Literature DB >> 32210489

Molecular Detection and Serotyping of Streptococcus pneumoniae in Children with Suspected Meningitis in Northeast Iran.

Sepideh Abdoli1, Saghar Safamanesh2,3, Mahsa Khosrojerdi4, Amir Azimian2,3.   

Abstract

BACKGROUND: To date, more than 90 Streptococcus pneumoniae (S. pneumoniae) capsular serotypes are known. The prevalence of these serotypes varies according to the geographical area and the regional vaccination program. Due to the lack of regular vaccination programs for S. pneumoniae in developing countries, serotyping of the prevalent isolates is useful in selecting the correct vaccine. The present study aimed to evaluate common serotypes of pneumococcal meningitis in Bojnurd, Iran.
METHODS: All cerebrospinal fluid (CFS) samples suspected for bacterial meningitis were analyzed. The samples were collected during 2014-2018 in the Laboratory of Imam Reza Hospital (Bojnurd, Iran). Due to the high rate of false-negative cultures, polymerase chain reaction (PCR) was used for the detection of lytA and psaA genes of S. pneumoniae. In addition, the modified Marimon's PCR method was used for serotyping the bacteria. The data were analyzed using Pearson's Chi-square test.
RESULTS: Out of the 901 CSF samples, 106 cases tested positive for S. pneumoniae using the PCR method, while only 92 cases tested positive using the conventional methods. Based on the Marimon's PCR method, serotypes 23F, 19F, 19A, 1, 14, and serogroup 6A/B were the most common types. Serogroups 18C, 15A/F, 15B/C, 9A/V, 7A/F, 11A/D/F, and 22A/F were also detected in isolates. Note that 2.8% of the samples were non-typable (NT).
CONCLUSION: The results showed that only 13 serotypes were responsible for all meningitis cases. Pneumococcal capsular vaccine-13 (PCV-13) is the preferred choice against common serotypes of S. pneumoniae in northeast Iran.The abstract was presented in Iran's 19th International Congress of Microbiology, as a poster and published in the congress abstracts book. Copyright: © Iranian Journal of Medical Sciences.

Entities:  

Keywords:  Meningitis; Serogroup; Vaccines; Streptococcus pneumoniae

Year:  2020        PMID: 32210489      PMCID: PMC7071549          DOI: 10.30476/IJMS.2019.45423

Source DB:  PubMed          Journal:  Iran J Med Sci        ISSN: 0253-0716


What’s Known Streptococcus pneumoniae is one of the major causative agents of meningitis in children. pneumococcal conjugate vaccine is one of the best methods to prevent pneumococcal disease. Pneumococcal capsular serotypes can vary in different geographical areas. What’s New The first attempt to evaluate the most common capsular serotypes in northeast Iran. Considering common capsular serotypes in Bojnurd (Iran), PCV-13 vaccine is the suitable choice for a vaccination program.

Introduction

Streptococcus pneumoniae (S. pneumoniae) is a Gram-positive coccus that can colonize the nasopharyngeal area without major clinical symptoms. Clinical manifestation of the bacteria ranges from otitis media and sinusitis to bacteremia, invasive pneumonia, and meningitis. [1 , 2]S. pneumoniae causes more than 14 million cases of invasive infections and approximately one million deaths annually among children in developing and underdeveloped countries. During 1999-2010, in the Asian-Pacific region, the incidence of pneumococcal disease among children aged under two years was about 150 cases per 100,000. [3] Meningitis is defined as the inflammation of meninges surrounding the brain and spinal cord. Infectious agents that cause bacterial meningitis are S. pneumoniae, Neisseria meningitidis, and Hemophilus influenzae. Of these, S. pneumoniae is the most common agent. It has various virulence factors such as streptolysin-O, IgA protease, and polysaccharide capsule. The bacterium has more than 90 capsular serotypes, but only a limited number is related to acute pneumococcal meningitis. [4] The mortality rate due to meningitis among children and adults is 25-73% and 20-30%, respectively, and the survivors often suffer from neurological complications and sequelae. [4] The adverse effect depends on the patient’s medical condition such as the underlying chronic disease, immune system, nutrition, etc. [5 , 6] Considering the high morbidity and mortality rates associated with pneumococcal infections, it is important to implement life-saving programs for the prevention, timely diagnosis, and treatment of pneumococcal diseases. As part of a national vaccination program, two types of vaccines are currently used in developed countries, namely pneumococcal capsular vaccine-10 (PCV-10) and pneumococcal capsular vaccine-13 (PCV-13). These vaccines contain serotypes [1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F] and [1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F], respectively.[7] The production of PCV-7, the previous type of PCV vaccine, has already been stopped. In some developing countries, such as Iran, pneumococcal vaccination is not included in the national vaccination program. Therefore, data on serotypes causing invasive pneumococcal infections are not readily available since vaccination is carried out locally in Iranian public and private hospitals. [4 , 8] Patients with suspected meningitis are typically viewed as emergency cases and physicians immediately proceed with empirical anti-microbial therapy and obtain cerebrospinal fluid (CSF) for laboratory evaluations. In some cases, the CSF culture could be negative while other tests (e.g. serological and molecular diagnostic) could be positive. Consequently, methods such as polymerase chain reaction (PCR) and multiplex PCR are also used. [9] Since the prevalence of serotypes causing invasive pneumococcal infections varies in different geographical areas, we focused our study on patients suspected of meningitis in Bojnurd, Iran. Using the molecular method, we evaluated CSF samples for pneumococcal serotypes to recommend a regional vaccination program.

Materials and Methods

An observational and descriptive study of CSF samples from patients with suspected meningitis was conducted in the Laboratory of Imam Reza Hospital, Bojnurd, Iran. The samples were collected during 2014-2018 from children aged <5 years with an increased level of C-reactive protein (CRP) or with fever and CSF leukocytosis. The samples were evaluated for S. pneumoniae using conventional methods, including CSF sediment gram staining, microscopic evaluation, and culture. The PCR assay was performed using lytA (N-acetylmuramoyl-L-alanine amidase) and psaA (pneumococcal surface adhesin A) as marker genes. In addition, capsular serotypes were determined using the modified Marimon’s multiplex PCR method for wzy, wchE, and wciN beta genes. The inclusion criteria were different physical examinations for children <12 months and for those between 12 months and 5 years old, such as bulging fontanel, nuchal rigidity, and positive Brudziński signs. The general inclusion criteria were increased levels of CRP, CSF leukocytosis, CSF protein; reduced level of CSF glucose; and physical signs of fever, neck stiffness, vomiting, headache, etc. The exclusion criterion was a previous PCV vaccination. The data were analyzed with Pearson’s Chi-square test using SPSS software (version 22.0). P<0.05 was considered statistically significant. The study was approved by the Ethics Committee of North Khorasan University of Medical Sciences, Bojnurd, Iran (code: 95/P/970). Written informed consent was obtained from the parents of the children.

Genomic DNA Extraction

Total genomic DNA of the CSF samples was extracted using QIAamp® DNA Blood mini kit (QIAGEN, Germany). In accordance with the manufacturer’s instruction, lysozyme at the concentration of 20 units/ml (SinaClon, Iran) was added to the lysis buffer. To obtain better results, based on a previous study, [10] the CSF samples were centrifuged at 8,000 rpm for 3 minutes and then used as the precipitants for DNA extraction. [10]

PCR Assay

The PCR assay was performed using the TAKARA PCR thermal cycler Gradient TP600 (TAKARA, Japan). For all PCR reactions, EmeraldAmp® MAX PCR Master Mix 2X (Takara, Japan) in a volume of 50 µl was used.

PCR Assay for Detection of S. pneumoniae

The lytA and psaA genes were selected as marker genes for the detection of S. pneumoniae. PCR was performed with the following sequences: primary denaturation at 94 °C for 5 minutes, 35 cycles of amplification (denaturation at 94 °C for 30 seconds, annealing at 58 °C for 30 seconds, extension at 72 °C for 30 seconds), and a final extension at 72 °C for 7 minutes. ATCC® 33400 reference strain was used for PCR optimization and to determine the limit of detection (LOD) of the triplex PCR method. The third set of primers was added to the reaction as the internal control for preventing false-negative results. Specific primers were used as the control for the recognition of the human beta-globin gene. The list of primer sequences is described in table 1.
Table 1

Primer sequences for detection of S. pneumoniae

Primer SequencesizeReference
lytA 1 forward5’-CCATTATCAACAGGTCCTACC-3’187 bp3Present study
lytA reverse5’-TAAGAACAGATTTGCCTCAAG-3’
PsaA 2 forward5’-GCCCTAATAAATTGGAGGATCTAATGA-3’114 bpJourdain et al.[12]
PsaA reverse5’-GACCAGAAGTTGTATCTTTTTTTCCG-3’
Beta-globin forward5’-GAAGAGCCAAGGACAGGTAC-3’268 bpPresent study
Beta-globin reverse5’-CAACTTCATCCACGTTCACC-3’

N-acetylmuramoyl-L-alanine amidase,

S. pneumoniae surface adhesin A precursor,

Base pair

To assess the LOD, 10-fold serial dilutions (equivalent to 107-101 copies) of a pneumococcal reference strain ATCC® 33400 were prepared using tested sterile CSF as a solvent (due to the presence of human cells containing the beta-globin gene as the internal control) and the extracted DNA was tested by triplex PCR protocol. In positive reactions, the bands 268 (internal control), 187 (lytA), and 114 bp (psaA) were observed (figure 1). In negative reactions, only the internal control band (268 bp) was observed (table 2). The primers were evaluated using the software packages AlleleID 6.0 (Biosoft International, Palo Alto, CA, USA) and Oligo 6.0 (Life Science Software Resource, Minnesota, USA). The reactions without any PCR product bands were false-negative and the results were not reliable (table 2). As shown in figure 1 and table 3, the mean LOD of the reaction after triplicate testing was between 101-102 colony-forming unit (CFU).
Figure 1

Agarose gel electrophoresis of triplex PCR on standard samples. The 268 bp, 187 bp, and 114 bp bands belong to beta-globin, lytA, psaA genes, respectively. Lanes, 1: 100 bp ladder; 2: 107 copy; 3: 106 copy; 4: 105 copy; 5: 104 copy; 6: 103 copy; 7: 102 copy; 8: 101 copy of S. pneumoniae genome

Table 2

Interpretation of S. pneumoniae detection PCR results

InterpretationBeta-globin: 268 bp lytA: 187 bp psaA: 114 bp
Unacceptable---
S. pneumoniae -+--
S. pneumoniae ++++
Table 3

Determination of LOD using the PCR method

NumberStandardCFUResult
1S1107+
2S2106+
3S3105+
4S4104+
5S5103+
6S6102+
7S7101-

CFU: Colony-forming unit (mL)

Primer sequences for detection of S. pneumoniae N-acetylmuramoyl-L-alanine amidase, S. pneumoniae surface adhesin A precursor, Base pair Agarose gel electrophoresis of triplex PCR on standard samples. The 268 bp, 187 bp, and 114 bp bands belong to beta-globin, lytA, psaA genes, respectively. Lanes, 1: 100 bp ladder; 2: 107 copy; 3: 106 copy; 4: 105 copy; 5: 104 copy; 6: 103 copy; 7: 102 copy; 8: 101 copy of S. pneumoniae genome Interpretation of S. pneumoniae detection PCR results Determination of LOD using the PCR method CFU: Colony-forming unit (mL) The PCR was also performed on 51 clinical isolates of S. pneumoniae and all reactions tested positive for lytA and psaA genes; indicating 100% sensitivity. For the specificity evaluation, PCR was performed using the extracted DNA from Haemophilus influenzae (ATCC51907), Neisseria meningitidis (ATCC13077), Staphylococcus aureus (ATCC19323), Streptococcus viridance (ATCC6249), Enterococcus fecalis (ATCC29212), Enterococcus faecium (ATCC700221), Escherichia coli (ATCC25922), Streptococcus agalactiae (ATCC13813), Listeria monocytogenes (ATCC19115), Pseudomonas aeruginosa (ATCC10145), and Mycobacterium tuberculosis (ATCC25177). All reactions were negative.

Multiplex PCR for Determination of Capsular Serotypes

The primers used for the amplification of various capsular types (wzy, wchE, and wciN genes) are listed in table 4. Marimon’s method was modified and adapted to the conventional PCR and agarose gel electrophoresis settings. [9] Originally, Marimon designed 55 sets of primers for evaluation with a capillary electrophoresis system. However, in the absence of such a system, due to the similar size of the PCR products of different primer pairs in the Marimon’s method, we performed the evaluation with the conventional PCR and electrophoresis. The 55 pairs of primers were grouped into nine separate multiplex reactions based on the difference in their PCR product size. The optimum difference in size for detection in agarose gel electrophoresis was about 100 bp. In some cases, when grouping based on product size was not possible, the PCR products were evaluated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The PCR thermal cycling condition was 15 minutes at 95 ºC; 35 cycles of 60 seconds at 95 ºC, 60 seconds at 58 ºC, and 60 seconds at 72 ºC; and a final extension step of 10 minutes at 72 ºC.
Table 4

Primer sequences for serotyping of S. pneumoniae

ReactionSerotypeSize (bp)ForwardReverse
11484CCGTCTTTTTGTATGGTGCTATGTGAACAGCCAATCCATCAATCAG
22A, 22F181ACGTATAGGACGTTTCTCAATCCATCCCGAAACCAAATTGCTATCC
33C278CGGCAGGTATAAGTATTATCGGCCTACACCTCTTATAAACGTTGG
35F, 47F375TTGCTACAGTTTTGATGTATCTCCAGAATCCGTTTCATCATACAGCC
6C, 6D473GTCGTGTAAAGTAGTATACAATCCATAATCCTCTGGATTATCCACCC
24A, 24B, 24F569TCATGCTTATGTTATGTGTTACGGGTGAGAGCTATATTTAGAACATGG
23B650TTGCATATGGATTTAATGGTGGGACCATTGCTGATAGAAGTAGAGG
2894ATTAGCTGCATACGCAAGAACCATTAGCTGCATACGCAAGAACC
3191AGAAATGCTATCCGCGTTGGGTTGTCACGAGATTACGCTCAGG
20292TATTGTTCCGAAAAAAGAGTGGGTACTCAAAGATTGTGTGGTACGG
11B, 11C392TAGAAATCGCAAGATAGCCTTCCCTGATTATGAGCATAGTTGATCC
7A, 7F491TTGACTGCAAGTGTTTCAATGGGAAAGCACAAAATATTGGAACGAGG
28A, 28F578AGGTAGACTACCAATTTCAATTCCTACACCTGCTAATATCAATGTTCC
37B, 7C, 40101TTATTTTTTAGAAACATTAAAACTCAACAATCATCTCTATTCGACC
15B, 15C201CGGATGATTGTAGCGTTTTATCCACTGTAGATTGTGTTCTGATTCC
31301TTTCAAGGATATGATAGTGGTGGTAGCATTACAGATGTCACTAAGG
17F402TCTTGTCAAATACATACTTACCCCGTAGTCTCGCATTTCTATCATCC
16A501GTTATGATAATGGTAACGCCTCCCAGCCAATAAGTCATATACGCC
15A, 15F598ATGAGAGGAAGATATATACTGGGAAATAAGTTGTCCCATAGGAAGG
49L, 9N111CACTGTTGGCTATGTTAGCCTCCTCTCCACGTGGCCAATATAC
6A, 6B, 6C, 6D211GAAGTAGAAAATCGTGTAAGTGGTCCAACAACTAACCTTATAAGGG
23A314CTAGGTTCGTATCTCTTTGCGGTACCAAATGGGTAATGGAGGGG
41A, 41F413AGTTACTGGCCCTTTCTTATTCCAGGTAAAAAGTCATATCCATTCCC
19F523TGTTCTTAGTAATGGATATACGGGAAAACTTCACCAGGATCTAATGG
17A615TTTACCCAAGAATGGTTTCTAGGAGCATAACAGTTTGCGCTATTGG
521122TTATGCTGGTTTAAATATCGCTCCTAACAAATATGCCAAAACGTAGCC
34130TGTAAGAGGAGATTATTTTCACCCGTCACAATAAAAACTGTACCTCC
25A, 25F, 38140CAACACAATGTCTTATTGCAGCCAACGCACCCCAAAATAACTTTCC
27240AATGCCGACGATTAATGCAGCCCTAGCCATGCTGGATATTTCCC
19B, 19C338TCAGTACGAATAGATGGAACACCCCCAGTATCTAAATCCTAATCCC
4433ATTCAGAGGCAGCTAGTTCAGGCAGAAGCTACTGTTAGGCTGG
48532CCCTTTGATAGCTATAGTATCGGCCCTGGAATAGAAGTTTTCTAGG
12A, 12B, 12F, 44, 46627CCTTTCTGATTCGTCCAGTTCCAGTTGAACCAACTCCCCATCC
610A, 10B, 0C, 10F151CRATGAGGCTATATGTTGGAATAGGTATTGAACYCATAGATAACAGAG
29251TGTGGCAAAAATTTCTTTAGCGGATATACCCAGTAAACAGACAAGG
11A, 11D, 11F348GGACATGTTCAGGTGATTTCCCTGCGCCAAATTTGGTATCGACC
5443TTATCTATTTTATCGCAGACTCCCCTGCCGATAAAAAGATAGATGCC
39544TATGAGGTATCATTTAGCAGGGGATCATCGAAATGGCAACTAAAGG
33B, 33D640ACAACAGCAATGTTGTTGTTACTCGAGAAGTAAGAGTTTTGTCATCC
743160GGAATAGTTTAGGATTTGTACACCTAGAGTCTGCTAACTGTAATATCC
23F260TTCACAAGTGATAGTGAACTTGGTATTAGCTTTATCGGTAAGGTGG
32A, 32F357CTTACAATGAGACGCTATTTTCCGTTATTACCATTGAATTCGTTCCC
33A, 33F, 37453ATGTTAGATTAGATGGTTTGCTGGATTCAACACATAAACCGTTGGGG
1555TTTGCTAGATGGTGAGTTTGTATCTTTAGAAGCTGCATTGTACTACTC
36230TTCCGGATCTATTCAATTTCCCCCAATAACAGCCTCCGTTTTACC
2383GTTCAATATTTCTCCACTACACCCTAAGAGTTCCAATACGTTGACC
35B483CATTAGTGTTGCTATGTTGTTCCGATTAGATAAATAAATACGCCCCC
16F606ACTGCTTGCATATTAGCTTTATGGTGATAGAGTGACAGAACAATTGG
89A, 9V172GATCAATGGCAACTATATTTACCCGATTCACTGTCTGACTTTGAACC
19A269ATTGGAGTAGCTGAGGTTTTTGGTATCCAATTTAAAACCAGCACGG
35A, 35C, 42367TCGTTCACCTACTTTATTAATGCCAATAATTCCTAATACCATCTGCCC
45463CAGATTGGTTTTCACATCACTCCACATAACACGACTTTTAGTGACC
918A, 18B, 18C, 18F220AGTCTTACTAGACGTAATGAACCAAGATAAATTGACTAAGTCCTCCC
13328TTAACAGGTAGATTACGACTTGGATATCCCAAAAACAAAATCGCTGG
47A423AATACATTGTACGTCTTTAACCCCCGAAGAATTAAACCCACATAACC

bp: Base pair

Primer sequences for serotyping of S. pneumoniae bp: Base pair

Results

Out of the 901 CSF sample, 92 cases tested positive for S. pneumoniae in culture and 106 cases tested positive for lytA and psaA genes using the molecular detection method. It should be noted that all the 92 culture-positive samples also tested positive in PCR. Of the 106 (11.8%) positive samples, 50 (47.2%) and 56 (52.8%) isolates were from female and male patients, respectively. There was no significant correlation between sex and S. pneumoniae isolation (P=0.92). Based on the primer pair combinations in table 1, all positive samples were evaluated for capsular serotypes using the modified Marimon’s multiplex PCR method. As shown in figure 2, the types 23F, 19F, 19A, 1, 14, and group six were the most common serotypes and groups in our samples. It should be noted that 2.8% of the samples were Non-typable (NT). The results for capsular serotypes and their distribution are presented in figure 2 and table 5.
Figure 2

Serotype distribution among S. pneumoniae strains.

Table 5

Serotype distribution among S. pneumoniae strains in different years

2014-2015n (%)2015-2016n (%)2016-2017n (%)2017-2018n (%)Totaln (%)
Number of S. pneumonian [+, %]160 [16, 10]163 [19, 11.7]278 [29, 10.4]300 [42, 14]901
S. Pneumoniae +a16 (15.1)19 (17.9)29 (27.4)42 (39.6)106 (11.8)
Womenb10 (62.5)8 (42.1)16 (55.2)16 (38.1)50 (47.2)
Menb6 (37.5)11 (57.9)13 (44.8)26 (61.9)56 (52.8)
Serotypec23F3 (15)5 (25)4 (20)8 (40)20 (18.9)
19A2 (15.4)3 (23.1)4 (30.8)4 (30.8)13 (12.3)
19F4 (23.5)3 (17.6)5 (29.4)5 (29.4)17 (16)
18C01 (25)1 (25)2 (50)4 (3.8)
6A/B3 (21.4)2 (14.3)4 (28.6)5 (35.7)14 (13.2)
15B/C001 (50)1 (50)2 (1.9)
141 (11.1)2 (22.2)2 (22.2)4 (44.5)9 (8.5)
9A/V1 (20)1 (20)1 (20)2 (40)5 (4.7)
15A/F0001 (100)1 (0.9)
7A/F0002 (100)2 (1.0)
12 (18.2)1(9.1)4 (36.4)4 (36.4)11 (10.4)
11A/D/F002 (66.6)1 (33.3)3 (2.8)
22A/F0002 (100)2 (1.9)
NT01 (33.3)1 (33.3)1 (33.3)3 (2.8)

Number of positive cases;

Number of positive cases in female or male patients;

Number of positive cases of each serogroup or serotype; NT: Non-typable

Serotype distribution among S. pneumoniae strains. Serotype distribution among S. pneumoniae strains in different years Number of positive cases; Number of positive cases in female or male patients; Number of positive cases of each serogroup or serotype; NT: Non-typable

Discussion

Serotypes 23F, 19F, 1, 14, 19A, and serogroup 6 were the most common types in Bojnurd, Iran. PCV13 had the optimal coverage for children aged ≤5 years in this area. The Quellung reaction (Neufeld test) is the accepted gold standard method for S. pneumoniae serotyping. However, a number of factors (e.g., costs, the need for operational expertise, potential false-negative cultures especially in meningitis cases) hindered its use in clinical laboratory settings. [11] Molecular assays have recently been developed to identify the invasive pneumococcal disease (IPD) associated with serotype distribution. [9 , 12] Consequently, we used the modified Marimon’s molecular method for serotyping S. pneumoniae. A limited number of capsular serotypes were related to most of the IPDs. [13] In the present study, we found 13 serotypes, which were responsible for all meningitis cases. Note that 2.8% of the isolates were NT. During the last two years, the prevalence of some serotypes (9A/V, 15A/F, 7A/F, 1, 11A/D/F and 22A/F) has increased in Bojnurd, Iran. Studies in the USA, UK, and Brazil have reported that only a few pneumococcal serotypes were related to the colonization and invasive diseases, [14 - 16] whereas a wide variety of such serotypes were identified in Asia. [17 , 18] The serotypes 23F, 14, 19F, and 6B were predominant in East and Southeast Asia prior to the PCV vaccination. [3] Several studies have reported that serotypes 1, 4, 6A/B, 7F, 9V, 14, 15B/C, 18C, 19F, 19A, and 23F account for more than 80% of the IPD in children, especially in developing countries without any routine pneumococcal vaccination programs. [19 - 22] In the absence of such programs in Iran, we managed to identify the presence of serotypes 23F, 19A, 19F, 18C, 14, 1, and serogroups 6A/B, 15B/C, 9A/V, 15A/F, 7A/F, 11A/D/F, and 22A/F. In line with other studies, [1 , 4 , 23 - 26] we found that the most prevalent serotypes in meningitis cases were 23F, 19A, 19F and 6A/B, which could be controlled with the PCV-13 vaccine. In contrast, Talebi and colleagues reported that the most common serotypes in pneumococcal isolates were 14 and 3, followed by 23F and 19F. [27] Some researchers believe that the common serotypes in infants are different from those found in adults. A previous study reported that the serotypes 6 and 19 were common in IPD related isolates and the 23-valent vaccine was best for adults. [28] Moreover, in another study, they reported serotype 6 was most prevalent in adults, but serotype 19 in infants. [29] Dashti and colleagues reported that the most prevalent serotypes were 19, 6, 14, 17, 20, 23, and 21 in nasopharyngeal carriers under 10 years old in Tehran (Iran). [30] Another study reported that four serotypes of 19A, 6, 3, and 23F were common in both the carrier and clinical samples at a rate of at least 91%. [13] Gharailoo and colleagues reported that the serotypes 6A/B, 19A, 19F, and 23F were the common types of nasopharyngeal carriers, [31] whereas another study reported that the most common serotypes in nasopharyngeal carrier children were 19F, 6A/B, 15A, 11, 23F, 1, 19A, and 35B. [32] Based on the above-mentioned studies, we deduced that the source of meningitis related to pneumococcal serotypes was the nasopharyngeal area. Overall, the data showed that serotypes 6A/B, 14, 18C, 19F, 19A, and 23F were the most prevalent serotypes in Asia, especially in non-immunized areas. We found that PCV-13 vaccine is the best candidate against common serotypes of meningitis-related S. pneumoniae strains. This vaccine is readily available in Iran and covers 77.13% of the most common serotypes in our region, especially 23F, 19A, 19F, and 6A/B. On the other hand, PCV-10 vaccine covers 65.06% of the serotypes but excludes the two major serotypes 19A and 6A. None of these vaccines could cover serotypes 22, 7, 15A/F, 15B/C, and 11. The present study was the first attempt to identify the distribution of serotypes in Bojnurd. Serotyping on more specimens is recommended to determine the extent of their coverage and evaluate the effectiveness of the vaccine.

Conclusion

The high pathogenicity of S. pneumoniae in different age groups and the increasing antimicrobial resistance are alarming. The management of this pathogen is essential to protect lives and to reduce therapeutic treatment costs. PCV-13 vaccine is the preferred choice in northeast Iran. More research on serotypes in different geographical regions allows the design of a nationwide vaccination program. Further studies on capsular serotyping, antimicrobial susceptibility testing, and molecular epidemiology should provide a better understanding of common pneumococcal types and allow choosing optimal therapeutic strategies in Iran.
  30 in total

1.  Ten-year surveillance of invasive Streptococcus pneumoniae isolates in central Turkey prior to the introduction of a conjugate vaccine.

Authors:  Duygu Percin; Yasemin Ay Altintop; Bulent Sumerkan
Journal:  J Infect Dev Ctries       Date:  2010-10-04       Impact factor: 0.968

2.  Pneumococcal nasopharyngeal colonization in young South Indian infants.

Authors:  C L Coles; R Kanungo; L Rahmathullah; R D Thulasiraj; J Katz; M Santosham; J M Tielsch
Journal:  Pediatr Infect Dis J       Date:  2001-03       Impact factor: 2.129

Review 3.  Prevnar (heptavalent pneumococcal conjugate vaccine): disease prevention in infants and children.

Authors:  B Shields
Journal:  J Pediatr Health Care       Date:  2001 Jul-Aug       Impact factor: 1.812

4.  Distribution of capsular types and drug resistance patterns of invasive pediatric Streptococcus pneumoniae isolates in Teheran, Iran.

Authors:  Hamidreza Houri; Sedigheh Rafiei Tabatabaei; Yasaman Saee; Fatemeh Fallah; Mohammad Rahbar; Abdollah Karimi
Journal:  Int J Infect Dis       Date:  2017-01-25       Impact factor: 3.623

5.  Invasive pneumococcal diseases in children in Hokkaido, Japan from April 2000, to March 2015.

Authors:  Hiroshi Sakata
Journal:  J Infect Chemother       Date:  2015-10-23       Impact factor: 2.211

6.  Serological and molecular capsular typing, antibiotic susceptibility and multilocus sequence typing of Streptococcus pneumoniae isolates from invasive and non-invasive infections.

Authors:  Yi-Jie Zhang; Yu-Shen Chen; Zhan-Wei Wang; Yu-Qian Li; Da-Xuan Wang; Ying Shang; Rong-Rong Fu; Ying-Hui Hu; Rong Geng; Li-Ping Wei; Jing-Ping Yang; Jia-Shu Li; Qin Yu; Juan DU; Zhan-Cheng Gao
Journal:  Chin Med J (Engl)       Date:  2013-06       Impact factor: 2.628

7.  Sequential multiplex PCR assay for determining capsular serotypes of colonizing S. pneumoniae.

Authors:  Sarah Jourdain; Pierre-Alexandre Drèze; Jozef Vandeven; Jan Verhaegen; Laurence Van Melderen; Pierre R Smeesters
Journal:  BMC Infect Dis       Date:  2011-04-20       Impact factor: 3.090

Review 8.  Clinical implications of pneumococcal serotypes: invasive disease potential, clinical presentations, and antibiotic resistance.

Authors:  Joon Young Song; Moon H Nahm; M Allen Moseley
Journal:  J Korean Med Sci       Date:  2013-01-08       Impact factor: 2.153

9.  Isolation of Asian endemic and livestock associated clones of methicillin resistant Staphylococcus aureus from ocular samples in Northeastern Iran.

Authors:  Seyed Asghar Havaei; Amir Azimian; Hosein Fazeli; Mahmood Naderi; Kiarash Ghazvini; Siamak Mirab Samiee; Masoud Soleimani
Journal:  Iran J Microbiol       Date:  2013-09

10.  Invasive Pneumococcal Disease (IPD) Serotype Frequency in Iranian Patients.

Authors:  Ali Mehrabi Tavana; Ramazan Ali Ataee
Journal:  Iran Red Crescent Med J       Date:  2013-08-05       Impact factor: 0.611

View more
  1 in total

1.  Identification and molecular characterization of penicillin-nonsusceptible Streptococcus pneumoniae isolates recovered from invasive infections in a pre-pneumococcal vaccine era.

Authors:  Mehrdad Mosadegh; Soheila Habibi Ghahfarokhi; Ali Ahmadi; Mohammad Reza Pourmand; Yousef Erfani; Rahil Mashhadi
Journal:  J Clin Lab Anal       Date:  2022-06-23       Impact factor: 3.124

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.