| Literature DB >> 32256726 |
Hongzhong Ma1, Juan Du1, Xiaoli Feng2, Yingjun Zhang3, Haihuan Wang1, Suchun Ding1, Aijie Huang1, Jiahai Ma1.
Abstract
Influence of rosiglitazone on the myocardial apoptosis in rats with acute myocardial infarction (AMI) via the Toll-like receptor 4 (TLR4)/nuclear factor-κB (NF-κB) signaling pathway was explored. A total of 30 healthy male Sprague-Dawley (SD) rats were randomly divided into group A (Sham group, n=10), group B (AMI model group, n=10) and group C (AMI model + rosiglitazone group, n=10) using a random number table. It was observed through H&E staining that group A had myocardial cells with normal morphology and infiltration of few inflammatory factors, while group B had swollen myocardial cells with disorderly and irregular morphology, large and dark-colored nuclei, infiltration of massive inflammatory factors, large amounts of fibrous tissue hyperplasia in the intercellular space, disorderly arranged, thickened and lengthened myocardial fibers with widened gaps. Moreover, group C exhibited infiltration of fewer inflammatory factors and more normal myocardial tissue structure compared with group B. According to the sirius-red staining results, group A had normally arranged myocardial cells with a small amount of collagen hyperplasia, while group B had collagen interstitial hyperplasia and higher content of myocardial collagen than group A. Compared with that in group B, the myocardial collagen deposit was substantially reduced in group C. TUNEL staining results showed that the apoptosis rate of rat myocardial cells in group B was obviously higher than that in group A (40.37 vs. 5.23%), and it was notably lower in group C than that in group B (24.82 vs. 40.37%). According to the western blot results, the protein expression levels of the inflammatory factors TLR-4 and NF-κB in rat myocardial tissues were notably raised in group B compared with those in group A, and they were evidently lower in group C than those in group B. Rosiglitazone inhibits the TLR4/NF-κB signaling pathway to produce a myocardioprotective effect. Copyright: © Ma et al.Entities:
Keywords: TLR4/NF-κB; acute myocardial infarction; rosiglitazone
Year: 2020 PMID: 32256726 PMCID: PMC7086202 DOI: 10.3892/etm.2020.8479
Source DB: PubMed Journal: Exp Ther Med ISSN: 1792-0981 Impact factor: 2.447
Primer sequences.
| Name | Primer sequences (C 5'-3') |
|---|---|
| HMGB1 | F: AAGAAGTGCTCAGAGAGGTGGAAG |
| R: TAGTTTCTTCGCAACATCACCA | |
| TNF-α | F: TGAACTTCGGGGTGATCGGT |
| R: GCTACGGGCTTGTCACTCG | |
| IL-6 | F: ATTGTATGAACAGCGATGATGC |
| R: AGAAACGGAACTCCAGAAGACC | |
| GAPDH | F: CTTCCGTGTTCCTACCCC |
| R: CCCAGGATGCCCTTTAGTG |
HMGB1, high-mobility group box 1; TNF-α, tumor necrosis factor-α; IL-6, intreleukin-6; F, forward; R, reverse.
Figure 1.Rosiglitazone notably improves the morphology of rat myocardial tissues.
Figure 2.Content of collagen in rat myocardial tissues in all groups. (A) Staining images of rat myocardial collagen in each group. (B) Relative expression level of myocardial collagen of each group of rats. aP<0.05 vs. group A; bP<0.05 vs. group B.
Figure 3.Apoptosis of rat myocardial cells in each group. (A) Comparison of apoptosis level of rat myocardial cells among all groups. (B) Apoptosis rate of rat myocardial cells in each group. aP<0.05 vs. group A; bP<0.05 vs. group B.
Figure 4.mRNA expression of HMGB1, TNF-α and IL-6 in rat myocardial tissues in each group. aP<0.05 vs. group A; bP<0.05 vs. group B. HMGB1, high-mobility group box 1; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6.
Figure 5.Protein expression of TLR-4 and NF-κB in rat myocardial tissues in each group. (A) Protein images of TLR-4 and NF-κB in each group of rats. (B) Relative protein expression levels of TLR-4 and NF-κB in each group of rats. aP<0.05 vs. group A; bP<0.05 vs. group B. TLR-4, Toll-like receptor 4; NF-κB, nuclear factor-κB.