Literature DB >> 32241866

Complete Chromosomal Sequences of Two Borrelia miyamotoi Samples Obtained from Ixodes ricinus Eggs in Czechia.

Jan Janeček1, Markéta Nováková2, Jan Oppelt3, Petra Pospíšilová4, Anita Cunha5, Ana Catarina Silva5, Li Dantong6, David Šmajs2.   

Abstract

Here, we present complete chromosome sequences of Borrelia miyamotoi samples CZ-F1E and CZ-F190E, which were obtained from Ixodes ricinus eggs from Czechia. The chromosome sequences, assembled from Illumina and Sanger sequencing data, had average coverage values of 647× and 3,216×, respectively. They belong to the European genotype, distinct from the Asian and American strains.
Copyright © 2020 Janeček et al.

Entities:  

Year:  2020        PMID: 32241866      PMCID: PMC7118192          DOI: 10.1128/MRA.01504-19

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

The tick-borne human pathogen Borrelia miyamotoi is distributed in the Holarctic realm (1). Characterization of B. miyamotoi genome sequences, especially those from Europe, is needed since the genome sequences of only two strains from the Netherlands have recently been published (2) and several whole-genome sequences from North America and Asia have been studied (3–7). In total, 416 engorged females of Ixodes ricinus were manually collected from dogs and cats by their owners in Czechia in 2018 to 2019. Ticks were stored separately in labeled tubes at 26°C and 90% relative humidity. Egg clusters were collected from 364 females promptly after oviposition and were stored in cryovials at −80°C. DNA was extracted from ∼100 eggs per cluster with the DNeasy blood and tissue kit (Qiagen). The presence of B. miyamotoi DNA in 6 of 364 samples was confirmed by amplification of a partial sequence of the glpQ gene (8). The ratio of B. miyamotoi to I. ricinus DNA copies in the six B. miyamotoi-positive samples was determined by nested PCR detection of the glpQ gene and I. ricinus ITS2 spacer (Table 1) in 10-fold serially diluted DNA samples (from nondiluted to 10−6 diluted). PCR products from the second amplification step were visualized by 1.5% agarose gel electrophoresis. Two samples, designated CZ-F1E and CZ-F190E, with the highest B. miyamotoi/I. ricinus DNA ratios (i.e., 2:1 and 20:1, respectively) were subjected to whole-genome sequencing. DNA libraries were prepared using the NEBNext Ultra DNA library preparation kit (Illumina) and sequenced on the Illumina platform in paired-end mode with a read length of 150 bp (Novogene, China).
TABLE 1

Primer pairs used for PCR amplification

OrganismTargeta Primer nameNucleotide sequence (5′ to 3′)Amplified fragment (bp)Annealing temp (°C)Reference or source
Ixodes ricinusITS2ITS2-outFCTCTTTGAACGCACATTGCG∼590b 48This study
ITS2-outRAGACTGACGGAAGGCTACGAThis study
ITS2-FCTGTGTGAGGGTCGGATCAT∼315b 60This study
ITS2-RCGTTTCACATCTCCAACGCAThis study
Borrelia miyamotoiglpQQ1CACCATTGATCATAGCTCACAG633488
Q2CTGTTGGTGCTTCATTCCAGTC8
Q3GCTAGTGGGTATCTTCCAGAAC399488
Q4CTTGTTGTTTATGCCAGAAGGGT8
Gap 1Gap1-2 FACCAAGATTCCTCAATTGCTC75858–50This study
Gap1-2 RGATGAAAGCTACTGCTTCAATTGAThis study
Gap 2Gap2-2 FCAATCTTGTCGTTCAGTGTATC87858–50This study
Gap2-2 RGAATATAAAACCCTAGCAACAAGCThis study
Gap 3Gap3-1 FCAAGAGTTGTTAGCAGGACTTCA93258–50This study
Gap3-1 RAGCAGCAGAACTAATTGTAAThis study
Gap 4Gap4-2 FAGAGAAGGTAGTTGGGGCT47058–50This study
Gap4-2 RGTAGCTTTCTCAAGTTGCTThis study

Amplification steps for ITS2 and glpQ were as follows: 94°C for 1 min; 40 cycles of 94°C for 30 s, with annealing at 48°C (or 60°C) for 30 s and 72°C for 1 min 45 s; and 72°C for 7 min. For gaps 1 to 4, conditions were as follows: 95°C for 3 min; 9 cycles of a touchdown step with denaturation at 94°C for 30 s, with the annealing temperature reduced from 58°C to 50°C, and extension at 72°C for 1 min, followed by 35 cycles of denaturation at 94°C and annealing at 50°C, both for 30 s, and extension at 72°C for 1 min; and a final extension step at 72°C for 5 min.

The length varies slightly among tick individuals.

Primer pairs used for PCR amplification Amplification steps for ITS2 and glpQ were as follows: 94°C for 1 min; 40 cycles of 94°C for 30 s, with annealing at 48°C (or 60°C) for 30 s and 72°C for 1 min 45 s; and 72°C for 7 min. For gaps 1 to 4, conditions were as follows: 95°C for 3 min; 9 cycles of a touchdown step with denaturation at 94°C for 30 s, with the annealing temperature reduced from 58°C to 50°C, and extension at 72°C for 1 min, followed by 35 cycles of denaturation at 94°C and annealing at 50°C, both for 30 s, and extension at 72°C for 1 min; and a final extension step at 72°C for 5 min. The length varies slightly among tick individuals. The 347,837,033 and 358,142,224 raw reads for CZ-F1E and CZ-F190E, respectively, were adapter and quality (Phred score of <15) trimmed by Cutadapt (v1.15) (9). The preprocessed reads were filtered by mapping to the I. ricinus sequence (GenBank accession number GCA_000973045.2) using BBMap (v37.25), which yielded 268,026,168 and 299,377,980 reads (77.1% and 83.6% of the raw counts) for CZ-F1E and CZ-F190E, respectively (10). The quality of the reads was continuously assessed by FastQC (v0.1.15) (11). The host clean reads were mapped to prokaryotic genomes with Kraken2 (v2.0.7-beta) (12), and the proportions of reads assigned to B. miyamotoi reached 2.5% and 14.4% for CZ-F1E and CZ-F190E, respectively. The fastq sequences were mapped to the B. miyamotoi representative genome LB-2001 assembly using BWA MEM (v0.7.15) (13); mapped reads were extracted using SAMtools (v1.4) and de novo assembled by SPAdes (v3.13.0) (14, 15). For each sample, the five longest scaffolds were manually selected from the assembly graph using Bandage (v0.8.1) (16). The average coverage values were 647× and 3,216× for CZ-F1E and CZ-F190E, respectively. Gaps between the scaffolds were filled by PCR amplification using custom primers (Table 1) and Sanger sequencing. Annotation was performed using the Prokaryotic Genome Annotation Pipeline (17). The complete chromosome sequences of 904,129 bp and 904,095 bp for CZ-F1E and CZ-F190E, respectively, with GC contents of 28.7%, contained 810 and 807 predicted protein-coding sequences, respectively, 3 rRNAs, 31 tRNAs, and 28 and 23 pseudogenes, respectively. The differences between the two genomes included 51 single-nucleotide variants, of which 35 nucleotide differences were located in coding regions, resulting in 12 amino acid differences in the predicted proteomes. Future studies characterizing plasmid contents are expected to bring new insights into the genetic diversity of this emerging pathogen.

Data availability.

The complete chromosome sequences of B. miyamotoi CZ-F1E and CZ-F190E samples have been deposited in the GenBank/DDBJ/EMBL database under accession numbers CP046389 and CP046388, respectively. The corresponding BioProject accession number is PRJNA591086, and the BioSample accession numbers are SAMN13351967 and SAMN13351968. The GenBank accession numbers for sequences obtained by Sanger sequencing are MN990105, MN990106, MN990107, MN990108, MN990109, MN990110, MN990111, and MN990112.
  12 in total

1.  SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing.

Authors:  Anton Bankevich; Sergey Nurk; Dmitry Antipov; Alexey A Gurevich; Mikhail Dvorkin; Alexander S Kulikov; Valery M Lesin; Sergey I Nikolenko; Son Pham; Andrey D Prjibelski; Alexey V Pyshkin; Alexander V Sirotkin; Nikolay Vyahhi; Glenn Tesler; Max A Alekseyev; Pavel A Pevzner
Journal:  J Comput Biol       Date:  2012-04-16       Impact factor: 1.479

Review 2.  Borrelia miyamotoi infection in nature and in humans.

Authors:  P J Krause; D Fish; S Narasimhan; A G Barbour
Journal:  Clin Microbiol Infect       Date:  2015-02-18       Impact factor: 8.067

3.  Bandage: interactive visualization of de novo genome assemblies.

Authors:  Ryan R Wick; Mark B Schultz; Justin Zobel; Kathryn E Holt
Journal:  Bioinformatics       Date:  2015-06-22       Impact factor: 6.937

4.  Chromosome Sequence of Borrelia miyamotoi, an Uncultivable Tick-Borne Agent of Human Infection.

Authors:  Fong Hue; Arash Ghalyanchi Langeroudi; Alan G Barbour
Journal:  Genome Announc       Date:  2013-09-12

5.  Multiple and Diverse vsp and vlp Sequences in Borrelia miyamotoi, a Hard Tick-Borne Zoonotic Pathogen.

Authors:  Alan G Barbour
Journal:  PLoS One       Date:  2016-01-19       Impact factor: 3.240

6.  Toward a Complete North American Borrelia miyamotoi Genome.

Authors:  Luke C Kingry; Adam Replogle; Dhwani Batra; Lori A Rowe; Christopher Sexton; Marc Dolan; Neeta Connally; Jeannine M Petersen; Martin E Schriefer
Journal:  Genome Announc       Date:  2017-02-02

7.  Whole-Genome Sequencing of Six Borrelia miyamotoi Clinical Strains Isolated in Russia.

Authors:  Konstantin V Kuleshov; Joris Koetsveld; Irina A Goptar; Mikhail L Markelov; Nadezhda M Kolyasnikova; Denis S Sarksyan; Marina G Toporkova; Nina P Kirdyashkina; German A Shipulin; Joppe W Hovius; Alexander E Platonov
Journal:  Genome Announc       Date:  2018-01-04

8.  Chromosome and Large Linear Plasmid Sequences of a Borrelia miyamotoi Strain Isolated from Ixodes pacificus Ticks from California.

Authors:  Luke C Kingry; Adam Replogle; Marc Dolan; Christopher Sexton; Kerry A Padgett; Martin E Schriefer
Journal:  Genome Announc       Date:  2017-09-14

9.  NCBI prokaryotic genome annotation pipeline.

Authors:  Tatiana Tatusova; Michael DiCuccio; Azat Badretdin; Vyacheslav Chetvernin; Eric P Nawrocki; Leonid Zaslavsky; Alexandre Lomsadze; Kim D Pruitt; Mark Borodovsky; James Ostell
Journal:  Nucleic Acids Res       Date:  2016-06-24       Impact factor: 16.971

10.  Draft Whole-Genome Sequences of Two Western European Borrelia miyamotoi Isolates.

Authors:  Konstantin V Kuleshov; Dieuwertje Hoornstra; Hein Sprong; Alexander E Platonov; Joppe W Hovius
Journal:  Microbiol Resour Announc       Date:  2019-12-12
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.