Molecular prevalence of Theileria infections in cattle in Yanbian, north-eastern China.

Bovine Theileria are tick-borne protozoan parasites that invade bovine erythrocytes and lymphocytes. Three main bovine Theileria species have been identified in China: T. orientalis, T. sinensis, and T. annulata. To examine the prevalence of bovine theileriosis in Yanbian, a total of 584 bovine blood samples were collected from five localities from 2017 to 2019 and analyzed by PCR. Six pairs of oligonucleotide primers directed against the 18S rRNA gene of Theileria spp., Tams-1 gene of T. annulata, MPSP gene of T. orientalis, and T. sinensis, were used to detect these parasites. A sequence analysis of the amplified genes confirmed that the Theileria species were T. orientalis and T. sinensis, without T. annulata. The overall prevalence of Theileria in cattle was 42.81% (250/584). Out of the 584 samples, 159 (27.23%) and 157 (26.88%) were positive for T. sinensis and T. orientalis, respectively, and the mixed infection rate was 11.30% (66/584). The total prevalence of bovine Theileria species in Helong, Hunchun, Longjing, Yanji, and Dunhua was 66.28%, 49.68%, 23.81%, 28.15%, and 0%, respectively. These results provide epidemiological data for the prevention and control of bovine Theileria species in Yanbian, China. © L. Jia et al., published by EDP Sciences, 2020.

Introduction

Bovine theileriosis, which primarily causes fever, anaemia, jaundice, and superficial lymph node enlargement in infected animals, is a tick-borne haemoprotozoan disease caused by parasites of the genus Theileria, which invades bovine erythrocytes and leukocytes [12]. The prevalence and active regions of vector ticks are critical components of bovine Theileria species epidemiology. The disease, which is difficult to completely eliminate, is associated with obvious regional and seasonal epidemics. Severe infections of cattle result in death, which causes considerable economic losses and potential threats to the cattle industry [24]. It has currently been established that the causative agents of bovine theileriosis include Theileria parva, Theileria annulata, Theileria mutans, and Theileria velifera [15]. Theileria parva and Theileria annulata cause a higher mortality rate in cattle, and represent two of the most virulent species compared with the other reported Theileria species. Theileria annulata is widely distributed throughout Europe, the Middle East, Russia, China, and Africa [22], whereas Theileria parva, termed East Coast fever, is primarily distributed in Africa [1]. In these regions where the cattle industry has developed, the economic losses to the industry related to T. annulata are higher than the losses related to Theileria species.

In China, the reported bovine Theileria species mainly include T. orientalis, T. sinensis, and T. annulata [26], which are widely distributed and constitute a considerable threat. Theileria orientalis is a haemoprotozoan parasite that infects cattle and buffalo, and is typically transmitted by Haemaphysalis ticks [10]. Previous studies have referred to this parasite as T. sergenti, T. buffeli, or a mixture of T. orientalis, T. buffeli, and T. sergenti; however, T. sergenti has now been replaced by T. orientalis. Theileria sinensis exhibits relatively weak pathogenicity, and is primarily distributed throughout Asia (e.g., Japan, China, and the Korean Peninsula) [7]. Theileria sinensis in China was identified in cattle and yak distributed in Gansu and the Qinghai-Tibet Plateau; however, the pathogenicity of the parasite requires further research. Theileria sinensis was first isolated in Gansu, China by Bai et al. from cattle naturally infected with parasites. To determine the taxonomic status of the indeterminate Theileria species, this parasite was compared with other bovine Theileria species by Chinese scholars using morphological comparisons, inoculation tests, and host-specific tests, and was finally termed Theileria sinensis [3]. Theileria annulata is propagated by deadly tick species of the genus Hyalomma, and is widely distributed throughout North Africa, Southern Europe, India, the Middle East, and Central Asia [25]. The life cycle of T. annulata is highly complex, and involves two stages: (1) haploid vegetative propagation in cattle; and (2) diploid sexual reproduction in ticks [5].

Yanbian is located in north-eastern China in the Golden Triangle of north-eastern Asia, and is bordered by North Korea to the south, and Russia to the east. In this study, a total of 584 blood samples of cattle were obtained and tested for the molecular detection of bovine Theileria and species identification.

Materials and methods

Ethics

Farm owners were contacted and permissions were obtained to have their animals involved. All experimental procedures in animals were conducted following the Ethical Principles in Animal Research issued by Yanbian University.

Sample collection and DNA extraction

In total, 584 cattle blood samples were obtained from the following five counties in Yanbian between 2017 and 2019: Helong (172), Hunchun (157), Longjing (84), Yanji (135), and Dunhua (36). Approximately 10 mL of blood was aseptically collected from the jugular vein of each animal using vacuum tubes, and stored at −20 °C until DNA extraction. The DNA was extracted from the whole blood using a blood extraction kit (OMEGA) and then stored at −20 °C until future use.

Primer design and synthesis

According to the sequences for the Theileria spp. 18S rRNA [4], T. annulata Tams-1 [14], T. orientalis MPSP [16], and T. sinensis MPSP [13] genes, six pairs of primers were synthesized by Shanghai Yingjun Biotechnology Co., Ltd. The primer sequences are listed in Table 1.

Table 1

Primer sequences

Pathogen	Target gene	Assay	Oligonucleotide sequences (5′ → 3′)	Product size (bp)	Annealing temperature (°C)	Reference
Theileria spp	18S rRNA	PCR	GAAACGGCTACCACATCT	778	55	Cao et al. [4]
			AGTTTCCCCGTGTTGAGT
		nPCR	TTAAACCTCTTCCAGAGT	581	55
			TCAGCCTTGCGACCATAC
T. annulata	Tams-1	PCR	GTAACCTTTAAAAACGT	721	55	Martin-Sanchez et al. [14]
			GTTACGAACATGGGTTT
		nPCR	CACCTCAAAACATACCCC	453	60
			TGACCCACTTATCGTCC
T. orientalis	MPSP	PCR	CTTTGCCTAGGATACTTCCT	776	58	Ota et al. [16]
			ACGGCAAGTGGTGAGAACT
T. sinensis	MPSP	PCR	CACTGCTATGTTGTCCAAGAGATATT	887	56	Liu et al. [13]
			AATGCGCCTAAAGATAGTAGAAAAC

Bovine Theileria DNA amplification

Genomic DNA was used as a template for conventional PCR and nested PCR (nPCR) amplification (Table 1). Genomic DNA isolated from cattle infected with T. orientalis and distilled water were used as positive and negative controls, respectively. The PCR reaction was conducted in a 20-μL reaction mixture comprising 1.0 μL of each primer (10 pmol), 4.0 μL template DNA (50 ng/μL), 2.0 μL dNTP Mix (Baosheng Dalian Bioengineering Co. Ltd), 2.0 μL of 10 × Ex Taq buffer, 1 μL Ex Taq (Baosheng Dalian Bioengineering Co. Ltd), and 9 μL distilled water. The amplification conditions consisted of an initial denaturation step at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 45 s, an annealing step at the temperature set for each primer for 1 min, an extension step at 72 °C for 1 min, and a final extension at 72 °C for 7 min. The annealing temperatures are presented in Table 1.

Sequencing and phylogenetic analysis

Amplicons from positive PCR products were cloned into the PMD 18T-Simple Vector (Baoshengwu, Dalian, China) and transformed into competent DH5α cells. Plasmid DNA was extracted using a plasmid extraction kit (OMEGA), and further identified by PCR and double enzyme digestion by restriction endonucleases SaI I and BamH I (Baoshengwu, Dalian, China). The precisely identified products were sent to Shanghai Yingjun Biotechnology Company for sequencing.

The sequences correctly obtained from the present study were subjected to a BLAST analysis using the BLASTn programme in the NCBI GenBank. Multiple alignments and phylogenetic analyses of the obtained sequences of the 18S rRNA and MPSP genes of bovine Theileria were performed using Clustal W [20] (BioEdit version 7.0.9) and the maximum likelihood (ML) (MEGA version 7 software) and Bayesian (MrBayes version 3.2) methods [19]. The substitution model Tamura-3-parameter was used for maximum likelihood (ML) analyses. The search for the ML tree and bootstrap resampling with 1000 replications were performed using MEGA. In the Bayesian analysis, the GTR + G + I model (n = 6, rates = invgamma) was selected to perform for 106 generations with sampling every 103 generations and the initial 25% of the sampled trees were discarded as burn-in. The GenBank accession numbers of the relative species used in this study are shown in Figure 2.

Figure 2

Phylogenetic trees based on the (A) 18SrRNA and (B) MPSP sequences of bovine Theileria. The ML tree was derived from a Tamura 3-parameter model using MEGA7, and Bayesian Inference by Mrbayes3.2 with the GTR + G + I model. ML bootstrap and BI posterior probabilities values are shown at the nodes in the order ML/BI. Bootstrap values <50 are not reported. Posterior probabilities <0.7 are not reported. The newly generated sequences in the present study are shown in bold.

Results

Molecular prevalence of bovine Theileria

Primers designed from the Theileria spp., T. annulata, T. sinensis, and T. orientalis genes were used for detection of DNA in the 584 bovine blood samples by PCR. The PCR amplification results show that Theileria spp. PCR amplified two fragments consisting of 778 bp (P1, P2) and 581 bp (P3, P4). Theileria sinensis PCR and Theileria orientalis PCR amplified fragments consisting of 887 bp (P5, P6) and 776 bp (P7, P8), respectively. However, all of the blood samples tested negative for T. annulata. The PCR amplification results for Theileria spp., T. sinensis, and T. orientalis are shown in Figure 1A–D.

Figure 1

(A) and (B) Theileria spp. nested PCR, M: DL 2 000 DNA Marker, lain1: Positive control, lain2-13: Sample products, lain14: Negative control. (C) and (D) T. orientalis PCR and T. sinensis PCR, M: DL 2000 DNA Marker, lain1-13: PCR products of the target gene, lain14: Negative control.

Among the 584 sampled animals, the prevalence of T. sinensis and T. orientalis infection was 27.23% (159/584) and 26.88% (157/584), respectively. Additionally T. annulata was not found in our study. The mixed infection rate for T. sinensis and T. orientalis was 11.30% (66/584) in this study (Table 2).

Table 2

The single and mixed infection rates of Theileria spp. in cattle in Jilin, China.

	Helong (n = 172)				Hunchun (n = 157)		Longjing (n = 84)		Yanji (n = 135)		Dunhua (n = 36)		Total (n = 584)
	No. of positive		95% CI		No. of positive	95% CI	No. of positive	95% CI	No. of positive	95% CI	No. of positive	95% CI	No. of positive	95% CI
Single infection
T. sinensis	42		24.42 (18.60–31.35)	31		19.75 (14.27–26.66)	4	4.76 (1.87–11.61)	16	11.85 (7.43–18.39)	0	0 (0–9.64)	93	15.92 (13.18-19.11)
T. orientalis	44		25.58 (19.64–32.59)	25		15.92 (11.02–22.45)	8	9.52 (4.91–17.68)	14	10.37 (6.28–16.65)	0	0 (0–9.64)	91	15.58 (12.87–18.75)
Mixed infection
T. sinensis + T. orientalis		28	16.28 (11.51–22.52)	22		14.01 (9.44–20.30)	8	9.52 (4.91–17.68)	8	5.93 (3.03–11.26)	0	0 (0–9.64)	66	11.30 (8.98–14.13)
Total positive		114	66.28 (58.93–72.92)	78		49.68 (41.96–57.42)	20	23.81 (15.98–33.93)	38	28.15 (21.25–36.26)	0	0 (0–9.64)	250	42.81 (38.86–46.86)
Negative samples		58	33.72 (27.08–41.07)	79		50.32 (42.58–58.04)	64	76.19 (66.07–84.02)	97	71.85 (63.74–78.75)	36	100 (90.36-100)	334	57.19 (53.14–61.14)

Target gene cloning and identification

The recombined clone plasmids PMD18-T-Theileria spp., PMD18-T-T. sinensis, and PMD18-T-T. orientalis were constructed with positive PCR products and clone vectors. Three gene fragments comprised of 581 bp, 887 bp, and 776 bp were obtained by PCR. Positive clones of each target gene were digested with BamH I and SaI I, and 581 bp, 2692 bp, 887 bp, 2692 bp, 776 bp, and 2692 bp fragments were obtained.

Comparative analysis

The 18S rRNA gene of Theileria spp., T. orientalis MPSP gene, and T. sinensis MPSP gene were identified in this study. Nucleotide sequence identity data demonstrated that the sequence of the 18S rRNA (MN628025) gene shares 100% sequence identity with China (KX115427.1). The MPSP gene (887 bp) of T. sinensis isolated in this study was 100% identical to a previously published sequence from Jilin (KX375400.1). Similarly, the T. orientalis gene obtained in our study had 99.6% nucleotide homology with Jilin 2 (KY392962.1), and three nucleotide mutations were found. Representative T. orientalis and T. sinensis MPSP sequences for different strains were registered in the GenBank database under accession numbers: MN630024 – MN630031.

Phylogenetic analysis

Two phylogenetic trees of bovine Theileria were constructed from the 18S rRNA and MPSP gene sequences of our amplicons and those available in GenBank. ML and BI analyses generated phylogenetic trees with similar topologies. A single tree topology was presented with support values (ML/BI). The sequence of the 18S rRNA gene obtained from our study (MN628025) was 100% identical to that of Guo (MG784413.1) isolated from Haemaphysalis qinghaiensis. The 18S rRNA sequence of T. sinensis described here formed a well-supported clade with all the studied T. sinensis, while the other Theileria species belonged to different clades such as T. sergenti (Fig. 2A). Concerning the MPSP gene, the phylogenetic analysis showed evidence of three main clades, one consisting of T. sinensis and the others T. orientalis and T. annulata (Fig. 2B). The phylogenetic analysis indicated that the T. orientalis MPSP gene from this study formed one cluster with the isolates from Fujian (KY392963.1), Heilongjiang (KY392967.1), and Thailand (AB562572.1). The isolated T. sinensis formed one clade with Jilin (KX375400.1). In addition, the MPSP genes of the T. orientalis isolated in this study were classified near the cluster of T. sinensis rather than that of T. annulata.

Discussion

Theileria orientalis infection occurs most frequently from June to July and September to October, and is the type of bovine theileriosis that spreads most widely throughout China, including in Heilongjiang, Jilin, Hebei, Guangxi, Fujian, Gansu, and Qinghai [6, 11]. Theileria sinensis was first isolated from Lintao, China, and represents a new species that primarily infects cattle and yak, and is the most common in the middle region of Gansu Province. However, the prevalence of T. sinensis in other regions remains poorly understood [2]. Moreover, T. annulata is widely distributed throughout the world, including in Central Asia, North America, and South Africa. The distribution of this parasite in China mainly includes the desert and semi-desert grasslands in the northwest, as well as North China, Greater Khingan, and the Changbai Mountains in the northeast region. Among these regions, Xinjiang has the highest incidence of T. annulata. Bovine theileriosis is closely related to the activity of ticks and is characterised by seasonality and regionality, making it difficult to completely eliminate. Severe disease caused by bovine Theileria in cattle often leads to death, which causes massive economic losses and represents a potential threat for the cattle industry. Yanbian has a long border and is rich in vegetation resources in the eastern mountainous area. Pasture, forest, and barn environments are particularly suitable for tick breeding and reproduction. Therefore, there are various types of ticks in Yanbian including Haemaphysalis longicornis, Dermacentor silvarum, and Ixodes persulcatus, which are the major vectors responsible for transmitting bovine Theileria species.

Our results in Yanbian were that Helong had the highest prevalence of bovine Theileria species, followed by Hunchun, Yanji, and Longjing, whereas Dunhua had 0% prevalence. The difference in the positive rate of bovine Theileria species among these regions may be directly related to the various feeding conditions of cattle. This is because cattle in extensive grazing conditions have more opportunities to be exposed to vector ticks, which leads to an increased percentage of infection with bovine Theileria. In the present study, blood samples collected from Dunhua were from cattle in captivity, whereas the samples from the other four regions were collected from semi-grazing cattle, which may explain the low prevalence of bovine Theileria species in Dunhua. Furthermore, the Helong region is located in the Eastern Foot of the Changbai Mountains, where there may be an increase in the species and quantity of the ticks. Therefore, the higher prevalence detected in Helong may be closely related to the geographical location [17].

Molecular taxonomic data for bovine Theileria have been relatively absent in China. Since the Theileria spp. gene is a highly effective molecular marker sequence, the genotypes and phylogenetic analysis of these parasites are usually studied by researchers in China and abroad utilizing this gene [8]. The rates of infection found in our study were much higher than those for T. sinensis (17.5%), T. orientalis (10.9%), and co-infection with both parasites (8.8%) detected by Jia et al. [9]. In addition, T. sinensis was found to be primarily distributed in the high altitude regions of China, and is rarely found in the lower elevations of northern China [21]. In a previous study, T. annulata infection was reported in neighbouring countries and in southern China [23]; however, no infection was found in this study, which may be related to the distribution of tick species in the sampling areas. Due to the limited sample size and geographical sampling location, T. annulata infections were not found in our research, which does not mean that no T. annulata is present in Yanbian. Therefore, further investigation is required to clarify this finding.

Currently, considerable economic losses to the cattle industry have been caused by the widespread distribution of bovine Theileria in China, which also imposes significant constraints on the export of agricultural products [18]. To further understand the epidemic characteristics and regional distribution of bovine Theileria, the specimens collected from five counties in Yanbian were analysed by molecular detection. Moreover, positive specimens were assessed by sequencing and phylogenetic analysis utilising the Theileria spp. 18S rRNA, T. orientalis MPSP, and T. sinensis MPSP genes, which aimed to elucidate the epidemic strains of bovine Theileria species in Yanbian. These results show that T. orientalis and T. sinensis are two major epidemic strains in this region. The findings of this study provide scientific evidence for the prevalence and geographical distribution of bovine Theileria in the north-eastern frontier of China. This information is useful for the early prevention and control of bovine theileriosis, which can be used to reduce the harm caused by the disease in this region.

Conclusions

Theileria sinensis (27.23%) and T. orientalis (26.88%) were found in this study. The findings of our study indicated that Yanbian was an epidemic area of bovine theileriosis. Additionally, feeding conditions and the geographical position of farms are two potential risk factors for the prevalence of bovine theileriosis, which is supported by this paper.