Literature DB >> 32215178

Elevated Glutathione Peroxidase 2 Expression Promotes Cisplatin Resistance in Lung Adenocarcinoma.

He Du1, Bi Chen2, Nan-Lin Jiao3, Yan-Hua Liu4, San-Yuan Sun4, You-Wei Zhang4.   

Abstract

The aim of this study was to explore the roles of GPX2, a member of the glutathione peroxidase family (GPXs, GSH-Px), in cisplatin (DDP) resistance in lung adenocarcinoma (LUAD). GPX2 was found to be the most significantly upregulated gene in a DDP-resistant A549/DDP cell line compared with the parental A549 cell line by RNA sequencing. The knockdown of GPX2 expression in A549/DDP cells inhibited cell proliferation in vitro and in vivo, decreased the IC50 values of DDP, induced apoptosis, inhibited the activities of GSH-Px and superoxide dismutase (SOD), inhibited ATP production and glucose uptake, and increased malondialdehyde (MDA) and reactive oxygen species (ROS) production; while GPX2 overexpression in A549 cells resulted in the opposite effects. Using gene set enrichment analysis (GSEA), we found that GPX2 may be involved in DDP resistance through mediating drug metabolism, the cell cycle, DNA repair and energy metabolism, and the regulation of an ATP-binding cassette (ABC) transporters member ABCB6, which is one of the hallmark genes in glycolysis. Moreover, immunohistochemistry revealed that GPX2 was upregulated in 58.6% (89/152) of LUAD cases, and elevated GPX2 expression was correlated with high expression of ABCB6, high 18-fluorodeoxyglucose (18F-FDG) uptake, and adverse disease-free survival (DFS) in our cohort. The Cancer Genome Atlas (TCGA) data also indicated that GPX2 expression was higher in LUAD than it was in normal lung tissues, and the mRNA expression levels of GPX2 and ABCB6 were positively correlated. In conclusion, our study demonstrates that GPX2 acts as oncogene in LUAD and promotes DDP resistance by regulating oxidative stress and energy metabolism.
Copyright © 2020 He Du et al.

Entities:  

Year:  2020        PMID: 32215178      PMCID: PMC7079220          DOI: 10.1155/2020/7370157

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   6.543


1. Introduction

Lung cancer is the leading cause of cancer-related death worldwide in both men and women. Non-small cell lung cancer (NSCLC), which includes lung adenocarcinoma (LUAD) and squamous cell carcinoma, accounts for approximately 85% of overall lung cancer incidence [1]. Cisplatin (DDP) is a first-line chemotherapeutic DNA damage-inducing drug for lung cancer treatment. Currently, it is widely in use, despite new drugs being developed [2, 3]. However, resistance to DDP has become a key obstacle in the effective treatment of patients with cancer [4]. Therefore, an improved understanding of the molecular mechanism of DDP resistance is required for the treatment of lung cancer. For decades, glutathione peroxidases (GPXs, GSH-Px) have been known to catalyze the reduction of H2O2 and reduce lipid hydroperoxides to their corresponding alcohols by using glutathione (GSH) as a reductant [5]. The family of GPXs comprises eight members (GPX1–8) in mammals, five of which are selenoproteins in humans (GPX1–4 and 6); thus, their expression depends on the supply of selenium (Se) [6]. Most Se-dependent GPXs are downregulated in tumor cells, while only GPX2 is considerably upregulated in a majority of solid tumors including LUAD in smokers [6, 7]. Knockdown of GPX2 contributes to increase reactive oxygen species- (ROS-) dependent caspase activation in LUAD cells [8]. Huang et al. [9] also found YAP suppresses lung squamous cell carcinoma progression via downregulation of GPX2 and ROS accumulation. In our previous works, GPX2 was screened to be the most significantly upregulated gene in a DDP-resistant A549/DDP cell line compared with the parental A549 cell line by RNA sequencing (data not shown) [10], but its specific functions and potential mechanisms are not yet clear. Thus, in the present study, we aimed to further explore the roles of GPX2 in DDP resistance in LUAD.

2. Materials and Methods

2.1. Patients

This study enrolled 152 primary LUAD patients with a median age of 60 (range, 35–80) years at our institutes from 2010 to 2013, including 85 males and 67 females. Postoperative paraffin-embedded tumor tissues and corresponding normal tissues (>3 cm from tumor) from patients were used. Patients underwent an operation and received platinum-based doublets adjuvant chemotherapy after surgery. None of them received preoperative treatment, such as chemotherapy and radiation therapy. Tumor stage was assessed based on the 2017 tumor node metastasis (TNM) classification of malignant tumors by the American Joint Committee on Cancer (AJCC). Cellular differentiation was graded in accordance with the WHO grading system. There was an overall survival (OS) data for all patients, and 125 of them had disease-free survival (DFS) data. Preoperative positron emission computed tomography (PET/CT) scans were performed on 55 patients. The study was carried out according to the approved ethical standards of the ethics committee in our hospitals, and all the participants signed informed consent.

2.2. Cell Lines and Cell Culture

The human LUAD cell line A549 was purchased from Shanghai Institutes for Biological Sciences, Chinese Academy of Cell Resource Center. Cells were cultured at 37°C with 5% CO2 in RPMI 1640 medium (HyClone, Logan, UT, USA) with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. The construction and culture of a DDP-resistant A549/DDP cell line, primary LUAD cells' isolation, and culture and identification of DDP sensitivity have been described in our previous study [11].

2.3. RNA Sequencing

RNA isolation, cDNA library construction, and RNA sequencing were performed by Genergy Bio Company (Shanghai, China). Briefly, total RNA was extracted from A549 and A549/DDP cells using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA), and the quality of extracted RNA was assessed by a Bioanalyzer (Agilent, Waldbronn, Germany). Total RNA samples were treated with DNase I to remove potential genomic DNA, and the polyadenylated fraction of RNA was isolated for RNA-Seq library preparation. A TruSeq Stranded mRNA sample prep kit (Illumina, San Diego, California, USA) was used to construct the stranded libraries by following the manufacturer's instructions. All libraries were sequenced on an Illumina HiSeq 2500 sequencer (Novogene Bioinformatics Technology Co., Ltd., Beijing, China). Genes that were differentially expressed between A549 and A549/DDP cells were identified by DESeq2 R package. According to the results of DESeq2 analysis, genes were classified as differentially expressed when fold changes were more than two and the statistically calculated p value was less than 0.05. Three replicates were tested for each cell line.

2.4. Real-Time Quantitative PCR (qPCR)

Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific). Reverse transcription reaction was performed using 2 μg of total RNA with a PrimeScript™ RT reagent kit (catalogue no. RR037A, Takara Biotechnology, Dalian, China). Gene expression levels were measured using TB Green Premix Ex Taq™ II kit (catalogue no. RR820A, TaKaRa) and an ABI 7300 thermocycler (Applied Biosystems, Foster City, CA) at the following conditions: 1 cycle at 95°C for 20 min and 40 cycles at 95°C for 5 s and 60°C for 30 s; 10 ng of sample cDNA and HPLC-grade water (add 20 μl) were used. Glyceraldehyde dehydrogenase (GAPDH) and β-actin (ACTB) were used as reference genes. The specific primer sequences are as follows: GPX2-forward, 5′-GGTAGATTTCAATACGTTCCGGG-3′; GPX2-reverse, 5′-TGACAGTTCTCCTGATGTCCAAA-3′; GAPDH-forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′; GAPDH-reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′; ACTB-forward, 5′-CATGTACGTTGCTATCCAGGC-3′; and ACTB-reverse, 5′-CTCCTTAATGTCACGCACGAT-3′. Data analysis was performed using the 2−ΔΔCt method to determine relative expression levels of GPX2 [12].

2.5. Lentivirus Infection

Oligonucleotides encoding short hairpin RNA (shRNA) targeting human GPX2 (point 510-531 shRNA-1, 5′-GCACAGAAAGCACTCATTAAA-3′; point 1035-1056 shRNA-2, 5′-GCGAACCCTCTCGTTATAATC-3′) were cloned into a pLKO.1 lentiviral vector (Addgene, Cambridge, MA, USA). The cDNA encoding GPX2 was obtained by reverse transcription PCR (primer forward (EcoRI): CGGAATTCATGGCTTTCATTGCCAAGTCC; reverse (BamHI): CGGGATCCGATGGCTAAAGATTGTGAG) and then were cloned into a pLVX-Puro lentivirus vector (Clontech, Mountain View, CA, USA) for constructing pLVX-Puro-GPX2 expressing vector. A pLKO.1-scramble shRNA (shNC) and blank pLVX-Puro (vector) were used as negative control. Virus packaging was performed in HEK 293T cells after cotransfection of the lentiviral vectors constructed above with packaging plasmid psPAX2 (Addgene) and envelope plasmid pMD2.G (Addgene) using Lipofectamine™ 2000 reagent (Invitrogen, Grand Island, NY, USA). Viruses were harvested 72 h after transfection, and viral titers were determined. A549 cells or A549/DDP cells (1 × 105) were infected with 1 × 106 recombinant lentivirus-transducing units in the presence of 6 μg/mL polybrene (Sigma, Shanghai, China). Virus-containing culture medium was replaced with fresh RPMI-1640 medium at 12 h postinfection, then cells were selected using 0.5 mg/mL puromycin (Sigma) at 48 h postinfection.

2.6. Western Blotting

Proteins were extracted with a Nuclear and Cytoplasmic Protein Extraction kit (catalogue no. P0028, Beyotime, Shanghai, China). Cell protein lysates were separated by 10% sodium salt (SDS)-polyacrylamide gel electrophoresis (PAGE) and then electroblotted from the gels onto polyvinylidene fluoride (PVDF) membranes (Roche Diagnostics, Mannheim, Germany). After blocking the membrane with 5% nonfat milk powder and 0.1% Tween 20 in PBS for 1 h, the membrane was incubated with primary antibodies specific to GPX2 (catalogue no. ab140130), p21 (ab218311), Cyclin D1 (ab134175), Bcl-2 (ab185002), Bax (ab32503), cleaved caspase 3 (ab32042), and GAPDH (ab181602); all of which were acquired from Abcam (Cambridge, UK; the dilution for all was 1 : 1000). After extensive washing with blocking solution, blots were exposed to horseradish peroxidase-conjugated goat anti-rabbit IgG (catalogue no. ZB-2301, Zsbio, Beijing, China; 1 : 2500 dilution). Finally, the protein bands were imaged using an enhanced chemiluminescent (ECL) substrate (Merck Millipore, Hong Kong, China).

2.7. Gene Set Enrichment Analysis (GSEA)

GSEA was performed by using a JAVA program (http://software.broadinstitute.org/gsea/index.jsp) with MSigDB C2 CP: canonical pathways gene set collection. Firstly, based on their correlation with GPX2 expression, GSEA generated an ordered list of all genes and then a predefined gene set (signature of gene expression upon perturbation of certain cancer-related gene) received an enrichment score (ES), which is a measure of statistical evidence rejecting the null hypothesis that the members of the list are randomly distributed in the ordered list. Parameters used for the analysis were as follows: “c2.all.v5.0.symbols. gmt” gene sets to run GSEA, 1000 permutations to calculate p value, and the permutation type was set to gene set. The maximum gene set size was fixed at 1500 genes, while the minimum size fixed at 15 genes. GPX2 expression level was used as phenotype label, and “Metric for ranking genes” was set to Pearson correlation. All other basic and advanced fields were set to default.

2.8. Cell Viability and Proliferation Analysis

Cell counting kit-8 (CCK-8) assays were used to assess cell viability. In short, cells were seeded into 96-well plates for 0-48 h at an initial density of 2 × 103 cells/well. Next, 90 μl of fresh serum-free medium and 10 μl of CCK-8 reagent (catalogue no. C0037; Beyotime) were added to each well after decanting the old medium; then, the plates were incubated at 37°C for 1 h. The optical density (OD value) was measured at a wavelength of 450 nm by scanning with a microplate reader (Promega, Beijing, China). Using GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA, USA), IC50 values were calculated by a DDP concentration-response curve (concentration gradients 0, 2, 5, 10, 20, and 40 μg/mL for a 48 h treatment period).

2.9. Flow Cytometry for Measuring Apoptosis

Cells were harvested directly or 48 h after transfection and then were washed with ice-cold phosphate-buffered saline (PBS). Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kits (catalogue no. KGA108-1; Keygene Biotech, Nanjing, China) were used to detect apoptosis in a FACScan instrument (Becton Dickinson, Mountain View, CA).

2.10. Oxidative Stress and Metabolite Analysis

Cells were seeded into six-well plates (2 × 105 cells/well). After 24 h of incubation, the cells were stained with 10 μM 2,7-dichlorofluoresceindiacetate (DCFH-DA; catalogue no. C10443; Thermo Fisher Scientific) at 37°C for 30 min for ROS detection; then, cells were washed with medium, and the fluorescence was detected and analyzed by flow cytometry. Additionally, cells were pelleted and lysed in 0.5 mL of cell lysis solution (Beyotime) to evaluate oxidative stress according to the manufacturer's protocol of GSH-Px (colorimetric method, catalogue no. A001-1-2), superoxide dismutase (SOD; WST-1 method, catalogue no. A001-3-2), and malondialdehyde (MDA; TBA method, catalogue no. A003-1-1) assay kits (Jiancheng Bioengineering Ltd., Nanjing, China); then, measurements were performed with a microplate reader (wavelengths of 412 nm, 532 nm, and 450 nm, respectively). Cellular adenosine three phosphate (ATP) production was measured with an ATP assay kit (colorimetric method, catalogue no. A095-1-1; Jiancheng Bioengineering), and results were read by a UV-visible spectrophotometer (wavelength of 636 nm). Protein content was measured according to the Bradford method. Glucose uptake was detected with a 2-NBDG Glucose Uptake Assay kit (Cell-Based, catalogue no. K682-50; Biovision Technologies, Exton, PA) according to the manufacturer's protocol; the fluorescence intensity of 2-NBDG in the cells was recorded using a FACScan instrument (Becton Dickinson).

2.11. In Vivo Xenograft Model

Six-week-old male BALB/c nude mice were purchased from the Laboratory Animal Center of Nanjing Medical University and were maintained under pathogen-free conditions. Tumor xenografts were established by a subcutaneous injection of 0.1 mL of cell suspensions (2 × 106 cells/mL) into nude mice on the right side of the posterior flank (n = 6 mice per group). Tumor growth was examined every three days. After 5~7 days, the tumor volume grew to ≈100 mm3, and the mice were intraperitoneally injected with a suspension of PBS containing DDP (2.5 mg/kg) twice per week. All mice were sacrificed after 4 weeks. Tumor tissues were excised, paraffin-embedded, and formalin-fixed; then, they were used to perform H&E staining and to detect GPX2 expression. The entire experimental protocol was conducted based on the guidelines of the local institutional animal care and use committee.

2.12. Immunohistochemistry (IHC)

Formalin-fixed, paraffin-embedded tissues were cut to generate consecutive 4 μm sections, which were then subjected to IHC analysis. The sections were incubated with antibodies against GPX2 (catalogue no. ab140130, Abcam; 1 : 200 dilution) and ATP binding cassette subfamily B member 6 (ABCB6) (b224575, Abcam; 1 : 200 dilution) at 4°C overnight. After washing in PBS, sections were further incubated with a HRP-conjugated secondary antibody (catalogue no. ZB-2301, Zsbio; 1 : 500 dilution) for 30 min at 37°C. Then, the tumor tissues were incubated with a substrate-chromogen (DAB) solution for 10 min. Finally, automated hematoxylin was used to counterstain the slides for 5 min. The immunostaining was microscopically evaluated by two independent pathologists. A semiquantitative scoring system was used that is based on the staining intensity and the proportion of positive cells [13].

2.13. Statistical Analysis

The SPSS 16.0 software system (SPSS, Chicago, IL) was used for statistical analysis. p < 0.05 was considered to indicate a statistically significant difference. The data are expressed as the mean ± standard error. Differences between the 2 groups were analyzed using Student's t test. Differences in frequency were examined by χ2 test. Overall survival (OS) and disease-free survival (DFS) were calculated using the Kaplan–Meier method and were compared by log-rank testing. GPX2 expression was also verified using the Gene Expression Profiling Interactive Analysis (GEPIA) online tool (http://gepia2.cancer-pku.cn/).

3. Results

3.1. The Expression Status of GPX2 in DDP-Resistant LUAD Cells and Tissues

We first analyzed transcriptome differences between A549/DDP cells and the parental A549 cells by RNA sequencing. Integrated analysis with the Gene Expression Omnibus (GEO) data (E-GEOD-43493 and E-GEOD-43494) revealed that GPX2 was the most significantly upregulated member in A549/DDP cells (Supplementary ). The expression status of GPX2 in A549 and A549/DDP cells was then verified, both at the mRNA and protein levels (Figures 1(a) and 1(c)). Using primary tumor cell culture and drug susceptibility testing, 20 LUAD samples were identified to be DDP-sensitive (IC50 < 5 μg/mL), and 20 samples were identified to be DDP-resistant (IC50 > 10 μg/mL). qPCR results showed that the expression level of GPX2 was also upregulated in DDP-resistant tissues (Figure 1(b)).
Figure 1

GPX2 expression of in cisplatin- (DDP-) resistant lung adenocarcinoma cell lines and tissues. The expression status of GPX2 in A549/DDP cells and the parental A549 cells was verified at the mRNA (a) and protein (c) levels. (b) GPX2 expression was analyzed in primary tumor cells; 20 LUAD samples were considered to be DDP-sensitive (IC50 < 5 mg/L), and 20 samples were considered to be DDP-resistant (IC50 > 10 mg/L). (c) Lentiviral vector-meditated shRNAs were used to knock down GPX2 expression in A549/DDP cells, and a GPX2 overexpressed vector was transfected into A549 cells. (d) Western blot analysis of the expression levels of cell cycle and apoptosis-related proteins. ∗p < 0.05 and ∗∗p < 0.001.

3.2. In Vitro Effects of GPX2 Expression on DDP Resistance

To study the role of GPX2 in the regulation of DDP resistance, we used specific shRNAs to knock down GPX2 expression in A549/DDP cells, and a GPX2 overexpression vector was transfected into A549 cells (Figure 1(c)). GPX2 overexpression in A549 cells induced an increase of Cyclin D1 and Bcl-2 expression, and it induced an inhibition of p21, Bax, and cleaved caspase 3 expression; while GPX2 knockdown in A549/DDP cells caused the opposite effects (Figure 1(d)). Furthermore, GPX2 overexpression in A549 cells promoted cell proliferation (Figure 2(a)) and increased the IC50 values of DDP from 6.177 μg/mL to 22.15 μg/mL (Figure 2(b)); further, it inhibited apoptosis of A549 cells when they were treated with 10 μM (3 μg/mL) DDP (Figures 2(c) and 2(d)). However, GPX2 knockdown in A549/DDP cells inhibited cell proliferation (Figure 2(a)), decreased the IC50 values of DDP from 28.44 μg/mL to 5.751 μg/mL (shGPX2-1) or 5.811 μg/mL (shGPX2-2) (Figure 2(b)), and induced apoptosis with or without DDP treatment (Figures 2(c) and 2(d)). It is worth noting that low-dose DDP (10 μM) did not induce apoptosis in A549/DDP cells, but GPX2 knockdown in A549/DDP cells significantly increased cytotoxicity of DDP (increased apoptotic rate) (Figures 2(c) and 2(d)).
Figure 2

In vitro effects of GPX2 expression in DDP resistance. Using a CCK-8 assay, (a) cell proliferation and (b) the IC50 values of DDP were analyzed; ∗p < 0.05 vs. control. (c, d) Cell apoptosis was evaluated by flow cytometry, before and after 10 μM DDP treatment; ∗p < 0.05 vs. control (without DDP), ∗∗p < 0.05 vs. control (with DDP), △p > 0.05 vs. SiNC (without DDP), and #p < 0.05.

3.3. GPX2 Affects DDP Cytotoxicity In Vivo

Nude mice were separated into 4 groups (6 per group) according to which cells they were inoculated with (mock or GPX2 overexpressed A549 cells and mock or GPX2 knockdown A549/DDP cells). All the xenograft models were treated with DDP (2.5 mg/kg). Tumor volumes were significantly reduced in mice bearing A549/DDP cells with GPX2 knockdown as compared with mice bearing mock cells; while tumor volumes were increased obviously in mice bearing GPX2 overexpressing A549 cells in comparison with mice bearing mock cells (Figures 3(a) and 3(b)). GPX2 protein expression in the xenograft was verified by IHC (Figure 3(c)). These results indicate that knockdown of GPX2 enhances DDP cytotoxicity and overexpression of GPX2 promotes DDP resistance in vivo.
Figure 3

In vivo effects of GPX2 expression in DDP resistance. Cells (2 × 106 cells/100 μL PBS) were subcutaneously inoculated into the right flank of BALB/c nu/nu mice, and the animals were randomly separated into 4 groups (6 per group) according to which cells they were inoculated with. The mice were intraperitoneally injected with a suspension of PBS containing DDP (2.5 mg/kg) twice per week, after the tumor volume grew to ≈100 mm3. (a) The mice were sacrificed, and the tumors were isolated after 4 weeks. (b) The tumor size was monitored every 3 days after cells implantation. (c) Hematoxylin-eosin (HE) staining was performed, and GPX2 protein was detected by immunohistochemistry (magnification ×200). ∗p < 0.05.

3.4. Potential Mechanisms of GPX2 that Promote DDP Resistance

GSEA was performed to explore potential mechanisms by which GPX2 promotes DDP resistance. We found that high expression of GPX2 was positively correlated with an oxidative phosphorylation gene set (ES = 0.6776158, p = 0, FDR = 0), a drug metabolism cytochrome gene set (ES = 0.6787219, p = 0, FDR = 0), a reactome regulation of mitotic cell cycle gene set (ES = 0.62144023, p = 0, FDR = 0), a hallmark glycolysis gene set (ES = 0.47295266, p = 0, FDR = 0), a glycolysis and gluconeogenesis gene set (ES = 0.52196103, p = 0, FDR = 0), and a hallmark DNA repair gene set (ES = 0.4268115, p = 0, FDR = 0) (Figure 4). These events are all closely related to cisplatin resistance.
Figure 4

Gene set enrichment analysis (GSEA). GSEA showed that high expression of GPX2 is positively correlated with an oxidative phosphorylation gene set, a drug metabolism cytochrome P450 gene set, a reactome regulation of mitotic cell cycle gene set, a hallmark glycolysis gene set, a glycolysis and gluconeogenesis gene set, and a hallmark DNA repair gene set.

Moreover, overexpression of GPX2 in A549 cells significantly increased the activity of GSH-Px and SOD, increased ATP production and glucose uptake, and decreased MDA production, regardless of DDP treatment (Figure 5(a)) but only decreased ROS production with DDP treatment (Figure 5(b)). Knockdown of GPX2 in A549/DDP cells significantly inhibited the activity of GSH-Px and SOD, inhibited ATP production and glucose uptake, and increased MDA and ROS production, regardless of DDP treatment (Figure 5). It is worth noting that low-dose DDP (10 μM) did not induced the above changes in A549/DDP cells, but GPX2 knockdown in A549/DDP cells significantly induced these changes, indicating increased cytotoxicity of DDP (Figure 5).
Figure 5

Oxidative stress and metabolite analysis. (a) Cellular malondialdehyde (MDA) production, activity of glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD), adenosine three phosphate (ATP) production, and glucose uptake were analyzed in A549 cells and A549/DDP cells with or without DDP treatment. (b, c) Reactive oxygen species (ROS) testing by flow cytometry in A549 cells and A549/DDP cells with or without DDP treatment. ∗p < 0.05 vs. control (without DDP), ∗∗p < 0.05 vs. control (with DDP), △p > 0.05 vs. ShNC (without DDP), and #p < 0.05.

3.5. Elevated GPX2 Expression Predicts Poor Prognosis

To better understand the association between GPX2 expression and DDP resistance, GPX2 expression was assessed in 152 LUAD patients treated with platinum-based adjuvant chemotherapy. As ATP-binding cassette (ABC) transporter member ABCB6 is listed at the top of the hallmark glycolysis gene set (Supplementary ), we detected ABCB6 protein expression in cancerous tissues and corresponding adjacent tissues. GPX2 expression was upregulated (high expression, score ≥ 3) in 89 LUAD cases (58.6%), and it was correlated with high expression of ABCB6 (Pearson r = 0.697), as showed in analysis of serial sections (Figures 6(a) and 6(d)). In 55 patients who received a preoperative PET/CT scan, elevated GPX2 protein was more frequent in the high 18-fluorodeoxyglucose (18F-FDG) uptake patients than that with the low FDG uptake (Figures 6(a) and 6(c)). We further analyzed the mRNA expression of GPX2 in The Cancer Genome Atlas (TCGA) data using the GEPIA online tool. The result indicated that GPX2 expression was significantly higher in LUAD (n = 483) than that in normal lung tissues (n = 347), and mRNA expression levels of GPX2 and ABCB6 were positively correlated (Pearson r = 0.58) (Figure 6(b)).
Figure 6

Elevated GPX2 expression predicts poor prognosis. (a) GPX2 and ABCB6 proteins expression by immunohistochemical staining (magnification ×200) in lung adenocarcinoma (LUAD) patients with high and low 18-fluorodeoxyglucose (18F-FDG) uptake. (b) Using the GEPIA online tool, the mRNA expression of GPX2 between LUAD (n = 483) and lung tissues (n = 347) and relationship between GPX2 and ABCB6 mRNA expression in LUAD were analyzed. (c) High expression of GPX2 was correlated with high 18F-FDG uptake in LUAD patients. (d) Relationship between the IHC scores of GPX2 and ABCB6 in our cohort. (e) Univariate survival analysis of overall survival (OS) and disease-free survival (DFS) in our cohort with high expression of GPX2 protein compared with that of low expression. (f) Survival analysis of LUAD from The Cancer Genome Atlas (TCGA) database using the GEPIA tool.

GPX2 protein expression was not associated with patients' clinicopathological features in our cohort, including gender, age, size, cellular differentiation, lymph metastasis, and clinical stage (Table 1). By the end of follow-up, a total of 88 patients had died within 6 years after surgery. Univariate survival analysis showed that patients with high expression of GPX2 prefer to have inferior OS to that with low expression [56.94 months (95% CI 41.50–51.77) vs. 66.32 months (95% CI 57.857–74.778), p = 0.157] (Figure 6(e)). Within 125 patients for whom DFS data was available, high expression of GPX2 was associated with shorter DFS than low expression was [34.75 months (95% CI 29.746–39.747) vs. 48.91 months (95% CI 41.033–56.779), p = 0.009] (Figure 6(e)). Survival analysis from TCGA database also verified that the increased GPX2 mRNA levels in LUAD tend to be associated with shorter OS [hazard ratio (HR) = 1.3, p = 0.062] (Figure 6(f)). These data suggest that GPX2 may affect prognosis and platinum resistance in LUAD.
Table 1

Association between GPX2 expression in LUAD tissues and clinicopathological features.

CharacteristicsNo.High expression of GPX2 n (%) p value
GenderMale8552 (61.1)0.460
Female6737 (55.2)

Age<607140 (56.3)0.604
≥608149 (60.5)

Tumor size>3 cm6741 (61.2)0.557
≤3 cm8548 (56.5)

DifferentiationWell/moderate10256 (54.9)0.192
Poor5033 (66.0)

Lymph metastasisNo8144 (54.3)0.258
Yes7145 (63.4)

StageI/II6836 (52.9)0.206
III/IV8453 (63.1)

∗ p < 0.05.

4. Discussion

Overexpression of the GPX2 gene is observed in many cancers, such as breast [14], liver [15], gastric [16], colorectal [17], nasopharyngeal [18], and esophageal squamous cell carcinoma [19], as well as in premalignant lesions like Barrett's esophagus [20]. GPX2 expression has been implicated in tumor initiation, growth, development, and metastasis, and it is strongly correlated with low OS rates [13], which suggested that GPX2 acts as a bona fide oncogene. GPX2 has been proposed to reduce oxidative DNA damage by reducing hydroperoxides and redox-sensitive pathways, thus facilitating tumor growth [21, 22]. To date, no research has been reported regarding the clinical significance of GPX2 in DDP resistance. In the present study, we first found GPX2 was upregulated in the DDP-resistant LUAD cells and tissues, and elevated GPX2 expression was associated with adverse DFS for LUAD patients treated with platinum-based adjuvant chemotherapy. Functional experiments in vitro and in vivo further confirmed that GPX2 promotes LUAD development and DDP resistance via promoting proliferation, antiapoptosis, and mediating oxidative stress. The antitumor activity of cisplatin occurs due to free radical formation causing DNA cross-linking and apoptosis. We have found GPX2 can protect against oxidative damage, which is consistent with previous studies on DDP resistance. We also found by GSEA that GPX2 may be involved in DDP resistance through regulating drug metabolism, cell cycle, DNA repair, and energy metabolism by GSEA. An abnormal metabolic phenotype is a hallmark of cancer [23], but its roles in chemoresistance are not yet fully defined. Cancer cells, unlike normal cells, mainly depend on glycolysis to produce energy even in the presence of oxygen; this is referred to as the Warburg effect or aerobic glycolysis [24]. The cancer cell benefits from this strategy because glycolysis also provides substrates for anabolic processes, which is believed to offer a selective advantage for the proliferation and survival [25]. However, under some circumstances, cancer cells have the ability to adapt their metabolism to different environments and treatments, increasing adaptability and tumor resistance to therapies [26]. In this sense, an increase of mitochondrial oxidative phosphorylation (OXPHOS), the essential cellular process that uses oxygen, and simple sugars to create ATP, has been described for some tumors [27, 28]. ROS, the byproducts of aerobic metabolism, play critical roles in regulating the decision-making of both glycolysis and OXPHOS [29]. When cells are exposed to environmental stress and damaging agents such as DDP, intracellular ROS production dramatically increases and triggers the apoptotic machinery of cells [30]. To achieve oxidative stress balance, cells coordinate adaptive responses to regulate ROS production and antioxidant systems including SOD and GPXs. In the present study, GPX2 expression was found to reduce ROS insult, increase SOD/GPXs activity, increase ATP production, and increase glucose uptake. These data imply that GPX2 may mediate metabolic alterations of LUAD via ROS. ABCB6 is considered to be one of the hallmark genes of glycolysis, and we found that expression levels of GPX2 and ABCB6 in LUAD were positively correlated both in our cohort and in TCGA data. We also found GPX2 protein upregulation was more frequent in patients with high 18F-FDG uptake than that in low uptake patients, which further confirmed that GPX2 was involved in energy metabolism in LUAD. The human ABC superfamily of transporters facilitates translocation of heterogeneous substrates including metabolic products, lipids and sterols, peptides and proteins, saccharides, amino acids, inorganic and organic ions, metals, and drugs across the cell membrane. To transport both cytotoxic agents and targeted anticancer drugs across extracellular and intracellular membranes against a concentration gradient, ABCs use energy acquired by the hydrolysis of ATP and play important roles in multidrug resistance [31]. Minami et al. [32] have found expression of ABCB6 is related to resistance to 5-FU, SN-38, and vincristine in an arsenite-resistant human epidermoid carcinoma KB-3-1 cell line. In addition, ABCB6 has been associated with a broad range of physiological functions, including tumorigenesis and progression [33, 34] but has not been previously studied in LUAD. In the present study, we verified the correlation of ABCB6 and GPX2 expression in LUAD, but their interaction in glucose metabolism needs further study.

5. Conclusions

Our study demonstrates that GPX2 acts as oncogene in LUAD and promotes DDP resistance via mediating oxidative stress and energy metabolism, thus providing new insight into the mechanisms underlying GPXs and contributing to developments of LUAD treatments.
  12 in total

Review 1.  The beginning of GPX2 and 30 years later.

Authors:  R Steven Esworthy; James H Doroshow; Fong-Fong Chu
Journal:  Free Radic Biol Med       Date:  2022-07-05       Impact factor: 8.101

2.  Integrated Analysis of Glutathione Metabolic Pathway in Pancreatic Cancer.

Authors:  Xingui Wu; Ruyuan Yu; Meisongzhu Yang; Yameng Hu; Miaoling Tang; Shuxia Zhang; Ainiwaerjiang Abudourousuli; Xincheng Li; Ziwen Li; Xinyi Liao; Yingru Xu; Man Li; Suwen Chen; Wanying Qian; Rongni Feng; Jun Li; Fenjie Li
Journal:  Front Cell Dev Biol       Date:  2022-06-03

3.  Redox regulation of hybrid metabolic state in breast cancer metastasis.

Authors:  Kuldeep S Attri; Jun Hyoung Park; Benny Abraham Kaipparettu
Journal:  Ann Transl Med       Date:  2022-09

4.  Metallothionein MT1M Suppresses Carcinogenesis of Esophageal Carcinoma Cells through Inhibition of the Epithelial-Mesenchymal Transition and the SOD1/PI3K Axis.

Authors:  Dandan Li; Weiyan Peng; Bin Wu; Huan Liu; Ruizhen Zhang; Ruiqin Zhou; Lijun Yao; Lin Ye
Journal:  Mol Cells       Date:  2021-04-30       Impact factor: 5.034

5.  A redox probe screens MTHFD1 as a determinant of gemcitabine chemoresistance in cholangiocarcinoma.

Authors:  Ruogu Pan; Zhiqing Yuan; Yingbin Liu; Xuxu Sun; Guiyang Wang; Xiaopen Wang; Junwen Qu; Jie Yang; Yuzheng Zhao; Yi Yang; Jian Wang; Kewei Li
Journal:  Cell Death Discov       Date:  2021-05-01

Review 6.  Elucidating Role of Reactive Oxygen Species (ROS) in Cisplatin Chemotherapy: A Focus on Molecular Pathways and Possible Therapeutic Strategies.

Authors:  Sepideh Mirzaei; Kiavash Hushmandi; Amirhossein Zabolian; Hossein Saleki; Seyed Mohammad Reza Torabi; Adnan Ranjbar; SeyedHesam SeyedSaleh; Seyed Omid Sharifzadeh; Haroon Khan; Milad Ashrafizadeh; Ali Zarrabi; Kwang-Seok Ahn
Journal:  Molecules       Date:  2021-04-19       Impact factor: 4.411

7.  Polyacetylenes from Codonopsis lanceolata Root Induced Apoptosis of Human Lung Adenocarcinoma Cells and Improved Lung Dysbiosis.

Authors:  Meng-Chuan Wang; Yu-Fang Wu; Wen-Ying Yu; Bing Yu; Hua-Zhong Ying
Journal:  Biomed Res Int       Date:  2022-02-18       Impact factor: 3.411

8.  The Effect of GPX2 on the Prognosis of Lung Adenocarcinoma Diagnosis and Proliferation, Migration, and Epithelial Mesenchymal Transition.

Authors:  Yu-Peng Li; Rui Lin; Ming-Zhu Chang; Yi-Jiu Ai; Si-Ping Ye; Hui-Ming Han; Yao-Yue Zhang; Han Mou; Run-Hong Mu; Xiao Guo
Journal:  J Oncol       Date:  2022-07-18       Impact factor: 4.501

9.  Herbal formula LLKL ameliorates hyperglycaemia, modulates the gut microbiota and regulates the gut-liver axis in Zucker diabetic fatty rats.

Authors:  Mei Li; Lei Ding; Yu-Li Hu; Ling-Ling Qin; You Wu; Wei Liu; Li-Li Wu; Tong-Hua Liu
Journal:  J Cell Mol Med       Date:  2020-11-20       Impact factor: 5.310

10.  Anticancer Effects with Molecular Docking Confirmation of Newly Synthesized Isatin Sulfonamide Molecular Hybrid Derivatives against Hepatic Cancer Cell Lines.

Authors:  Mahmoud Eldeeb; Eman F Sanad; Ahmed Ragab; Yousry A Ammar; Khaled Mahmoud; Mamdouh M Ali; Nadia M Hamdy
Journal:  Biomedicines       Date:  2022-03-20
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.