Literature DB >> 32257888

Silymarin inhibits Toll-like receptor 8 gene expression and apoptosis in Ramos cancer cell line.

Nasrin Ranjbar1,2, Ramin Saravani3,2, Zohreh Faezizadeh4.   

Abstract

OBJECTIVE: Silymarin is a herbal extract containing flavonolignans, and it has inhibitory effects against the growth of different cancer cell lines by inducing apoptosis. Toll-like receptors are suggested as a novel and attractive target to treat cancer. The current study aimed at examining the mechanism of silymarin-induced apoptosis in Ramos cells and investigating its effects on TLR8 expression.
MATERIALS AND METHODS: The half maximal inhibitory concentration (IC50) of silymarin in Ramos cells was determined via MTT viability test while the type of cell death was tested by annexin V/propidium iodide (PI) double staining method. The activity of caspase-3 and expression of TLR8 were measured in a time-dependent manner (in IC50) by colorimetric assay and real-time polymerase chain reaction (RT-PCR), respectively.
RESULTS: The results of MTT showed that IC50 of silymarin in Ramos cells was 100 μg/ml after 48 hr treatment (p<0.01). Flow cytometry by annexin V/PI, showed that silymarin induced early/late apoptosis in this cell line (p<0.05 to p<0.01). In addition, the caspase-3 colorimetric method showed that caspase-3 increased in the Ramos cell line after treatment (p<0.01). This treatment led to a reduction in TLR8 mRNA expression in a time-dependent manner (p<0.01).
CONCLUSION: The results indicated a new mechanism in the anticancer activity of Toll-like receptor (TLR) signaling after silymarin treatment in Ramos cancer cell line. This plant could be used to develop anticancer agents inhibiting TLRs.

Entities:  

Keywords:  Apoptosis; Gene expression; Ramos cells; Silymarin; TLR8; Toll-like receptor

Year:  2020        PMID: 32257888      PMCID: PMC7103436     

Source DB:  PubMed          Journal:  Avicenna J Phytomed        ISSN: 2228-7930


Introduction

Compounds derived from certain plants induce apoptosis in different cancerous cell lines (Unitt and Hornigold, 2011 ▶). It was reported that herbal agents suppress toll-like receptors (TLRs) and may be potential targets of chemotherapeutic compounds. The fruits and seeds of the medicinal plant Silybum marianum L., are used to obtain a bioactive extract named silymarin, which mainly contains silibinin and partially silibinin stereoisomers (Ramasamy and Agarwal, 2008 ▶;Wen et al., 2008 ▶). Extensive studies indicated strong chemopreventive and anticancer effects of silymarin on many types of cancers (Wen et al., 2008 ▶; Tyagi et al., 2007 ▶). There are more than 20 types of lymphatic system cancers. Burkitt lymphoma, a germinal center B-cell-derived cancer, is an important human oncogene found more than three decades ago. This cancer, which is a form of non-Hodgkin's lymphoma, begins in immune cells called B-lymphocytes (Burkitt, 1958 ▶). The most tenable hypothesis consistent with all the observed facts is that tumor formation results from interactions between some virus or viruses and a reticuloendothelial system altered by chronic and heavy infection by malarial or other parasites (Burkitt, 1969 ▶). TLRs are transmembrane pattern recognition receptors capable of recognizing generic pathogen-associated molecular patterns (PAMPs) (Barton and Kagan, 2009 ▶). Their activation induces intracellular signaling pathways that result in the production of a variety of nuclear factor (NF)-kB-mediated cytokines (e.g. tumor necrosis factor) and type I interferon (Kawai and Akira, 2011 ▶), which prevent cell death by expressing anti-apoptotic proteins such as Bcl-2 and induce chronic inflammation by producing cyclooxygenase-2 (Grimm et al., 2010 ▶; Bowie and O'neill, 2000 ▶). Humans have ten known functional TLRs, of which TLR 3, 7, 8, and 9 are expressed on intracellular vesicular membranes and are commonly involved in recognizing nucleic acids; TLR8 detects viral single-stranded RNA (Kawai and Akira, 2006 ▶). Recently, it was observed that TLRs are expressed in tumor cells (Sato et al., 2009 ▶). The role of TLRs expression in tumor cells and its relationship with tumor development are exciting subjects in tumor immunity. TLR8 is activated in different cancers including cervical, pancreatic, and lung cancer cells (Zhang et al., 2014 ▶; Cherfils-Vicini et al., 2010a ▶; Grimmig, et al., 2015 ▶). Cherfils-Vicin et al. reported that TLR8 was expressed in human lung cancer cells, and PolyU (TLR8 ligand) could upregulate B-cells lymphoma-2 (Bcl-2) and promote the survival of lung cancer cells. They also proposed that Bcl-2 plays a crucial role in autophagy and apoptosis pathways (Cherfils-Vicini et al., 2010b ▶). Therefore, TLR8 is considered a key marker of tumor genesis and is a highly selective candidate to develop anti-proliferative and anti-malignant agents. To date, there is no report on TLR8 gene expression and the molecular mechanism involved in the anti-proliferative effect of silymarin in Ramos (P53-mutant) cancer cell line. Also, there are data on mutations in the P53 that associated with malignancy condition such as proliferation, migration, and invasion The current study aimed at examining the effect of silymarin on TLR8 gene expression and induction of apoptosis in Ramos cancer cell line.

Materials and Methods

Chemical reagents All the materials were of analytical grade. RPMI 1640 medium, trypan blue and trypsin were purchased from INOCLON (G. Innovative Biotech Co Inoclon), Iran). Fetal bovine serum (FBS), penicillin/streptomycin and amphotericin B were purchased from Gibco (Rockville, MD, USA). Annexin V/PI (propidium iodide), apoptosis detection kit was obtained from BioVision (San Francisco, CA, USA). 3-(4, 5-dimethylhiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Reverse transcription kit and real-time PCR kit were purchased from TaKaRa Bio Inc. (Dalian, China). Cell culture The P53-mutant Ramos cells (ATCC® Number: CRL-1596™; Organism: Homo sapiens, human; Cell Type: B lymphocyte; and Disease: Burkitt's lymphoma) were maintained in a medium that contained RPMI 1640 medium, fetal bovine serum (10%), penicillin (100 U/ml), and streptomycin (100 µg/ml). The P53-mutant Ramos cell line was grown under cell culture conditions at 37°C, with 95% humidity, with an atmosphere of 5% CO2. MTT viability assay To evaluate the cytotoxic effects of silymarin on Ramos cell line, cells were plated at a density of 6×103 cell/well in a 96-well plate and exposed to various concentrations of silymarin (0, 25, 50, 75 and 100 μg/ml) for 24, 48 and 72 hr. Then, the viability of the cells was measured by MTT assay. Briefly, after the aforementioned periods, 20 μl of MTT dye was added and the solution was incubated at 37°C for 3 hr. Then, 200 μl of dimethyl sulfoxide (DMSO) was added and the solution was placed in a dark box for 15 min. Finally, all the plates were read at 570 nm wavelength using a microplate reader (Stat Fax 2100; Awareness Technology, Los Angeles, CA, USA). Flow cytometry assay using annexin V/PI staining Apoptosis was detected using annexin/PI staining kit. Ramos cells were seeded (1 × 105 cell/well) in 6-well plates and incubated for 12 hr before treatment with increasing concentrations of silymarin. After 48 hr of treatment, both treated and untreated cells were trypsinized, washed with cold phosphate-buffered saline (PBS), and resuspended in PBS. Apoptosis was measured using an annexin V/PI double staining kit (BioVision, San Francisco, CA, USA). According to the manufacturer’s instructions, first of all, the cell pellets were stained with 250 μl 1X binding buffer and later, incubated with 2.5 µl annexin V for 15 min in the dark at room temperature. Before analysis, 2.5 µl of propidium iodide (PI) was added and incubated for 10 min. Finally, the working solution (1000 µl) was added to the samples before analysis by a fluorescence-activated cell sorting (FACS) cytometer (BD Biosciences, San Jose, CA, USA). Caspase-3 activity Caspase-3 activity was measured according to the manufacturer’s instructions using colorimetric Assay Kits (R&D systems Co. Germany). Briefly, cells were treated with silymarin (IC50) at different times (0 [control], 6, 12 and 24 hr); next, cells were washed twice in cold PBS and lysed using lysis buffer for 10 min. Then, cells were centrifuged at 10000 g for 10 min and then 50 µl reaction buffer and 5 µl of caspase-3 substrate were added to supernatants and incubated at 37°C for 1 hr. The results of absorbance as measured by a microplate reader (Stat Fax 2100; Awareness Technology, Los Angeles, CA, USA) at 405 nm wavelength are expressed as fold changes of caspase-3 activity in treated cells divided by the caspase-3 activity of adjacent untreated cells. mRNA expression Cells at a density of 12×104 cells/well were seeded in 96-well plates and then they were incubated without or with silymarin (IC50) at different times (0 [control], 4, 8, 12, 24, and 48 hr) and RNAs were extracted by RNX (SinaClon, Tehran, Iran). After synthesis of cDNAs by reverse transcription kit (TAKARA Bio Inc. Dalian, China) based on the extracted RNAs, the mRNA expression levels of TLR8 gene were evaluated by real-time PCR (Applied Biosystems, Foster City, CA, USA) using specific primers for both target genes [TLR8 mRNA] and GAPDH used as housekeeping gene (Table 1).
Table 1

Sequences of the primer pairs for TLR8 and reference gene

Target nameAmplicon lengthPrimer sequence forwardPrimer sequence reverse
TLR8 184 bp5ʹCAGAGCATCAACCAAAGCAA3ʹ5ʹGCTGCCGTAGCCTGAAATA3ʹ
GAPDH 150 bp5ʹGAGCCACATCGCTCAGACAC3ʹ5ʹCATGTAGTTGAGGTCAATGAAGG3ʹ
Statistical analysis All data were analyzed by IBM SPSS statistics version 22 (SPSS Inc., Chicago, IL, USA). To compare data, One-way analysis of variance (ANOVA) with the Dunnett’s test was used. A p-value of less than 0.05 was considered statistically different. Sequences of the primer pairs for TLR8 and reference gene

Results

Anti-proliferative effect of silymarin on human Ramos cancer cells The effect of silymarin on the Ramos cell line was examined. The cells in different concentrations of silymarin and at different times were exposed, the cell line viability was examined by using an MTT assay. The most significant inhibitory effects of silymarin in Ramos cancer cell line were 69±4.5%, 50±2.1% and 19±1.5 at concentration 100 µg/ml after treatment for 24, 48 and 72 hr, respectively. Concentration of 100 μg/ml at time 48hr revealed decreased growth by 50% in Ramos cancer cell line (p<0.01). Figure 1 shows the results of MTT in cancer cell line.
Figure 1

Effects of silymarin on suppression of Ramos cell growth. Cells were exposed for 24, 48 and 72 hr to different concentrations of silymarin, and cell proliferation was examined by MTT assay. This compound decreased cell proliferation in time- and dose-dependent fashions. **p<0.01 show significant differences compared to control cells

Effects of silymarin on suppression of Ramos cell growth. Cells were exposed for 24, 48 and 72 hr to different concentrations of silymarin, and cell proliferation was examined by MTT assay. This compound decreased cell proliferation in time- and dose-dependent fashions. **p<0.01 show significant differences compared to control cells Detection of apoptosis by flow cytometry To study whether silymarin induced apoptosis in the cell line, both treated and untreated Ramos cells were double-stained with annexin V-FITC/PI; then, cells were analyses by flow cytometry. The obtained results showed a significant increase in the percentage of both early and late apoptosis in a concentration-dependent manner (p<0.05 to p<0.01); Figures 2 and 3).
Figure 2

Flow cytometric evaluation of apoptosis in Ramos cells after 48 hr treatment with silymarin by staining with annexin-V and propidium iodide (PI). Both early and late apoptosis were increased in cells in comparison with untreated cell line. *p<0.05 and **p<0.01 show significant differences compared to control cells

Figure 3

Silymarin induced apoptosis in Ramos cell line. Cells were treated with different concentrations of silymarin (0 [control], 25, 50, and 100 µg/ml). After 48 hr of treatment, Ramos cells were stained with annexin/PI. All measurements done by flow-cytometry were performed independently in triplicates per experimental point, and representative results are shown

Flow cytometric evaluation of apoptosis in Ramos cells after 48 hr treatment with silymarin by staining with annexin-V and propidium iodide (PI). Both early and late apoptosis were increased in cells in comparison with untreated cell line. *p<0.05 and **p<0.01 show significant differences compared to control cells Caspase-3 activation assay To examine the role of caspase-3 in silymarin-induced apoptosis, the activity of caspase-3 was measured. Treatment of Ramos cancer cells with 100 µg/ml of silymarin markedly increased the activity of caspase-3 in a time-dependent manner (p<0.05 to p<0.01). Figure 4 shows Colorimetric assay of caspase-3 activity in cancer cell line.
Figure 4

Colorimetric assay of caspase-3 activity after treatment with silymarin 100 μg/ml. Activity of caspase-3 was enhanced in Ramos cancer cells. *p< 0.05 and **p<0.01 show significant differences compared to control cells

RT- PCR assay The expression levels of TLR8 were examined by real-time RT-PCR using SYBR Green in Ramos cancer cells. As shown in Figure 5, TLR8 mRNAs in cancer cell line was detected, and also the effects of silymarin on expression of the TLR8 gene was performed at different times (o[control], 4, 8, 12, 24 and 48 hr). The results show that TLR8 gene expression level decreased significantly in Ramos cancer cell line in the presence of silymarin (100µg/ml) in comparison to untreated cells (p<0.01).
Figure 5

Real-time RT -PCR analysis of TLR8 mRNA expression on human Ramos cancer cell line following silymarin (100 μg/ml) treatment in different times. **p<0.01 show significant differences compared to control cells

Silymarin induced apoptosis in Ramos cell line. Cells were treated with different concentrations of silymarin (0 [control], 25, 50, and 100 µg/ml). After 48 hr of treatment, Ramos cells were stained with annexin/PI. All measurements done by flow-cytometry were performed independently in triplicates per experimental point, and representative results are shown Colorimetric assay of caspase-3 activity after treatment with silymarin 100 μg/ml. Activity of caspase-3 was enhanced in Ramos cancer cells. *p< 0.05 and **p<0.01 show significant differences compared to control cells Real-time RT -PCR analysis of TLR8 mRNA expression on human Ramos cancer cell line following silymarin (100 μg/ml) treatment in different times. **p<0.01 show significant differences compared to control cells

Discussion

The current study focused on the effect of silymarin on TLR8 expression inhibition, cell viability, and induction of apoptosis in Ramos cancer cell line. The results of the current study showed a significant positive correlation between Ramos cancer cell line with silymarin and reduced expression of TLR8 and apoptosis in a concentration- and time-dependent fashion; silymarin also increased caspase-3 activity. Silymarin is composed of several flavonolignans including silybin A, silybin B, isosilybin, and silychristin. The main components of Silybum marianum such as polyphenolic fraction and silybin have significant antioxidant and cytoprotective effects (Křen and Walterova, 2005 ▶; Pradhan and Girish, 2006 ▶). Previous investigations showed that silymarin induces apoptosis in different cell lines such as HepG2 (Ramakrishnan et al., 2009 ▶), PC-3 (Deep et al., 2008 ▶), C33A, HeLa (Huang et al., 2005 ▶; Yu et al., 2012 ▶), and FaDu cell line, as well as oral cancer (Su et al., 2013 ▶). So far, extensive studies demonstrated that herbal compounds could inhibit inflammatory responses by the modulation of TLRs (Romano et al., 2013 ▶) and finally, induce apoptosis (Marx, 2004 ▶; Kelly et al., 2006 ▶). TLRs play a pivotal role to maintain tissue homeostasis by regulating tissue repair and inflammatory responses to injuries (Chuang and Ulevitch, 2000 ▶). Through activating the NF-kB pathway, TLRs play an essential role in inflammatory processes (Grimmig et al., 2015 ▶). Thus, targeting TLRs should be considered a potential strategy to treat cancers (Grimmig et al., 2015 ▶). TLR8 gene is mapped to chromosome Xp22 (Wang et al., 2008 ▶). Recently, overexpression of TLR8 was reported in a variety of tumor cells (Pradere et al., 2014; Rivlin et al., 2011) such as pancreatic cancer (Grimm et al., 2010 ▶). Previous studies demonstrated that the expression levels of TLR7/TLR8 genes were associated with colorectal cancer (tumor progression) and that survival rate was lower among patients with TLR7/TLR8 overexpression (Grimm et al., 2010 ▶). Mutations in the P53 gene are observed in almost 10% of hematopoietic malignancies (Brosh and Rotter, 2009 ▶). Also, P53-mutant cells show different results on growth inhibition as compared with wild-type P53 (Farrell et al., 1991 ▶). On the other hand, studies revealed that binding to human papillomavirus 16 E6 oncoproteins leads to rapid proteolytic degradation of P53 and induces the ubiquitin pathway in cells. However, Ramos cells are resistant to E6-directed degradation and are Epstein-Barr virus-negative (EBV-negative). Also, these cells express high levels of TLR8 and could be used as a suitable model to investigate the functions and mechanisms of TLRs in in vitro studies (Vousden et al., 1993 ▶). However, mutant P53 downstream signaling pathway is not clear because there are different P53-mutant variants (Rivlin et al., 2011 ▶). TLRs ligand binding induces myeloid differentiation primary response 88 (MYD88) adapter molecules, which leads to the activation of mitogen-activated protein kinase (MAPK) signaling pathway, and in turn, inhibition of apoptosis via expression of anti-apoptotic proteins such as Bcl-2 (Grimm et al., 2010 ▶; Bowie and O'neill, 2000 ▶). In the current study, it was observed that different concentrations (25–100 µg/ml) of silymarin induce apoptosis in Ramos cell line (P53-mutant).A study revealed that silymarin induces apoptosis and causes drug sensitivity in anaplastic lymphoma cells (Molavi et al., 2016 ▶). It is also reported that silymarin induces apoptosis in silymarin-treated K562 cells (Faezizadeh et al., 2012 ▶). Caspase-3 plays a vital role to induce apoptosis (Hussein, 2005 ▶). The activation of caspase-3 from its zymogen form (procaspase-3) is probably triggered through two mechanisms including the release of cytochrome c (intracellular way) and activation of caspase-8 (extracellular way) (Wang et al., 1999 ▶). Induction of apoptosis is considered an anti-cancer mechanism for many bio-active agents. Epimedium contains Icariin, the hydrolytic product of which exhibits induction of cell apoptosis by activation of caspases in human Raji Burkitt lymphoma and P3HR-1 cell line (Li et al., 2014 ▶). The application of plant compounds, particularly silymarin, as chemotherapeutic compounds for cancers is recommended since they do not impose any adverse effects on normal lymphocytes (Agarwal et al., 2006 ▶; Shanmugam et al., 2011 ▶). Therefore, targeting TLRs could be a promising strategy to expand anticancer agents. In summary, the current study data indicated downregulation of TLR8 expression after silymarin treatment in Ramos cancer cells. It was also discovered that silymarin effectively suppressed cell proliferation, induced apoptosis in Ramos cancer cells in a concentration-dependent fashion, and caused activation of caspase-3. Ultimately, according to the obtained results, TLR8 signaling may be a potential target for Burkitt lymphoma therapy.
  39 in total

Review 1.  The interleukin-1 receptor/Toll-like receptor superfamily: signal generators for pro-inflammatory interleukins and microbial products.

Authors:  A Bowie; L A O'Neill
Journal:  J Leukoc Biol       Date:  2000-04       Impact factor: 4.962

2.  A sarcoma involving the jaws in African children.

Authors:  D BURKITT
Journal:  Br J Surg       Date:  1958-11       Impact factor: 6.939

Review 3.  Apoptosis in the ovary: molecular mechanisms.

Authors:  Mahmoud R Hussein
Journal:  Hum Reprod Update       Date:  2005-02-10       Impact factor: 15.610

4.  Silymarin inhibits cervical cancer cell through an increase of phosphatase and tensin homolog.

Authors:  Hann-Chin Yu; Li-Jen Chen; Kai-Chun Cheng; Ying-Xiao Li; Ching-Hua Yeh; Juei-Tang Cheng
Journal:  Phytother Res       Date:  2011-10-20       Impact factor: 5.878

Review 5.  Toll-like receptors and their crosstalk with other innate receptors in infection and immunity.

Authors:  Taro Kawai; Shizuo Akira
Journal:  Immunity       Date:  2011-05-27       Impact factor: 31.745

6.  Increase of phosphatase and tensin homolog by silymarin to inhibit human pharynx squamous cancer.

Authors:  Chin-Hui Su; Li-Jen Chen; Jyh Fei Liao; Juei-Tang Cheng
Journal:  J Med Food       Date:  2013-08-03       Impact factor: 2.786

7.  Cancer research. Inflammation and cancer: the link grows stronger.

Authors:  Jean Marx
Journal:  Science       Date:  2004-11-05       Impact factor: 47.728

Review 8.  When mutants gain new powers: news from the mutant p53 field.

Authors:  Ran Brosh; Varda Rotter
Journal:  Nat Rev Cancer       Date:  2009-08-20       Impact factor: 60.716

9.  TLR7 and TLR8 expression increases tumor cell proliferation and promotes chemoresistance in human pancreatic cancer.

Authors:  Tanja Grimmig; Niels Matthes; Katharina Hoeland; Sudipta Tripathi; Anil Chandraker; Martin Grimm; Romana Moench; Eva-Maria Moll; Helmut Friess; Igor Tsaur; Roman A Blaheta; Cristoph T Germer; Ana Maria Waaga-Gasser; Martin Gasser
Journal:  Int J Oncol       Date:  2015-07-02       Impact factor: 5.650

10.  Cytotoxic effect of icaritin and its mechanisms in inducing apoptosis in human burkitt lymphoma cell line.

Authors:  Zi-Jian Li; Can Yao; Su-Fang Liu; Long Chen; Ya-Ming Xi; Wen Zhang; Guang-Sen Zhang
Journal:  Biomed Res Int       Date:  2014-05-07       Impact factor: 3.411

View more
  2 in total

Review 1.  Role of Silymarin in Cancer Treatment: Facts, Hypotheses, and Questions.

Authors:  Tomas Koltai; Larry Fliegel
Journal:  J Evid Based Integr Med       Date:  2022 Jan-Dec

Review 2.  The favorable impacts of silibinin polyphenols as adjunctive therapy in reducing the complications of COVID-19: A review of research evidence and underlying mechanisms.

Authors:  Vali Musazadeh; Arash Karimi; Nasim Bagheri; Jaber Jafarzadeh; Sarvin Sanaie; Mahdi Vajdi; Mozhde Karimi; Hamid Reza Niazkar
Journal:  Biomed Pharmacother       Date:  2022-08-22       Impact factor: 7.419

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.