control samples. FoxP3-EGFP expression within a transferred conventional CD4+ T cell population in the presence of Lm infection was further defined based off uninfected controls. For APCs, a general MHC-II(I-A/I-E)+ gate was first set. B220+CD11c− B cells, B220+CD11c+ pDCs, and B220−CD11c+ macrophage (Mac) and DC populations could be readily identified downstream of this. The B220−CD11c+ bulk gate was further dissected via CD11b, CD11clo-hi, CD8α, CD103, and F4/80 expression for deeper identification of Mac and DC subsets. PBMC populations were analyzed for absence of CD4+TCRβ+ cells during CD4+ T cell depletion experiments, and lack of CD11b+Ly6Ghi cell presence was confirmed in neutrophil depletion experiments before proceeding. Cell surface staining of 3.0 × 106 splenic mononuclear cells isolated directly ex vivo or various numbers of cells cultured in vitro was performed by specific antibody labeling for 15 min at 4°C in FACS Buffer (1 3 PBS containing 2% fetal bovine serum and 0.1% NaN3). Cells were fixed in BD Cytofix/Cytoperm (BD Biosciences). Nuclear protein staining was achieved using the FoxP3 Staining Set (eBioscience). For intracellular T cell cytokine detection, cells were re-stimulated with 2 μg/mL Ova257–264 peptide (AnaSpec, Fremont, CA) for 5 h. Intracellular cytokine detection in APC populations was measured after 5 h of stimulation with 5 ng/mL phorbol 12-myristate 13-acetate (PMA) and 500 ng/mL ionomycin (Sigma-Aldrich). Both cytokine procedures featured concurrent blocking with 1 μL/mL GolgiPlug and 1 μL/mL GolgiStop during culture and permeabilization with BD Perm/Wash (BD Biosciences) after fixation. Data were collected on a BD FACS Canto II (BD Immunocytometry Systems, San Jose, CA) and analyzed using FlowJo (v9.7.5 and v10.4.2) software (Tree Star Inc., Ashland, OR). Fluorescent cell sorting of CD45.1+, CD45.2+, FoxP3-EGFP+, and/or FoxP3-EGFP− cells was performed using BD FACSAria I, BD FACSAria II, and BD FACSAria Fusion cell sorters (BD Immunocytometry Systems).

ImageStream

p65-GFP knockin mice were infected with HD Lm ΔactA-Ova for 24 h and splenocytes were surface stained as in traditional flow cytometry for identification of APC subset expression of MHC-II(I-A/I-E), B220, CD11b, CD11c, CD8α, CD103, and F4/80 followed by identification of intracellular targets including endosomal TLR9, cytoplasmic/nuclear GFP, and DNA using 4’,6-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene, OR). Cells were collected using an Amnis ImageStreamX mk II imaging flow cytometer with INSPIRE (v99.0.0.0) software and analyzed using IDEAS (v6.2.183.0) software (Amnis Inc., Seattle, WA). Briefly, a morphology mask of nuclei was defined with DAPI, which included all pixels within the outmost image contour. To quantify translocation of p65-GFP to the nuclei of cells, the similarity score within the DAPI-masked area was calculated as the log transformed Pearson’s correlation coefficient for DAPI and GFP image components and reported as the ΔΔ Median Similarity Morphology of ~1000–6000 events/sample (Δ1 = TLR9lo-hi; Δ2 = naive-24 h).

RNA sequencing (RNA-Seq)

Total RNA was purified using the Direct-zol RNA MiniPrep Plus and RNA Clean & Concentrator-25 kits (Zymo Research, Irvine, CA). RNA quality and quantity was assessed using an Agilent 2100 Bioanalyzer with a RNA 6000 Pico kit (Agilent Technologies, Santa Clara, CA) resulting in all samples producing RIN scores above 9.0. 5 ng of total RNA was then amplified using the Smart-seq2 pro- tocol (Picelli et al., 2014). A 1:1 ratio of Agencourt AMPure XP beads (Beckman Coulter) were used to purify resulting cDNA, and 1 ng cDNA was subsequently used to prepare a sequencing library with the Nextera XT DNA Library Prep kit (Illumina, San Diego, CA). Both whole-transcriptome amplification and sequencing library preparations were performed in a 96-well format to reduce assay-to-assay variability. Quality control steps were included to determine total RNA quality and quantity, the optimal number of PCR pre-amplification cycles, and fragment size selection. The resulting libraries were deep sequenced on the HiSeq 2500 System in Rapid Run mode (Illumina) using 50-bp single-end reads (~6.0 × 106 reads per condition).

Bioinformatics analysis of RNA-Seq

The single-end reads that passed Illumina filters were filtered for reads aligning to tRNA, rRNA, adaptor sequences, and spike-in controls. Reads were then aligned to UCSC mm10 reference genome using TopHat (v1.4.1) software (Trapnell et al., 2009). DUST scores were calculated with PRINSEQ Lite (v0.20.3) software (Schmieder and Edwards, 2011) and low-complexity reads (DUST > 4) were removed from the BAM files. Alignment results were parsed via the SAMtools (Li et al., 2009) to generate SAM files. Read counts to each genomic feature were obtained with Python HTSeq (v0.6.0) software (Anders et al., 2015) using the union option. After removing absent features (zero counts in all samples), raw counts were imported to R (v3.1.0) Bioconductor (v3.0) package DESeq2 (v1.6.3) (Love et al., 2014) to identify differentially expressed genes among samples. DESeq2 normalizes counts by dividing each column of the count table (samples) by the size factor of this column. The size factor is calculated by dividing the samples by geometric means of the genes bringing count values to a common scale suitable for comparison. p values for differential expression were calculated using binomial test for differences between the base means of two conditions. p values were then adjusted for multiple test correction using the Benjamini Hochberg algorithm (Benjamini and Hochberg, 1995) to control the false discovery rate. Genes were considered differentially expressed between two groups of samples when DESeq2 analysis resulted in an adjusted p value of <0.05. Bio function analysis of gene-ontology (GO) term enrichment of pathways related to T cell activation, differentiation, proliferation, death/survival, and adhesion/movement showing enrichment among genes differentially expressed (filtered on p < 0.05) as well as upstream regulator prediction of differentially expressed gene profiles compared among bulk endogenous FoxP3-EGFP+ Treg fluorescently sorted from naive mice versus counterparts exposed to HD Lm ΔactA-Ova for 24 h was conducted using Ingenuity Pathway Analysis (IPA; v01–07) software (QIAGEN).

p65 DNA binding site prediction

The consensus transcription factor DNA-binding preference of the highly conserved N-terminal Rel homology (RH) domain of p65 (RelA) was queried in the JASPAR database (Sandelin et al., 2004). Putative transcription factor binding sites were scanned for with the position-specific frequency matrix of p65 input over genomic DNA spanning 2 kb upstream and downstream of murine Il12a and Il12b loci with an >0.80 threshold.

QUANTIFICATION AND STATISTICAL ANALYSIS

Significant differences between experimental groups were calculated using the two-tailed Student’s t test or one-way/two-way ANOVAs (with group comparisons R 3) with multiple comparison Tukey’s post hoc test or Dunnett’s post hoc test relative to a control where appropriate. For survival curves, the Mantel-Cox and x2 tests were used to determine significance. Data analysis was performed using Prism (v7.0a and v8.0.2) software (GraphPad Software Inc., La Jolla, CA). Numbers in histograms and scatterplots represent percentage. All data in bar, scatter, and line graphs indicate means ± SEM. Values of p < 0.05 were regarded as being statistically significant and noted as * < 0.05, ** < 0.01, *** < 0.001, and **** < 0.0001. † < 0.05, †† < 0.01, ††† < 0.001, and †††† < 0.0001 notations were used with reports of ANOVA alongside multiple comparisons tests. Each experiment in this report was replicated 2 or 3 times to ensure reproducibility and reach statistical power of the results.

DATA AND CODE AVAILABILITY

These data presented in this manuscript are tabulated in the main paper and in the supplementary materials. RNA-seq metadata are archived in the NCBI gene expression omnibus (GEO) as series GSE106554.

KEY RESOURCES TABLE

REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies

anti-CD4 (GK1.5)Alejandro Aruffo (Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA) and (Noelle et al., 1992)N/A
anti-CD4 (RM4-5) APC-eF780eBioscienceCat#47-0042-82
anti-CD4 (RM4-5) PerCP-Cy5.5Tonbo BiosciencesCat#65-0042-U 100
anti-CD8 (53-6.7) eF450eBioscienceCat#48-0081-82
anti-CD8 (53-6.7) PETonbo BiosciencesCat#50-0081-U 100
anti-CD11b (M1/70) PE-Cy73D BiosciencesCat#552850
anti-CD11c (N418) PerCP-Cy5.5eBioscienceCat#45-0114-82
anti-CD25 (PC61.5) PerCP-C5.5Tonbo BiosciencesCat#65-0251-U 100
anti-CD40L (MR1)Alejandro Aruffo (Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA) and (Noelle et al., 1992)N/A
ant-CD44 (IM7) PerCP-Cy5.5eBioscienceCat#45-0441-82
ant-CD45.1 (A20) APC-eF780eBioscienceCat#47-0453-82
ant-CD45.2 (104) APCTonbo BiosciencesCat#20-0454-U 100
ant-CD45R/B220 (RA3-6B2) APC-eF780eBioscienceCat#47-0452-82
ant-CD45R/B220 (RA3-6B2) BV605BD BiosciencesCat#563708
ant-CD69 (H1.2F3) APCBioLegendCat#104513
ant-CD103 (2E7) APCeBioscienceCat#17-1031-80
ant-CD103 (2E7) PEeBioscienceCat#12-1031-82
ant-F4/80 (BM8) PEeBioscienceCat#12-4801-80
ant-FoxP3 (FJK-16 s) PEeBioscienceCat#12-5773-82
ant-GFP (pAb) FITCRockland ImmunochemicalsCat#600-402-215
ant-IFN-β (RMMB-1) FITCPBL Assay ScienceCat#22400-3
ant-IFN-γ (XMG1.2) APCeBioscienceCat#17-7311-82
ant-IL-2 (JES6-5H4) PEBioLegendCat#503808
ant-IL-4 (11B11)BioLegendCat#504108
ant-IL-12 (p40) (C17.8) PETonbo BiosciencesCat#50-7123-U100
ant-IL-12 (p70) (R2-9A5)BioXCellCat#BE0233
ant-Ki-67 (SolA15) eF450eBioscienceCat#48-5698-82
ant-Ly6G (1A8)BioXCellCat#BP0075
ant-MHC II (M5/114.15.2) APC-eF780eBioscienceCat#47-5321-80
ant-MHC II (M5/114.15.2) eF450eBioscienceCat#48-5321-80
ant-NK1.1 (PK136) APCeBioscienceCat#17-5941-82
ant-NK1.1 (PK136) PE-Cy7eBioscienceCat#25-5941-82
ant-TCRβ (H57-597) APCTonbo BiosciencesCat#20-5961-U 100
ant-TCRβ (H57-597) FITCTonbo BiosciencesCat#35-5961-U 100
ant-TCRβ (H57-597) Pacific BlueBioLegendCat#109226
ant-TCRβ (H57-597) PETonbo BiosciencesCat#50-5961-U025
ant-TCRβ (H57-597) PE-Cy7Tonbo BiosciencesCat#60-5961-U 100
ant-TLR9 (26C593.2) AF647Thermo Scientific and self-labeledCat#MA5-16178
ant-TNF-α (MP6-XT22) PE-Cy7BD BiosciencesCat#557644

Bacterial and Virus Strains

WT Listeria monocytogenes (Lm) 10403SDaniel A. Portnoy (University of California, Berkeley, CA)N/A
WT Lm OvaDaniel A. Portnoy (University of California, Berkeley, CA)N/A
Lm ΔactA 10403SDaniel A. Portnoy (University of California, Berkeley, CA)N/A
Lm ΔactA-Ova 10403SDaniel A. Portnoy (University of California, Berkeley, CA)N/A

Chemicals, Peptides, and Recombinant Proteins

CellTrace Violet (CTV)Life TechnologiesCat#C34557
4’,6-diamidino-2-phenylindole (DAPI)Molecular ProbesCat#D1306
diphtheria toxin (DT)Sigma-AldrichCat#D0564
DNase I, from bovine pancreasSigma-AldrichCat#11284932001
H-2Kb-Ova iTAg tetramer PEMBL InternationalCat#TB-5001-1
Mouse T-Activator anti-CD3/CD28 DynabeadsGIBCOCat#11452D
Ova257–264 peptide (SIINFEKL)AnaSpecCat#AS-60193-1
rmIL-12 (p70)R&D SystemsCat#419-ML-010
rmTGF-β1R&D SystemsCat#7666-MB-005

Critical Commercial Assays

human/mouse TGF-β1 ELISAInvitrogenCat#88-8350-86
liquid ALT (SGPT) Reagent setPointe ScientificCat#A7526150
live/Dead Fixable Yellow Dead Cell Stain kitInvitrogenCat#L-34968
MILLIPLEX MAP 32-plex mouse cytokine/chemokine panelEMD MilliporeCat#MCYTMAG-7 0K-PX32
mouse IFN-α2/4 Platinum ELISAeBioscienceCat#BMS6027
mouse IFN-β VeriKine ELISAPBL Assay ScienceCat#42400
Novagen NovaQUANT Mouse Mitochondrial to Nuclear Ratio kitEMD MilliporeCat#72621 −1KIT

Deposited Data

RNA-Seq metadataNCBI gene expression omnibusGSE106554

Experimental Models: Mice

C57BL/6The Jackson LaboratoryStock#000664
Act-mOva H-2kb−/−Marc K. Jenkins (University of Minnesota, Minneapolis, MN) and (Feau et al., 2011; Janssen et al., 2005)N/A
Batf3−/− The Jackson LaboratoryStock#013755
Foxp3EGFP (FoxP3-EGFP)The Jackson LaboratoryStock#006772
Foxp3 DTR-EGFP The Jackson LaboratoryStock#016958
Il12rb2 −/− The Jackson LaboratoryStock#003248
Nr4a1GFP (Nur77-GFP)Kristin A. Hogquist (University of Minnesota) and (Moran et al., 2011)N/A
p65-GFPManolis Pasparakis (University of Cologne, Cologne, Germany) and (De Lorenzi et al., 2009)N/A
Tlr2 −/− The Jackson LaboratoryStock#004650
Tlr4 −/− The Jackson LaboratoryStock#007227
Tlr7 −/− The Jackson LaboratoryStock#008380
Tlr9 M7Btlr The Jackson LaboratoryStock#014534

Oligonucleotides

Mus musculus Tlr2 QuantiTect primersQIAGENCat#QT00129752
Mus musculus Tlr4 QuantiTect primersQIAGENCat#QT00259042
Mus musculus Tlr7 QuantiTect primersQIAGENCat#QT00251013
Mus musculus Tlr9 QuantiTect primersQIAGENCat#QT01043049
forward primer for Lm mpl CCAGTATTCGGCGGGATTGGself-designedN/A
reverse primer for Lm mpl GACCCACGCACACAGACATCself-designedN/A
forward primer for Lm plcB GCAACGGAAGACATGGTAGCAAself-designedN/A
reverse primer for Lm plcB GTAGTCCGCTTTCGCCCTTTself-designedN/A
forward primer for Mus musculus Hprtl CTCCGCCGGCTTCCTCCTCAself-designedN/A
reverse primer for Mus musculus Hprtl ACCTGGTTCATCATCGCTAATCself-designedN/A
forward primer for ovalbumin GTCAGCAGAGGCTGGAGTGGAself-designedN/A
reverse primer for ovalbumin GGCGTTGGTTGCGATGTGCTself-designedN/A
ODN 1585 Ctrl (CpG-A Ctrl) ggGGTCAAGCTTGAggggggInvivoGenCat#tlrl-1585c
ODN 1585 (CpG-A) ggGGTCAACGTTGAggggggInvivoGenCat#tlrl-1585
ODN 1668 Ctrl (CpG-B Ctrl) tccatgagcttcctgatgctInvivoGenCat#tlrl-1668c
ODN 1668 (CpG-B) tccatgacgttcctgatgctInvivoGenCat#tlrl-1668

Software and Algorithms

Bioconductor (v3.0) package DESeq2 (v1.6.3) Love et al., 2014 N/A
FlowJo (v9.7.5 and v10.4.2) softwareTree Star Inc.N/A
IDEAS (v6.2.183.0) softwareAmnis Inc.N/A
Ingenuity Pathway Analysis (IPA; v01-07) softwareQIAGENN/A
Luminex MAGPIX System with xPONENT (v4.2) softwareLuminexN/A
Python HTSeq (v0.6.0) software Anders et al., 2015 N/A
PRINSEQ Lite (v0.20.3) software Schmieder and Edwards, 2011 N/A
Prism (v7.0a and v8.0.2) softwareGraphPad Software Inc.N/A
SAMtools Li et al., 2009 N/A
SoftMax Pro (v5.3b12) softwareMolecular DevicesN/A
TopHat (v1.4.1) software Trapnell et al., 2009 N/A

Other

Cytofix/CytopermBD BiosciencesCat#554722
FoxP3 Staining seteBioscienceCat#00-5523-00
GolgiPlugBD BiosciencesCat#555029
GolgiStopBD BiosciencesCat#554724
ionomycinSigma-AldrichCat#P1585
phorbol 12-myristate 13-acetate (PMA)Sigma-AldrichCat#I0634
  82 in total

1.  JASPAR: an open-access database for eukaryotic transcription factor binding profiles.

Authors:  Albin Sandelin; Wynand Alkema; Pär Engström; Wyeth W Wasserman; Boris Lenhard
Journal:  Nucleic Acids Res       Date:  2004-01-01       Impact factor: 16.971

2.  Control of regulatory T cell development by the transcription factor Foxp3.

Authors:  Shohei Hori; Takashi Nomura; Shimon Sakaguchi
Journal:  Science       Date:  2003-01-09       Impact factor: 47.728

3.  Full-length RNA-seq from single cells using Smart-seq2.

Authors:  Simone Picelli; Omid R Faridani; Asa K Björklund; Gösta Winberg; Sven Sagasser; Rickard Sandberg
Journal:  Nat Protoc       Date:  2014-01-02       Impact factor: 13.491

Review 4.  Infections and autoimmune diseases.

Authors:  Jean-François Bach
Journal:  J Autoimmun       Date:  2005-11-08       Impact factor: 7.094

5.  Expansion and characteristics of human T regulatory type 1 cells in co-cultures simulating tumor microenvironment.

Authors:  Christoph Bergmann; Laura Strauss; Reinhard Zeidler; Stephan Lang; Theresa L Whiteside
Journal:  Cancer Immunol Immunother       Date:  2007-01-31       Impact factor: 6.968

Review 6.  Regulatory T cells: mechanisms of differentiation and function.

Authors:  Steven Z Josefowicz; Li-Fan Lu; Alexander Y Rudensky
Journal:  Annu Rev Immunol       Date:  2012-01-06       Impact factor: 28.527

Review 7.  How regulatory T cells work.

Authors:  Dario A A Vignali; Lauren W Collison; Creg J Workman
Journal:  Nat Rev Immunol       Date:  2008-07       Impact factor: 53.106

8.  Smad7 in T cells drives T helper 1 responses in multiple sclerosis and experimental autoimmune encephalomyelitis.

Authors:  Ingo Kleiter; Jian Song; Dominika Lukas; Maruf Hasan; Bernhard Neumann; Andrew L Croxford; Xiomara Pedré; Nadine Hövelmeyer; Nir Yogev; Alexander Mildner; Marco Prinz; Elena Wiese; Kurt Reifenberg; Stefan Bittner; Heinz Wiendl; Lawrence Steinman; Christoph Becker; Ulrich Bogdahn; Markus F Neurath; Andreas Steinbrecher; Ari Waisman
Journal:  Brain       Date:  2010-03-30       Impact factor: 13.501

9.  HTSeq--a Python framework to work with high-throughput sequencing data.

Authors:  Simon Anders; Paul Theodor Pyl; Wolfgang Huber
Journal:  Bioinformatics       Date:  2014-09-25       Impact factor: 6.937

10.  TopHat: discovering splice junctions with RNA-Seq.

Authors:  Cole Trapnell; Lior Pachter; Steven L Salzberg
Journal:  Bioinformatics       Date:  2009-03-16       Impact factor: 6.937

View more
  5 in total

Review 1.  The Trinity of cGAS, TLR9, and ALRs Guardians of the Cellular Galaxy Against Host-Derived Self-DNA.

Authors:  Vijay Kumar
Journal:  Front Immunol       Date:  2021-02-11       Impact factor: 7.561

2.  Bleomycin-Induced Lung Injury Increases Resistance to Influenza Virus Infection in a Type I Interferon-Dependent Manner.

Authors:  Sang-Uk Seo; Jae-Hyeon Jeong; Bum-Seo Baek; Je-Min Choi; Youn Soo Choi; Hyun-Jeong Ko; Mi-Na Kweon
Journal:  Front Immunol       Date:  2021-08-18       Impact factor: 7.561

3.  Developmentally distinct CD4+ Treg lineages shape the CD8+ T cell response to acute Listeria infection.

Authors:  Joseph S Dolina; Joey Lee; Eugene L Moore; Jennifer L Hope; Donald T Gracias; Takaji Matsutani; Ashu Chawla; Jason A Greenbaum; Joel Linden; Stephen P Schoenberger
Journal:  Proc Natl Acad Sci U S A       Date:  2022-03-03       Impact factor: 11.205

Review 4.  Toll-Like Receptor Signaling and Its Role in Cell-Mediated Immunity.

Authors:  Tianhao Duan; Yang Du; Changsheng Xing; Helen Y Wang; Rong-Fu Wang
Journal:  Front Immunol       Date:  2022-03-03       Impact factor: 7.561

5.  Tregs tango with killer cells in acute infection.

Authors:  Xiang Sun; Hongbo Chi
Journal:  Proc Natl Acad Sci U S A       Date:  2022-03-21       Impact factor: 12.779

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.