| Literature DB >> 32258150 |
Ramakanta Rana1, Manoranjan Ranjit1, Madhusmita Bal1, Hemant Kumar Khuntia1, Sanghamitra Pati1, Sri Krishna2, Aparup Das2.
Abstract
Estimation of the spread and advancement of Plasmodium falciparum artemisinin-resistant parasites can be done by probing polymorphisms in the kelch (Pfk13) domain (a validated molecular marker). This study aimed to provide baseline information for future artemisinin surveillance by analyzing the k13-propeller domain in P. falciparum field isolates collected from 24 study areas in 14 malaria hot spots of Odisha (previously Orissa) during July 2018-January 2019. A total of 178 P. falciparum mono infections were assessed. An 849-base pair fragment encoding the Pfk13 propeller was amplified by nested polymerase chain reaction and sequenced in both directions (PCR). After DNA alignment with the 3D7 reference sequence, all samples were found to be wild type. It can be anticipated that malaria public health is not under direct threat in Odisha relating to ART resistance.Entities:
Mesh:
Substances:
Year: 2020 PMID: 32258150 PMCID: PMC7102476 DOI: 10.1155/2020/8475246
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
Total number of cases of IDT+ve, nested PCR+ve, PfKelch13 amplified, and 57 (89.06%) sequenced out of 64 P. falciparum isolates, by different sites and districts of Odisha, India.
| SL no. | District | SL no. (area wise) | Sites | No. of samples | IDT Pf/Pv | PCR+ve | K13 amplified ( | Samples sequenced | |
|---|---|---|---|---|---|---|---|---|---|
|
| All sequenced | ||||||||
| 1 | Keonjhar | 1 | Saria | 2 | 2 | 2 | 2(100) | 1 | |
| 2 | Kalahandi | 2 | Banigaon, Lanjigarh | 35 | 35 | 23 | 19() | 12 | |
| 3 | Kandhamal | 3 | Similipadar | 31 | 30 | 22 | 18() | 13 | |
| 4 | Kandhamal | 4 | Saperivatta | 8 | 8 | 8 | 6() | 3 | |
| 5 | Sundargarh | 5 | Sanajala, Baneigarh | 1 | 1 | 1 | 1() | 1 | |
| 6 | Sundargarh | 6 | Uparginia, Baneigarh | 15 | 15 | 15 | 5() | 4 | |
| 7 | Angul | 7 | Rugudidiha | 1 | 1 | 1 | 1() | 1 | |
| 8 | Angul | 8 | Bandhabhui | 2 | 2 | 2 | 1() | 1 | |
| 9 | Deogarh | 9 | Jalisuan, Barkot | 5 | 3 | 2 | 1() | 1 | |
| 10 | Raygada | 10 | Patalamba | 12 | 12 | 8 | 7() | 4 | |
| 11 | Raygada | 11 | Gartali | 5 | 5 | 5 | 4() | 3 | |
| 12 | Raygada | 12 | Kandsui | 3 | 3 | 3 | 3() | 2 | |
| 13 | Raygada | 13 | Parsali | 2 | 2 | 2 | 2() | 2 | |
| 14 | Ganjam | 14 | Uparabartala | 5 | 4 | 1 | 1() | 1 | |
| 15 | Malkangiri | 15 | Andrahal | 2 | 2 | 2 | 2() | 2 | |
| 16 | Malkangiri | 16 | Kanininga | 1 | 1 | 1 | 1() | 1 | |
| 130 | 129 | 107 | 76(71) | 52 | |||||
|
| |||||||||
| 17 | Cuttack | 17 | SCB MCH | 21 | 21 | 1 | 1() | 1 | |
| 18 | Khurda | 18 | Capital Hospital | 5 | 5 | 4 | 3() | 2 | |
| 19 | Khurda | 19 | SUM Hospital | 1 | 1 | 1 | 1() | 1 | |
| 20 | Kandhamal | 20 | RKSSDH, Baliguda | 5 | 2 | 2 | 1() | 1 | |
| 21 | Kandhamal | 21 | Dist HQ hospital, Phulbani | 1 | 1 | 1 | 1() | 1 | |
| 22 | Bargarh | 22 | Paikmal PHC | 5 | 5 | 4 | 3() | 3 | |
| 23 | Bargarh | 23 | Dunguripali, Jharbandh | 5 | 2 | 2 | 2() | 1 | |
| 24 | Nuapada | 24 | Dist HQ hospital, Bukuramunda | 5 | 4 | 4 | 3() | 2 | |
| 48 | 46 | 21 | 17(80) | 12 | |||||
| Total | 178 | 175 (98.31%) | 128 (73.14%) | 93 (72%) | 64 | ||||
PCR thermo cycling conditions for primary and secondary PCR (for PF3D7_1343700).
| Primer name | PCR | Sequence 5′-3′ | Product | Initial denaturation | Denaturation | Annealing | Extension | Final extension | No. of cycles |
|---|---|---|---|---|---|---|---|---|---|
| K13_PCR-F | 10 PCR | CGGAGTGACCAAATCTGGGA | 2097 bp | 95-15 m | 95-00.30 s | 58-2.00 m | 72-2.00 m | 72-10.00 m | 25 |
| K13_PCR_R | 10 PCR | GGGAATCTGGTGGTAACAGC | |||||||
| K13_N1_F | 20 PCR | GCCAAGCTGCCATTCATTTG | 849 bp | 60-1.00 m | 72-2.00 m | 28 | |||
| K13_N1_R | 20 PCR | GCCTTGTTGAAAGAAGCAGA |
Distribution of P. falciparum isolates age wise, gender wise, and k13 sequencing results.
| Age group | Frequency of Pf cases | % | Pf cases in male | K13 male | Pf cases in female | K13 female | ||
|---|---|---|---|---|---|---|---|---|
| 0-9 | 36 | 28.12 | 27 | 20 | 9 | 5 | K13 selected for sequencing no. 64 | Propeller sequenced/results (no-wild type, 57 wild type) |
| 10-19 | 26 | 20.31 | 12 | 8 | 14 | 5 | ||
| 20-29 | 13 | 10.15 | 5 | 5 | 8 | 6 | ||
| 30-39 | 9 | 7.03 | 4 | 4 | 5 | 4 | ||
| 40-49 | 24 | 18.75 | 17 | 12 | 7 | 5 | ||
| 50-59 | 14 | 10.93 | 7 | 7 | 7 | 6 | ||
| 60-69 | 5 | 3.9 | 2 | 2 | 3 | 3 | ||
| 70-79 | 1 | 0.78 | 0 | 0 | 1 | 1 | ||
| Total | 128 | 74 (57.8%) | 58 | 54 (42.1%) | 35 |