Regulatory T cells (Treg) play essential roles in maintaining immune homeostasis. Resident Treg in visceral adipose tissue (VAT-Treg) decrease in male obese mice, which leads to the development of obesity-associated chronic inflammations and insulin resistance. Although gender differences in immune responses have been reported, the effects of the difference in metabolic environment on VAT-Treg are unclear. We investigated the localization of VAT-Treg in female mice in comparison with that in male mice. On a high-fat diet (HFD), VAT-Treg decreased in male mice but increased in female mice. The increase was abolished in ovariectomized and HFD-fed mice, but was restored by estrogen supplementation. The IL33 receptor ST2, which is important for the localization and maturation of VAT-Treg in males, was reduced in CD4+CD25+ T cells isolated from gonadal fat of obese mice of both genders, suggesting that a different system exists for VAT-Treg localization in females. Extensive analysis of chemokine expression in gonadal fat and adipose CD4+CD25+T cells revealed several chemokine signals related to female-specific VAT-Treg accumulation such as CCL24, CCR6, and CXCR3. Taken together, the current study demonstrated sexual dimorphism in VAT-Treg localization in obese mice. Estrogen may attenuate obesity-associated chronic inflammation partly through altering chemokine-related VAT-Treg localization in females.
Regulatory T cells (Treg) play essential roles in maintaining immune homeostasis. Resident Treg in visceral adipose tissue (VAT-Treg) decrease in male obesemice, which leads to the development of obesity-associated chronic inflammations and insulin resistance. Although gender differences in immune responses have been reported, the effects of the difference in metabolic environment on VAT-Treg are unclear. We investigated the localization of VAT-Treg in female mice in comparison with that in male mice. On a high-fat diet (HFD), VAT-Treg decreased in male mice but increased in female mice. The increase was abolished in ovariectomized and HFD-fed mice, but was restored by estrogen supplementation. The IL33 receptor ST2, which is important for the localization and maturation of VAT-Treg in males, was reduced in CD4+CD25+ T cells isolated from gonadal fat of obesemice of both genders, suggesting that a different system exists for VAT-Treg localization in females. Extensive analysis of chemokine expression in gonadal fat and adiposeCD4+CD25+T cells revealed several chemokine signals related to female-specific VAT-Treg accumulation such as CCL24, CCR6, and CXCR3. Taken together, the current study demonstrated sexual dimorphism in VAT-Treg localization in obesemice. Estrogen may attenuate obesity-associated chronic inflammation partly through altering chemokine-related VAT-Treg localization in females.
Numerous biological phenomena exhibit distinctive traits due to sexual dimorphism. Immune and metabolic systems are representative because they are markedly affected by sex hormones [1, 2]. As systemic metabolism is regulated by immune systems, their coordinated association has been explored in immuno-metabolism studies. Obesity-associated infiltration of immune cells promotes chronic inflammation, especially in visceral adipose tissue, and exacerbates insulin resistance and glucose metabolism [3, 4]. However, our understanding of the sexual dimorphism in immune cells is currently limited regarding the development of obesity-associated chronic inflammation.Regulatory T cells (Treg) are a specific subpopulation of T cells that can suppress inappropriate or extreme immune responses such as autoimmune reactions [5]. Increased estrogen plays a significant role in establishing maternal-fetal immune tolerance during pregnancy by promoting the differentiation of Treg from naïve T cells [6]. In contrast, the number of Treg decreases in the visceral adipose tissue of male obesemice [7, 8]. As Treg can alleviate obesity-associated chronic inflammation, their reduction further exacerbates chronic inflammation in obesity. Indeed, increased adipose inflammation was observed in Treg-depleted mice, whereas glucose metabolism was ameliorated in obesemice after adopted transfer of Treg [7, 9]. Although several underlying mechanisms of reduced adiposeTreg in obesity have been examined, they were investigated only in males. Males are more prone to metabolic abnormalities than females upon overnutrition due to the absence of estrogen, a cardinal female hormone [10]. However, the impact of obesity on adiposeTreg in females and the effects of estrogen on their regulation are unknown.Tissue resident Treg exhibit distinct gene expression profiles that markedly affect their immune properties. Visceral adipose tissue-localized Treg (VAT-Treg) are one of most well-characterized tissue-resident Treg subsets that distinctively express peroxisome proliferator activated receptor γ (PPARγ) and related genes [11]. In addition, VAT-Treg have been demonstrated to have unique chemokine expression profiles [7, 11], suggesting the existence of unknown chemokine signals related to VAT-Treg accumulation. Indeed, tissue-specific chemokine signals have been identified for the regulation of tissue Treg distribution in several tissues [12-14]. However, the regulatory mechanism of Treg trafficking in adipose tissue during obesity development is unclear, especially in females.VAT-Treg play a significant role in adipose chronic inflammation and systemic glucose metabolism in obesity. In the current study, we aimed to clarify the relationship among glucose metabolism, chronic inflammation, and Treg distribution in the adipose tissue of lean and obesemice from the viewpoint of sex difference. We found an increase in VAT-Treg in obese female mice. Therefore, we concurrently prepared ovariectomized mice and estrogen-supplemented mice fed a high-fat diet (HFD) to examine the impact of estrogen on obese phenotypes and Treg distribution. Moreover, the expression of chemokines and their receptors suspected to function in tissue-trafficking of Treg was examined by analyzing isolated CD4+CD25+ T cells from VAT of both genders. Thus, the current study demonstrated the sexual dimorphism and impact of estrogen on VAT-Treg accumulation during obesity development, and the suggested chemokine signals as the underlying mechanism.
Materials and methods
Animals and experimental groups
Eight-week-old male and female C57BL/6J mice were purchased from Japan SLC (Shizuoka, Japan). They were divided into six experimental groups: 1) male mice fed normal diet (Rodent Diet 20 5053; LabDiet, St. Louis, MO, USA) (M-Chow), 2) male mice fed 60 kcal% high-fat diet (D12492; Research Diets, New Brunswick, NJ, USA) (M-HFD), 3) female mice fed normal diet (F-Chow), 4) female mice fed 60 kcal% HFD (F-HFD), 5) ovariectomized female mice fed 60 kcal% HFD (OVX-HFD), and 6) OVX-HFD mice receiving estradiol (OVX-HFD+E2). Ovariectomy and sham-operation were performed under anesthesia with pentobarbital sodium. Mice were housed under a 12:12-h light-dark cycle (lights on at 07:00) in a temperature-controlled colony room, and were provided food and water ad libitum. Mice were fasted overnight and euthanized by cervical dislocation for analysis. All experimental procedures used in this study were approved by the Committee of Animal Experiments at University of Toyama (A2013PHA-15 and A2016PHA-14).
Exogenous estradiol treatment
17β-estradiol (Sigma-Aldrich, Darmstadt, Germany) or vehicle was administered via subcutaneously injection (1.5 μg/mice in sesame oil) every 4 days by imitating the estrus cycle of mice, referring to a previous study on rats with minor modification [15]. The dose of estrogen was determined based on the body weight transition after the treatment.
Analysis of body composition
Body fat composition was analyzed by magnetic resonance imaging (MRI) under anesthesia in mice at 12 weeks after the initiation of HFD feeding, as described previously [16]. Series of T1-weighted axial slices were analyzed using ImageJ (NIH, Bethesda, MD, USA).
Analysis of energy metabolism
Oxygen consumption (VO2), the production of carbon dioxide (VCO2), and locomotor activity in mice were measured in metabolic chambers (MK-5000RQ, Muromachi Kikai, Tokyo, Japan) with free access to food and water, as described previously [16].
Glucose and insulin tolerance test
The glucose tolerance test (GTT) and insulin tolerance test (ITT) were conducted on mice 12–13 or 15 weeks after the initiation of HFD feeding. For the GTT, mice fasted for 6 h were injected intraperitoneally with glucose (2g/kg body weight). For the ITT, mice fasted for 2 h were injected intraperitoneally with insulin (0.75 U/kg body weight) [17, 18].
Isolation of stromal-vascular fraction
Gonadal white adipose tissues (Wg) of mice were minced and digested with collagenase (Wako Pure Chemical Industries Ltd, Osaka, Japan) at 37°C for 60 min. Samples were passed through mesh, centrifuged at 220 xg for 15 min, and the stromal-vascular fraction (SVF) was isolated as a pellet. Pellets were rinsed twice and incubated in lysing buffer (BD Biosciences) for 15 min, and the SVF was used for flow cytometry.
Isolation of splenocytes
Spleens were grinded with slide glasses. Samples were passed through mesh, centrifuged at 220 xg for 15 min, and pellets were incubated in lysing buffer for 1 min. Then, splenocytes were subjected to flow cytometry analysis.
Flow cytometry analysis
SVF cells and splenocytes were incubated with purified rat anti-mouseCD16/CD32 (BD Biosciences, San Jose, CA, USA) for 15 min, and then stained with antibodies or the matching isotype controls. For the analysis of 7AAD-CD45+CD4+CD8-CD25+FOXP3+ Tregs, SVF cells and splenocytes were stained with PE-Cy7 anti-mouseCD45 antibody (eBioscience), FITCrat anti-mouseCD4 antibody (BD Biosciences), APC-Cy7 anti-mouseCD8a antibody (BioLegend), and PE anti-mouseCD25 antibody (BioLegend) for 40 min. Cells were rinsed and incubated with 7-amino-actinomycin D (BD Biosciences) for 15 min. Cells were rinsed twice and fixed in 4% paraformaldehyde (Wako Pure Chemical Industries Ltd) for 15 min. After washing, cells were kept at 4°C overnight. The next day, cells were permeabilized with 0.1% polyoxyethylene sorbitan monolaurate (Wako Pure Chemical Industries Ltd) for 20 min. After washing, cells were incubated with purified rat anti-mouseCD16/CD32 for 15 min and stained with APC anti-mouse/ratFoxp3 (eBioscience) for 60 min. Then, the numbers of Treg were analyzed by FACSAria II (BD Biosciences). Data were analyzed by FACS Diva 6.1.2 (BD Bioscience) or FCS Express (De Novo Software). The gating strategy of Treg cells are shown in S1 Fig. For the isolation of 7AAD-CD45+CD4+CD8-CD25+ cells (CD4+CD25+T cells), SVF cells and splenocytes were stained with PE-Cy7 anti-mouseCD45 antibody (eBioscience), APCrat anti-mouseCD4 antibody (BD Biosciences), FITCrat anti-mouseCD8a antibody (BD Biosciences), and PE anti-mouseCD25 antibody (BioLegend). This fraction was isolated by FACSAria II and subjected to real-time PCR analysis.
Real-time quantitative PCR
RNA extraction, reverse transcription, and real-time PCR using SYBR green were performed as previously described [17]. The relative expression of objective mRNA was calculated as a ratio to that of the 18S ribosomal RNA. Primer sequences are listed in Table 1.
Table 1
Primer list.
Genes
Forward primer
Reverse primer
Emr1
CTTTGGCTATGGGCTTCCAGTC
GCAAGGAGGACAGAGTTTATCGTG
Itgax
ATGTTGGTGGAAGCAAATGG
CCTGGGAATCCTATTGCAGA
Tnfa
AGCCTGTAGCCCACGTCGTA
GGCACCACTAGTTGGTTGTCTTTG
Il1b
TCCAGGATGAGGACATGAGCAC
GAACGTCACACACCAGCAGGTTA
Il33
CCTGCCTCCCTGAGTACATACA
CTTCTTCCCATCCACACCGT
Il1rl1
GCAATTCTGACACTTCCCATG
ACGATTTACTGCCCTCCGTA
Ccl2
TCACCTGCTGCTACTCATTCACCA
TACAGCTTCTTTGGGACACCTGCT
Ccl3
TGAAACCAGCAGCCTTTGCTC
AGGCATTCAGTTCCAGGTCAGTG
Ccl5
CCTCACCATCATCCTCACTGCA
TCTTCTCTGGGTTGGCACACAC
Ccl11
TTCTATTCCTGCTGCTCACGG
AGGGTGCATCTGTTGTTGGTG
Ccl20
CGACTGTTGCCTCTCGTACA
GAGGAGGTTCACAGCCCTTT
Ccl21
TGAGCTATGTGCAAACCCTGAGGA
TGAGGGCTGTGTCTGTTCAGTTCT
Ccl22
TCTTGCTGTGGCAATTCAGA
GAGGGTGACGGATGTAGTCC
Ccl24
CTGTGACCATCCCCTCATCT
TATGTGCCTCTGAACCCACA
Cxcl10
TGCTGGGTCTGAGTGGGACT
CCCTATGGCCCTCATTCTCAC
Ccr1
TTAGCTTCCATGCCTGCCTTATA
TCCACTGCTTCAGGCTCTTGT
Ccr2
AGAGGTCTCGGTTGGGTTGT
CACTGTCTTTGAGGCTTGTTGC
Ccr3
TTTCCTGCAGTCCTCGCTAT
ATAAGACGGATGGCCTTGTG
Ccr4
CGAAGGTATCAAGGCATTTGGG
GTACACGTCCGTCATGGACTT
Ccr5
ATACCCGATCCACAGGAGAA
CCATTCCTACTCCCAAGCTG
Ccr6
TTGTCCTCACCCTACCGTTC
GATGAACCACACTGCCACAC
Ccr7
CCAGCAAGCAGCTCAACATT
GCCGATGAAGGCATACAAGA
Cxcr3
GCCAAGCCATGTACCTTGAG
GGAGAGGTGCTGTTTTCCAG
18s rRNA
GTAACCCGTTGAACCCCATT
CCATCCAATCGGTAGTAGCG
Statistical analysis
Data are expressed as the mean ± S.E. Statistical analysis was performed using the Student’s t-test between two groups or one-way ANOVA and Bonferroni test for multiple comparisons using the software ystat2004. Statistical analysis for body weight transition, blood glucose levels in GTT and ITT in female mice were conducted by two-way ANOVA and Bonferroni test for multiple comparisons using the software StatView5.0. P<0.05 was considered significant.
Results
Sex difference in energy and glucose metabolism of diet-induced obesity
The impact of HFD feeding differs between male and female [2]. Therefore, we initially examined the metabolic profiles of each mouse. In males, HFD feeding strongly augmented body weight gain and fat accumulations in both gonadal and inguinal white adipose tissue (Wg and Wi, respectively). These increases were correlated with a decrease in VCO2 in the dark phase (Fig 1A–1E). In females, F-HFD mice exhibited a significant increase in body weight compared with those fed F-Chow, albeit to a lesser extent than in male mice. In contrast, the body weight of OVX-HFD mice significantly increased, whereas replacement of E2 effectively attenuated weight gain to a similar level as F-HFD mice (Fig 1F). Similar changes were observed in Wi weights at sacrifice, and in visceral and subcutaneous adipose tissue volumes analyzed by MRI at 12 weeks of HFD feeding; however, Wg weights at sacrifice were almost similar among the three groups of HFD-fed mice (Fig 1I–1M). Regarding energy metabolism, VO2 in the dark phase, and VCO2 in both light and dark phases decreased in the HFD-fed female mice. Of note, OVX-HFD mice exhibited further reduction of VO2 in the dark phase compared with F-HFD mice, and E2 treatment ameliorated this reduction (Fig 1G and 1H).
Fig 1
Sex difference in metabolic phenotypes of diet-induced obesity.
Changes in body weight (A, F), oxygen consumption (B, G), carbon dioxide production (C, H), weights of gonadal (Wg) and inguinal white adipose tissue (Wi) (D, E, I, J) in male (A-E) and female mice (F-J) are shown. Representative T1-weighted axial MRI slices of female mice (K), and estimated volumes of visceral (L) and subcutaneous fat (M) in each experimental group of female mice are shown. Data are the mean ± S.E. (n = 10–18 in A, F; n = 5–9 in B-E, G-M). *P<0.05 and **P<0.01, significantly different from Chow mice; †P<0.05 and ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §P<0.05 and §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2 mice.
Sex difference in metabolic phenotypes of diet-induced obesity.
Changes in body weight (A, F), oxygen consumption (B, G), carbon dioxide production (C, H), weights of gonadal (Wg) and inguinal white adipose tissue (Wi) (D, E, I, J) in male (A-E) and female mice (F-J) are shown. Representative T1-weighted axial MRI slices of female mice (K), and estimated volumes of visceral (L) and subcutaneous fat (M) in each experimental group of female mice are shown. Data are the mean ± S.E. (n = 10–18 in A, F; n = 5–9 in B-E, G-M). *P<0.05 and **P<0.01, significantly different from Chow mice; †P<0.05 and ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §P<0.05 and §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2mice.We next investigated the glucose metabolism by GTT and ITT (Fig 2). M-HFD mice exhibited significantly higher blood glucose levels by both GTT and ITT, suggesting glucose intolerance and insulin resistance (Fig 2A and 2B). In contrast, F-HFD mice exhibited a modest increase in glucose levels by GTT and ITT. However, glucose levels were significantly increased, and E2 treatment attenuated this increase in OVX-HFD mice (Fig 2C and 2D).
Fig 2
Sex difference in glucose metabolism of diet-induced obesity.
Glucose tolerance test (A, C), insulin tolerance test (B, D), and glucose area under the curve (AUC) in male and female mice are shown. Data are the mean ± S.E. (n = 5–9). *P<0.05 and **P<0.01, significantly different from control mice; †P<0.05 and ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §P<0.05 and §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2 mice.
Sex difference in glucose metabolism of diet-induced obesity.
Glucose tolerance test (A, C), insulin tolerance test (B, D), and glucose area under the curve (AUC) in male and female mice are shown. Data are the mean ± S.E. (n = 5–9). *P<0.05 and **P<0.01, significantly different from control mice; †P<0.05 and ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §P<0.05 and §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2mice.
Sex difference in adipose Treg localization
VAT-Treg play an essential role in the regulation of chronic inflammation and glucose homeostasis, and this reduction is considered as a causative factor promoting chronic inflammation in male obesemice [7]. However, little is known about the impact of obesity on VAT-Treg in females. To elucidate the sex-specific properties of adipose-resident Treg localization, we analyzed Treg in the spleen and VAT by flow cytometry. In the spleen, CD4+ T cells in female OVX and OVX-HFD mice, and CD8+ T cells in all mice fed HFD were decreased. In contrast, the number of Treg did not differ among mouse groups of either sex (Fig 3A and 3B). On the other hand, CD4+ T cells were reduced and CD8+ T cells were increased by HFD feeding in the Wg of male mice (Fig 3C) as previously reported [8,19]. However, no such changes were observed in female mice (Fig 3D). Importantly, VAT-Treg were significantly reduced by HFD in male mice (Fig 3C) as previously reported [7, 8], whereas their number was slightly and significantly increased in F-HFD and OVX-HFD+E2mice, and not altered in OVX-HFD mice (Fig 3D).
Fig 3
Sex difference in the impact of HFD feeding on adipose tissue localization of CD4+ and CD8+ T cells and Treg.
The ratios of CD4+ and CD8+ T cells in CD45+ cells, and CD25+FOXP3+ Treg in CD4+ cells of spleen (A, B) and gonadal white adipose tissue (C, D) of male and female mice examined by flow cytometry are shown. Data are the mean ± S.E. (Spleen n = 5–9, Wg n = 4–6). *P<0.05 and **P<0.01, significantly different from control mice; #P<0.1 compared with control mice. The results of analysis with absolute cell number are shown in S2 Fig.
Sex difference in the impact of HFD feeding on adipose tissue localization of CD4+ and CD8+ T cells and Treg.
The ratios of CD4+ and CD8+ T cells in CD45+ cells, and CD25+FOXP3+ Treg in CD4+ cells of spleen (A, B) and gonadal white adipose tissue (C, D) of male and female mice examined by flow cytometry are shown. Data are the mean ± S.E. (Spleen n = 5–9, Wg n = 4–6). *P<0.05 and **P<0.01, significantly different from control mice; #P<0.1 compared with control mice. The results of analysis with absolute cell number are shown in S2 Fig.
Sex difference in chronic inflammation of adipose tissue
We next examined mRNA expression of genes related to chronic inflammation in the Wg. In M-HFD males, the expression of macrophage markers Emr1and Itgax, and proinflammatory cytokines Tnfa and Il1b were significantly increased (Fig 4A–4D). These findings are consistent with the reduction of VAT-Treg in M-HFD mice. However, in females, the increase in these genes was observed only in OVH-HFD mice, and not in F-HFD or OVX-HFD+E2mice (Fig 4E–4H). Therefore, the lower expression of proinflammatory genes in these mice was consistent with the higher accumulation of VAT-Treg in F-HFD and OVX-HFD+E2mice (Fig 3D).
Fig 4
Sex difference in the mRNA expression of inflammatory genes in Wg.
mRNA expression of Emr1 (A, E), Itgax (B, F), Tnfa (C, G), and Il1b (D, F) in gonadal WAT of male and female mouse is shown. Data are the mean ± S.E. (n = 5–9). **P<0.01, significantly different from control mice; ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2 mice.
Sex difference in the mRNA expression of inflammatory genes in Wg.
mRNA expression of Emr1 (A, E), Itgax (B, F), Tnfa (C, G), and Il1b (D, F) in gonadal WAT of male and female mouse is shown. Data are the mean ± S.E. (n = 5–9). **P<0.01, significantly different from control mice; ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2mice.
Comprehensive expression analysis of chemokines and their receptors in the Wg and accumulated CD4+CD25+ T cells
Interleukin 33 (IL33) signaling through its receptor ST2 (Interleukin 1 receptor-like 1; Il1rl1) plays an important role in the recruitment and maintenance of VAT-Treg in males [20, 21]. Therefore, we analyzed the expression of Il33 in the Wg and Il1rl1 in adiposeCD4+CD25+ T cells (Fig 5). Consistent with IL33 being considered as ‘alarmin’, its expression was higher in the Wg of M-HFD mice than in that of M-Chow mice (Fig 5A), suggesting inflammation and tissue damage associated with obesity [20]. These effects were similar in females; therefore, Il33 expression in Wg was correlated with the degree of obesity and inflammation (Fig 5C), which was significantly higher in OVX-HFD female mice among the female mouse groups (Figs 1 and 4). In contrast, the Il1rl1 expression in adiposeCD4+CD25+ T cells slightly decreased in M-HFD mice (Fig 5B), consistent with the previous observation in male obesemice [20]. Similarly, a decrease in Il1rl1 expression in adiposeCD4+CD25+ T cells was observed in both F-HFD and OVX-HFD mice (Fig 5D).
Fig 5
Sex difference in the mRNA expression of IL33 in Wg and ST2 in adipose CD4+CD25+ T cells.
CD4+CD25+ T cells were isolated from the Wg of male and female mice by FACSAria cell sorter. mRNA expression of Il33 in the Wg (A, C) and Il1rl1 in CD4+CD25+ T cells (B, D) are shown. Data are the mean ± S.E. (n = 5–9). *P<0.05 and **P<0.01, significantly different from Chow mice; #P<0.1, different from Chow mice; †P<0.05, significantly different between F-HFD and OVX-HFD mice; §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2 mice.
Sex difference in the mRNA expression of IL33 in Wg and ST2 in adipose CD4+CD25+ T cells.
CD4+CD25+ T cells were isolated from the Wg of male and female mice by FACSAria cell sorter. mRNA expression of Il33 in the Wg (A, C) and Il1rl1 in CD4+CD25+ T cells (B, D) are shown. Data are the mean ± S.E. (n = 5–9). *P<0.05 and **P<0.01, significantly different from Chow mice; #P<0.1, different from Chow mice; †P<0.05, significantly different between F-HFD and OVX-HFD mice; §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2mice.The impact of HFD feeding on VAT-Treg accumulation differed between male and female mice (Fig 3). Therefore, we hypothesized a sex-specific trafficking mechanism of VAT-Treg. As VAT-Treg express several chemokine receptors that are suggested to be involved in the migration and extravasation of tissue-resident Treg [7, 11], we examined the expression of chemokines in the Wg and their corresponding receptors in adiposeCD4+CD25+ T cells (Fig 6). The heat map of chemokine expression in male mice revealed that most chemokines were increased in the Wg of M-HFD mice, whereas that of their receptors in adiposeCD4+CD25+ T cells was lower than that in M-Chow mice (Fig 6A). In female mice, the expression of chemokines in the Wg was similarly increased in F-HFD compared with that in F-Chow mice. In contrast, their expression in OVX-HFD mice varied. In this context, expression of some chemokines, such as CCL3, 5, 2, and 22, were further increased, whereas that of other chemokines, including CCL24, 20, and CXCL10, was not altered or even slightly reduced (Fig 6B). The chemokine expression in OVX-HFD+E2mice also varied. In contrast, an almost consistent change was induced by HFD feeding in the expression of chemokine receptors in adiposeCD4+CD25+ T cells (Fig 6A and 6B). In general, the expression decreased in both male and female mice fed HFD. Among them, characteristic expression change was observed in CCR4 of M-HFD mice, and in CCR6 and CXCR3 of female mice fed HFD.
Fig 6
Heat map of mRNA expression of chemokines in the Wg and their receptors in adipose CD4+CD25+ T cells.
CD4+CD25+ T cells were isolated from the Wg of male (A, C, D) and female (B, E, F) mice by FACSAria cell sorter. mRNA expression of chemokines in the Wg and their corresponding receptors in CD4+CD25+ T cells was analyzed by real-time PCR. Heat map analysis showed different gene expression pattern in males and females of each mouse group. Color from red to blue indicates high to low expression. mRNA expression of Ccl24, Ccl20, and Cxcl10 in the Wg (C, E), and Ccr3, Ccr6, and Cxcr3 in CD4+CD25+ T cells (D, F) is shown. Data are the mean ± S.E. (n = 5–9; C-F). *P<0.05 and **P<0.01, significantly different from Chow mice; #P<0.1, among two groups, as indicated; ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2 mice.
Heat map of mRNA expression of chemokines in the Wg and their receptors in adipose CD4+CD25+ T cells.
CD4+CD25+ T cells were isolated from the Wg of male (A, C, D) and female (B, E, F) mice by FACSAria cell sorter. mRNA expression of chemokines in the Wg and their corresponding receptors in CD4+CD25+ T cells was analyzed by real-time PCR. Heat map analysis showed different gene expression pattern in males and females of each mouse group. Color from red to blue indicates high to low expression. mRNA expression of Ccl24, Ccl20, and Cxcl10 in the Wg (C, E), and Ccr3, Ccr6, and Cxcr3 in CD4+CD25+ T cells (D, F) is shown. Data are the mean ± S.E. (n = 5–9; C-F). *P<0.05 and **P<0.01, significantly different from Chow mice; #P<0.1, among two groups, as indicated; ††P<0.01, significantly different between F-HFD and OVX-HFD mice; §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2mice.Although adiposeTreg decreased in the Wg of M-HFD mice, their number increased in F-HFD mice and OVX-HFD+E2mice, and was not altered in OVX-HFD mice (Fig 3). We selected several genes that coordinately alter their expression according to the distribution of adiposeTreg in female mice based on the heat map, and confirmed their expression by increasing the number of samples (Fig 6C and 6D). We also analyzed the expression of genes in male mice, and confirmed that Ccl24 and Cxcl10 expression increased and that of Ccl20 slightly increased in the Wg, whereas that of Ccr3, 6 and Cxcr3 slightly decreased in adiposeCD4+CD25+ T cells of M-HFD mice (Fig 6C and 6D). In females, Ccl24 expression was increased in the Wg of F-HFD and OVX-HF+E2mice, whereas expression of its receptor Ccr3 was not altered among adiposeCD4+CD25+ T cells of each mouse group. Expression of Ccl20 was not changed, and Cxcl10 expression was instead increased in the Wg of OVX-HFD mice. In contrast, the expression of their corresponding receptors for Ccr6 and Cxcr3 in adiposeCD4+CD25+ T cells correlated with VAT-Treg accumulation. Their expression increased or slightly increased in both F-HFD and OVX-HFD+E2mice, but not in OVX-HFD mice (Fig 6E and 6F). Obesity-associated alteration of inflammatory gene expression does not occur at the systemic levels because no notable changes in chemokine receptor expression were observed in the spleen among all groups of mice tested (S3 Fig).
Discussion
The decrease in estrogen in menopause is associated with increased risk of obesity and type 2 diabetes in women [22]. Physiological estrogens function in the maintenance of metabolic homeostasis by regulating energy homeostasis, insulin sensitivity, lipogenesis, and chronic inflammation in numerous tissues in females [16, 23–25]. Therefore, females are generally considered less susceptible to chronic inflammation associated with obesity, mainly due to the presence of estrogen. In addition, the obesity-associated decrease in VAT-Treg is also involved in chronic inflammation and impaired glucose metabolism in males [4]. However, the metabolic impact and effects of estrogen on the localization and function of VAT-Treg in females are unclear. In the current study, we demonstrated the opposite impact of obesity on the accumulation of VAT-Treg between male and female mice. Moreover, the increase in female was inhibited in OVX-HFD mice, but was restored by supplementation with estrogen (Fig 3), suggesting an important role for estrogen in VAT-Treg accumulation in obesity. Furthermore, the expression of chemokine signaling molecules, including CCL24, CCR6, and CXCR3, was altered in accordance with female-specific fluctuations in VAT-Treg in obesity (Fig 6). Therefore, these chemokine signals are candidates mediating the accumulation of VAT-Treg.The significance of IL33/ST2 signaling in the localization of VAT-Treg in male mice was previously demonstrated [20, 21, 26]. We also observed a reduction of VAT-Treg and decrease in ST2 expression in adiposeCD4+CD25+ T cells despite the increase in IL33 in the Wg of M-HFD mice (Figs 3 and 5), as previously reported [20]. Of note, this decrease in ST2 was also observed in the adiposeCD4+CD25+ T cells of F-HFD and OVX-HFD mice, suggesting the existence of a mechanism other than IL33/ST2 signaling in VAT-Treg localization in female mice. Recently, T cell receptors (TCR) in Treg that recognize VAT-specific antigens have been suggested as an important mechanism for VAT-Treg localization. In males, significant accumulation of VAT-Treg was reported in a transgenicmouse overexpressing the TCR gene of VAT-Treg clone, whereas no such findings were observed in the female mice [26]. This also suggests female-specific mechanisms for VAT-Treg accumulation.Naturally occurring Treg differentiate in the thymus, and are distributed mainly to lymphoid tissues and throughout the body. Certain Treg migrate to peripheral tissues and play a homeostatic role in response to the tissue environment [27]. Tissue-resident Treg exhibit tissue-specific expression of chemokine receptors that mobilize them to target tissues by chemokine signals [28]. The expression of CCL24 in the Wg, and CCR6 and CXCR3 in adiposeCD4+CD25+ T cell fluctuate in parallel with the number of VAT-Treg in female mice (Fig 6), suggesting the involvement of these signals in VAT-Treg recruitment. Indeed, the migration ability was decreased in Treg of CCR6 knockout mice in vitro [29]. Reduced Treg migration was also observed in the central nervous systems of the experimental autoimmune encephalomyelitis model Rag1 knockout mice reconstituted with bone marrow of CCR6 knockout mice [29]. Moreover, a decrease in FOXP3 expression was reported in the adipose tissue of male CXCR3 knockout mice fed HFD [30]. CXCR3 has been also demonstrated to be involved in the chemotaxis of Treg to pancreatic islets [13]. Regarding the effects of estrogen, it increases CCR6 expression in lymphoblasts in vitro [31]. As current limited knowledge regarding the molecular mechanism of estrogen and chemokine signaling for Treg mobilization should be further clarified in the future. We screened several chemokines and their receptors, and provided several candidate of chemokine signaling implicating VAT-Treg localization especially in females. It would be important to verify the expression of these receptors on Tregs by analysis with flow cytometry. Furthermore, the impact of chemokine receptor intervention identified in this study on VAT-Treg localization in female mice is needed to be clarified.Group 2 innate lymphoid cells (ILC2) have recently been highlighted as immune cells controlled by sex hormones. Male are less susceptible to allergic airway inflammation, have a lower prevalence of asthma, and have lower ILC2 numbers in the lung and circulation compared with female mice and asthmapatients. The negative impact of androgen and testosterone signaling has been suggested as a mechanism for the reduction in males [32, 33]. Since recent evidences suggest that ILC2 play crucial roles in adipose tissue homeostasis and browning [34], it would be interesting to investigate the sex difference of adipose ILC2 in various conditions such as obesity or cold exposure.Estrogen replacement in mice is generally conducted by osmotic pump or sustained-release tablet [16, 23, 35], which is not physiological administration considering estrous cycles. The rodent estrus cycle repeats every 4 days, and a method of administering estrogen at 2 μg every four days has been reported as a physiological replacement for rats [15]. However, this dose was excessive as marked weight loss was observed. After careful induction in preliminary experiments, we found 1.5 μg/mice to be ideal for estrogen replacement in C57BL/6 mice because it restored the estrus cycle based on vaginal smears, body fat gain, and disturbed energy and glucose metabolisms of OVX-HFD mice to those similar to HFD mice (Figs 1 and 2).Several studies have attempted to elucidate the impact of obesity on the localization of VAT-Treg in humans. Contradictory results have been reported, possibly due to the difference in population, including age, menopause ratio, sex proportion, and methods for evaluating VAT-Treg utilizing flow cytometry or real-time PCR in each study [8, 9, 36–39]. The increase in VAT-Treg in obesity has been reported in studies where most subjects were women [36, 40]. In this context, the gender difference in VAT-Treg has also been described in obesemice [41], but the underlying mechanisms of sexual dimorphism or estrogen impact on VAT-Treg localization have not been clarified. The current study provides evidence that estrogen at a physiological level significantly affects VAT-Treg localization. Its effects may be one of the protective mechanisms to alleviate metabolic stress associated with obesity.FOXP3 is an important transcription factor for the immuno-suppressive function of Treg; therefore, they are generally defined as CD4+CD25+FOXP3+ T cells in mice [42]. As cell fixation with paraformaldehyde for intracellular staining of FOXP3 promotes nucleic acid fragmentation and is not suitable for the accurate analysis of mRNA expression [43], we isolated CD4+CD25+ T cells from the Wg and analyzed chemokine receptor expression (Fig 6). CD4+CD25+ T cells were considered Treg until the discovery of FOXP3 [44]. As recent studies demonstrated that some population of activated conventional T cells also express CD25 [45], experiments with Foxp3 reporter mice may be more ideal for the analysis of gene expression in tissue-resident Treg, being a limitation of the current study.In summary, the current study demonstrated the sexual dimorphism in VAT-Treg accumulation in obesity. The increase in VAT-Treg in obesity may be induced by altered chemokine signals regulated by estrogen, which attenuates obesity-associated chronic inflammation and dysregulation of glucose metabolism in female mice.
Gating strategy for CD4+CD25+Foxp3+ Treg cells.
Representative plots of flow cytometry showing the gating strategy for identifying Tregs.(TIF)Click here for additional data file.
The impact of HFD feeding on absolute cell numbers of CD4+ and CD8+ T cells and Treg in the spleen and Wg (Related to Fig 3).
The absolute cell number ratios of CD4+ and CD8+ T cells and CD4+CD25+FOXP3+ Treg in the spleen and gonadal white adipose tissue (Wg) of male and female mice examined by flow cytometry are shown. The results were obtained in the same experiments as in Fig 3. Data are the mean ± S.E. (Spleen n = 5–9, Wg n = 4–6). *P<0.05 and **P<0.01, significantly different from control mice; **P<0.01, significantly different from control mice; †P<0.05, significantly different between F-HFD and OVX-HFD mice; §§P<0.01, significantly different between OVX-HFD and OVX-HFD+E2mice.(TIF)Click here for additional data file.
Heat map of mRNA expression of chemokine receptors in splenic CD4+CD25+ T cells.
CD4+CD25+ T cells were isolated from spleens of male (A, C) and female (B, D) mice by FACSAria cell sorter. mRNA expression of chemokine receptors in CD4+CD25+ T cells were analyzed by real-time PCR. Heat map analysis showing similar gene expression pattern in males and females of each mouse group. Color from red to blue indicates high to low expression. mRNA expression of Ccr3, Ccr6, and Cxcr3 in CD4+CD25+ T cells is shown. Data are the mean ± S.E. (n = 4–9; C, D).(TIF)Click here for additional data file.(XLSX)Click here for additional data file.17 Dec 2019PONE-D-19-30423Estrogen regulates sex-specific localization of regulatory T cells in adipose tissue of obese female micePLOS ONEDear Prof. Sasaoka,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.There were major issues identified by reviewer 1 that require significant attention, additional experiments, and re-write (especially within the methods section).We would appreciate receiving your revised manuscript by Jan 31 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Jonathan M Peterson, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements:Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdfTo comply with PLOS ONE submission requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.3. Thank you for stating the following in the Financial Disclosure section:This study was funded by the Japan Society for the Promotion of Science (JSPS KAKENHI Grant Number JP15K09410) to TW and a research grant from Mitsubishi Tanabe Pharma Corporation to TW.We note that one of the authors received funding from a commercial source:Mitsubishi Tanabe Pharma CorporationPlease provide an amended Competing Interests Statement that explicitly states this commercial funder, along with any other relevant declarations relating to employment, consultancy, patents, products in development, marketed products, etc.Within this Competing Interests Statement, please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.Please include your amended Competing Interests Statement within your cover letter. We will change the online submission form on your behalf.Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.We will update your Data Availability statement to reflect the information you provide in your cover letter.5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQAdditional Editor Comments (if provided):There were major issues identified by reviewer 1 that require significant attention, additional experiments, and re-write (especially within the methods section).[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: NoReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: N/AReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: In this paper the authors provide some results suggesting that the recruitment of Treg cells in VAT upon HFD induced obesity is differentially regulated according the the sex, down regulated in male mice and up-regulated in female mice. This is an interesting observation, but the rest of the work suffers from flow in experimental designs and interpretation of the data.Major concerns :The results from Fig 1 to Fig 2 assessing the impact of ovarian hormones and E2 on HFD -induced metabolic phenotypes and on glucose tolerance are largely redundant to previously published works in this field.The results in Fig 3 suggesting sex differences in the recruitment of Foxp3Treg cells are interesting but very preliminary. The authors should show the gating strategy they used and provide a complete analysis of others immune cells associated with VAT, particularly ILC2. Sex bias have been shown regarding ILC2 numbers in various tissues (Cephus Cell report 2017; Laffont JEM 2017). They should also express the results as absolute cell numbers normalized to tissue weight.The rationale of the experiment in Fig. 4 is unclear. Only TNFa is a pro-inflammatory cytokine gene. Emr1 and Itgax encode for F4/80 and CD11c, respectively. The expression of F4/80 and CD11c + cells must be assessed by FACS rather than RT-qPCR to be really informative..Again, the rationale of Fig 5 is also unclear. Il1rl1 (ST2) IL33 receptor expression could be simply assessed by FACS on Tregs….IL33 is an alarmin produced by epithelial cells undergoing cell death or necrosis, not by hematopoietic cells. There is no rationale to test IL33 mRNA expression in Treg cells….In Fig 6 the data must be expressed as relative expression normalized to house keeping genes rather than fold-change which does not mean anything. Again, the expression of chemokine receptor (CCR3, CCR6, CXCR3) could be easily tested by FACS on Treg cells.Reviewer #2: In the article the authors wanted to address the difference in obesity in male and female populations and the chronic inflammatory response related to obesity. The article also addresses how estrogen protect against the chronic inflammation in females through Treg cellular response. Overall the article was well written and the conclusions were well supported. However, there were a couple of significant but minor issues, specifically within the methods section, that need to be addressed prior to publication.· Investigators have in methods section “as previously described” on lines 103, 110, 114, and 153. When reviewing the cited articles on line 103, #16 did not have any methods on MRI. Citation #17 and it did have MRI in its methods but it also said “as previously described” with a citation. I will assume the other citations are the same. It would be easier for the readers if the protocol is described and that the references indicated actually describe the methods being used.· Similarly the details for the glucose tolerance test and insulin tolerance tests were incomplete. For example how long were the animals fasted prior to start of experiment?· When reporting centrifugation within the methods section the authors must either indicated the Relative centrifugal force, or RCF, not RPMs, as without the rotor model number the RPM value cannot be repeated.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: Yes: Kristy L. Thomas[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.30 Jan 2020Answers to Academic EditorThe Editor indicated there were major issues identified by the Reviewer 1 that required significant attention, additional experiments, and re-write manuscript. We have carefully considered all of the comments of the Reviewers. We added gating strategy of Tregs (Fig. 1S), flow cytometry data of CD4+ and CD8+ T cells (Fig. 3), absolute cell counts for flow cytometry data (Fig. 2S), and measured Il1b expressions in the Wg of each mouse as another inflammatory cytokine (Fig. 4) in the revised manuscript.The Reviewer 1 has requested several flow cytometry experiments. We understand analysis with flow cytometry provides more informative and straightforward results compared with mRNA analysis of sorted cells by flow cytometry. Ideally, all experiments should be performed by flow cytometry. However, we could not conduct additional flow cytometry experiments. There are several reasons why we could not confirm our results with flow cytometry, and we answered each of them in the Response to Reviewer 1. We would like to explain an overview here. The main reason is limited number of stromal vascular fraction (SVF) cells available in adipose tissues. The number of SVF cells in adipose tissue is low, especially in lean animals. Therefore, more than one mouse per one sample is needed for each analysis (macrophages, expression of ST2 or one chemokine receptor on Tregs). Our FACSArea II system (BD Bioscience) can measure only 6 colors simultaneously to analyze adipose tissue SVF cells with appropriate compensation. We have already used 5 colors (7AAD, CD45, CD4, CD25, and Foxp3) for Treg separation. In addition, we need strict consideration of experimental ethics regarding the number of mice required for the experiments. Furthermore, it would take 5 month to prepare mice for flow cytometry analysis, because mice were fed high-fat diet for 16 weeks after sham or ovariectomy.Current study has shown the sex difference on VAT-Treg accumulation in obese condition. We screened mRNA expression of several chemokine receptors, and found synchronous changes in CCR3, CCR6, and CXCR3 expression on Tregs with VAT-Treg localization. Although we did not confirm their expressions by flow cytometry, we believe that the current findings are novel and meaningful for further understanding the localization of VAT-Treg.We would like to thank the Editor and the Reviewers for highly evaluating our manuscript. Our detailed response to each of the Reviewer’s criticism is described bellows. We really hope that our revised manuscript is now acceptable for publication in PLOS ONE.Answers to Reviewer 1We thank the Reviewer for evaluating our manuscript and his/her thoughtful suggestions for improving our manuscript.1. The results from Fig 1 to Fig 2 assessing the impact of ovarian hormones and E2 on HFD -induced metabolic phenotypes and on glucose tolerance are largely redundant to previously published works in this field.The Reviewer suggested that impacts of HFD feeding, results in Figs. 1 and 2 are redundant, since ovariectomy and estradiol (E2) treatment on body weight gain and glucose metabolism are already reported. Although the Reviewer’s indication is taken, we carefully re-consider that these results are still important basic data for properly understanding current study, because body fat accumulation, adiposeTreg accumulation and glucose metabolism are closely related to each other. In addition, we did provide a novel method for E2 supplementation in mice, which was modified from a previous reported study on rats [Reference 15, Horm Behav. 2002 doi: 10.1006/hbeh.2002.1835.]. We administered 1.5 µg of E2 every 4 days to imitate the estrus cycle of mice. Most of metabolic parameters including body and fat weights, energy metabolism, glucose levels in glucose and insulin tolerance test were comparable between female sham-operated HFD-fed mice (F-HFD) and E2-supplemented ovariectomized mice fed HFD (OVX-HFD+E2), indicating that the method of E2 supplementation appears to be adequate in the experiments. Although continuous E2 supplementation methods such as sustained releasing tablets or osmotic pump are commonly used for mice experiments, we believe the current new method is considered simple, cost-effective and physiological approach. Therefore, we understand that demonstration of results in Figs. 1 and 2 is important for verifying the data with the current supplementation method.2. The results in Fig 3 suggesting sex differences in the recruitment of Foxp3Treg cells are interesting but very preliminary. The authors should show the gating strategy they used and provide a complete analysis of others immune cells associated with VAT, particularly ILC2. Sex bias have been shown regarding ILC2 numbers in various tissues (Cephus Cell report 2017; Laffont JEM 2017). They should also express the results as absolute cell numbers normalized to tissue weight.The Reviewer indicated that sex differences in the recruitment of Foxp3adiposeTreg cells in Fig. 3 are interesting but preliminary. VAT-Treg plays significant role in the attenuation of obesity-associated chronic inflammation, thereby contributing to the maintenance of systemic glucose metabolism in male animals [Reference 7, Nat Med. 2009, doi: 10.1038/nm.2002.; Reference 8, Nat Med. 2009, doi: 10.1038/nm.2001.]. Therefore, we think that the observation is interesting as the Reviewer indicated. In the following experiments, we attempted to investigate the possible underlying mechanisms of VAT-Treg accumulation in female mice by screening their chemokine receptor expressions, since distribution of resident Treg has been shown to be regulated by chemokine signals in various tissues [Reference 27, Blood. 2006, doi: 10.1182/blood-2006-01-0177.]. We really hope that the Reviewer understands our research focus and strategy.In response to the Reviewer’s request, we added gating strategy of Treg analysis, which was added as the S1 Fig. and described in the method section of the revised manuscript (page 10, line 145).The Reviewer suggested to provide complete analysis of other immune cells associated with VAT, particularly ILC2, since their sex bias has been shown recently. Therefore, we demonstrated CD4+ and CD8+ T cell data in the spleen and gonadal white adipose tissue (Wg) in addition to Tregs in Fig. 3 and results section of the revised manuscript (page 15, line 211 to page 16, line 219), although we could not provide complete analysis of immune cells including ILC2. We understand that the Reviewer’s suggestion about ILC2 analysis is quite interesting, because recent studies have indicated that adipose ILC2 plays significant roles in tissue homeostasis and browning. However, preparation of new separate sets of each mouse group is required for the complete analysis of immune cells including ILC2. It will take about more than 5 month for the preparation of mice, because mice were loaded HFD for 16 weeks after ovariectomy. Since we really understand that the adipose ILC2 analysis is another important research topic in the future, we proposed ILC2 experiment as a crucial and needed topic in the discussion section of the revised manuscript (page 25, lines 362 to 369), as follows: Group 2 innate lymphoid cells (ILC2) have recently been highlighted as immune cells controlled by sex hormones. Male are less susceptible to allergic airway inflammation, have a lower prevalence of asthma, and have lower ILC2 numbers in the lung and circulation compared with female mice and asthmapatients. The negative impact of androgen and testosterone signaling has been suggested as a mechanism for the reduction in males [32, 33]. Since recent evidences suggest that ILC2 play crucial roles in adipose tissue homeostasis and browning [34], it would be interesting to investigate the sex difference of adipose ILC2 in various conditions such as obese or cold stimulation.The Reviewer suggested to explain the results as absolute cell numbers normalized to tissue weight in Fig. 3. The presentation of flow cytometry data with cell frequency or absolute cell numbers is sometimes controversial. We considered cell frequency data to be useful because of the low variability and elimination of dead cells. In this context, we presented Fig. 3 as the data with cell frequency. In contrast, data with absolute cell number is also important especially for the analysis with rarely localized cell types. Indeed, frequencies of lung ILC2 cells are rare (about less than 1% in both papers: Cephus Cell report 2017 and Laffont JEM 2017). We understand that presentation of data with both frequency and absolute cell numbers is ideal, as the Reviewer suggested. In this context, the absolute numbers of adiposeTreg did not change significantly in female F-HF and OVX-HFD+E2mice and even in any group of male mice, possibly due to remarkable increase of CD4+ T cells by HFD feeding in our experimental condition. Since adiposeTreg is usually evaluated by frequency data [Reference 7, Nat Med. 2009, doi: 10.1038/nm.2002.; Reference 8, Nat Med. 2009, doi: 10.1038/nm.2001.] and the interpretation of absolute cell numbers data is difficult, we added these data in the S2 Fig. of the revised manuscript.3. The rationale of the experiment in Fig. 4 is unclear. Only TNFa is a pro-inflammatory cytokine gene. Emr1 and Itgax encode for F4/80 and CD11c, respectively. The expression of F4/80 and CD11c + cells must be assessed by FACS rather than RT-qPCR to be really informative.Obesity-associated infiltration of proinflammatory macrophage is a well-known feature of chronic inflammation in the visceral adipose tissue that produces inflammatory cytokines including TNFα. The Reviewer suggested that only Tnfa is a pro-inflammatory cytokine gene shown in Fig. 4 of the original manuscript. Since we agree with the Reviewer’s indication, we analyzed the expressions of Il1b as another important cytokine known to be implicated in the development of insulin resistance in the obeseadipose tissue. The expression showed similar change compared to Tnfa in the mice group. These new results are added in the Fig. 4 and stated in the result section of the revised manuscript (page 17, lines 231 to 232), as follow: the expression of macrophage markers Emr1and Itgax,and proinflammatory cytokines Tnfa and Il1b were significantly increased (Fig. 4A-D).The Reviewer indicated that Emr1 and Itgax encoding F4/80 and CD11c are representative markers for macrophages and proinflammatory M1-macrophages, respectively. The Reviewer suggested to assess these cell numbers by flow cytometry. We understand that analysis with flow cytometry is ideal for evaluation of macrophage infiltration. However, the number of SVF cells in adipose tissue is low especially in lean animals. More than one mouse per one sample is needed only for the macrophage analysis. In addition, it takes more than 5 months to prepare the new separate set of each mouse group for the assay. We really hope that the Reviewer understands the practical difficulties of analyzing adipose tissue with flow cytometry. In contrast, mRNA expressions of Emr1 and Itgax are usually analyzed as adequate indicators of macrophage infiltration in adipose tissue (e.g. Takei R, PLOS One 2019, doi: 10.1371/journal.pone.0223302.; Li J, Nat Commun 2019, doi: 10.1038/s41467-019-10348-0.; Kawano Y, Cell Metab 2016, doi: 10.1016/j.cmet.2016.07.009.). Therefore, we measured these mRNA expressions as indicators of obesity-associated chronic inflammations in these animals. Again, we really hope that the Reviewer understands our careful decision on the experiments.4. Again, the rationale of Fig 5 is also unclear. Il1rl1 (ST2) IL33 receptor expression could be simply assessed by FACS on Tregs….IL33 is an alarmin produced by epithelial cells undergoing cell death or necrosis, not by hematopoietic cells. There is no rationale to test IL33 mRNA expression in Treg cells….The significance of IL33/ST2 signaling in the localization of VAT-Treg in male mice has been previously demonstrated [References 20, 21, 26 of the revised manuscript]. Therefore, we investigated whether the expression of Il1lr1 is associated with VAT-Treg localization in female mice, and found that they were not correlated as described in the discussion section. The Reviewer again suggested that investigation of ST2 (Il1rl1) expression in Treg could be assessed by flow cytometry rather than mRNA analysis in sorted samples. We really understand the importance of ideal analysis with flow cytometry for ST2 expression in Treg. Again, we would like to mention that the number of SVF cells in adipose tissue is limited. Preparation of a new separate set of samples from each mouse group is practically very difficult for the assay. On the other hand, we believe that the measurement of mRNA expression is an adequate approach for analyzing limited samples with appropriate biological implications.We measured IL33 levels in the visceral adipose tissue, since it is an alarmin, as the Reviewer indicated. We labeled “VAT” and “CD4+CD25+ T cells” above panels to indicate analyzed samples in the revised Fig. 5.5. In Fig 6 the data must be expressed as relative expression normalized to house keeping genes rather than fold-change which does not mean anything. Again, the expression of chemokine receptor (CCR3, CCR6, CXCR3) could be easily tested by FACS on Treg cells.All of expression data including Fig. 6 are expressed as relative expression normalized to the 18S ribosomal RNA, as described in the material and method section.Current study has shown the sex difference on VAT-Treg accumulation in obese condition. We screened mRNA expression of several chemokine receptors, and found synchronous changes in CCR3, CCR6, and CXCR3 expression on Tregs with VAT-Treg localization. Although we did not confirm their expressions by flow cytometry analysis, we believe that the current findings are novel and valuable for further understanding the mechanism of VAT-Treg localization. At the same time, we understand the limitation that current study shows a possible involvement of these chemokine signaling in the clarification of VAT-Treg localization mechanisms in female. The limitation of the current study and requirement of the suggested future research has been described in the discussion section of the manuscript. Furthermore, since the Reviewer’s indication that chemokine receptor expressions should be confirmed by flow cytometry analysis is well taken, we included this point in the discussion section of the revised manuscript (page 25, lines 355 to 361), as shown below: As current limited knowledge regarding the molecular mechanism of estrogen and chemokine signaling for Treg mobilization should be further clarified in the future. We screened several chemokines and their receptors, and provided several candidate of chemokine signaling implicating VAT-Treg localization especially in females. It would be important to verify the expression of these receptors on Tregs by analysis with flow cytometry. Furthermore, the impact of chemokine receptor intervention identified in this study on VAT-Treg localization in female mice is needed to be clarified.Answers to Reviewer 2We thank the Reviewer for highly evaluating our manuscript and his/her thoughtful suggestions for improvement of our manuscript.1. The Reviewer suggested to revise references in the method section to adequately repeat the experiments for readers. According to the Reviewer’s important suggestion, we have carefully checked all of references regarding the adequate explanation of the experimental protocol in the method section. As a result, we deleted references 16 and 19 in original manuscript, and adequately corrected and added one paper (reference 17) in the revised manuscript.2. The Reviewer asked to describe fasting time of GTT and ITT experiments. We agree with the Reviewer’s indication, since fasting time is important for understanding of GTT and ITT data. In response to the Reviewer’s comment, we stated the fasting time in the method section of the revised manuscript (page 8, line 115 to page 9, line 117).3. The Reviewer advised to describe the relative centrifugal force when reporting centrifugation in the method section. According to the Reviewer’s comment, we changed the description about centrifugation from RPM to RCF in the revised manuscript (Page 9, lines 122 and 128).Submitted filename: PONE-D-19-30423 Responce to Reviewers.docxClick here for additional data file.11 Mar 2020Estrogen regulates sex-specific localization of regulatory T cells in adipose tissue of obese female micePONE-D-19-30423R1Dear Dr. Sasaoka,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Jonathan M Peterson, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments (optional):all comments from previous reviews have been answered. While additional experiments would enhance the findings of the manuscript, they are not required.Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #2: All comments have been addressedReviewer #3: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #2: YesReviewer #3: Partly**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #2: YesReviewer #3: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #2: YesReviewer #3: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2: YesReviewer #3: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #2: Authors have sufficiently addressed the minor revisions addressed in the previous review. There are no additional revisions that have appeared in this newest draft.Reviewer #3: Q1: Circulating adipokines play a critical role in systemic inflammation and insulin resistance. The authors' work and responses to reviewers have well done. I'm wondering if it is possible to look at serum adipokine profile?Q2: The conclusion would be solider if in vitro experiments could be conducted to investigate the mechanism by which estrogen acts to IL33/ST2 in the context of nutrient excess.**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: Yes: Kristy L. ThomasReviewer #3: No18 Mar 2020PONE-D-19-30423R1Estrogen regulates sex-specific localization of regulatory T cells in adipose tissue of obese female miceDear Dr. Sasaoka:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr Jonathan M PetersonAcademic EditorPLOS ONE
Authors: Tara M D'Eon; Sandra C Souza; Mark Aronovitz; Martin S Obin; Susan K Fried; Andrew S Greenberg Journal: J Biol Chem Date: 2005-08-17 Impact factor: 5.157
Authors: Ana Claudia Araujo-Pires; Andreia Espindola Vieira; Carolina Favaro Francisconi; Claudia Cristina Biguetti; Andrew Glowacki; Sayuri Yoshizawa; Ana Paula Campanelli; Ana Paula Favaro Trombone; Charles S Sfeir; Steven R Little; Gustavo Pompermaier Garlet Journal: J Bone Miner Res Date: 2015-03 Impact factor: 6.741
Authors: Alyssa L Thomas; Pablo C Alarcon; Senad Divanovic; Claire A Chougnet; David A Hildeman; Maria E Moreno-Fernandez Journal: Front Aging Date: 2021-09-22
Authors: Sara Sayonara da Cruz Nascimento; Jaluza Luana Carvalho de Queiroz; Amanda Fernandes de Medeiros; Ana Clara de França Nunes; Grasiela Piuvezam; Bruna Leal Lima Maciel; Thaís Souza Passos; Ana Heloneida de Araújo Morais Journal: PLoS One Date: 2022-09-01 Impact factor: 3.752
Authors: Maria E Moreno-Fernandez; Vishakha Sharma; Traci E Stankiewicz; Jarren R Oates; Jessica R Doll; Michelle S M A Damen; Maha A T A Almanan; Claire A Chougnet; David A Hildeman; Senad Divanovic Journal: Nutr Diabetes Date: 2021-06-07 Impact factor: 5.097