| Literature DB >> 32209460 |
Petra Mlcochova1, Helena Winstone2, Lorena Zuliani-Alvarez2, Ravindra K Gupta3.
Abstract
Macrophages exist predominantly in two distinct states, G0 and a G1-like state that is accompanied by phosphorylation of SAMHD1 at T592. Here, we demonstrate that Toll-like receptor 4 (TLR4) activation can potently induce G0 arrest and SAMHD1 antiretroviral activity by an interferon (IFN)-independent pathway. This pathway requires TLR4 engagement with TRIF, but not involvement of TBK1 or IRF3. Exclusive Myd88 activators are unable to trigger G0 arrest or SAMHD1 dephosphorylation, demonstrating this arrest is also Myd88/nuclear factor κB (NF-κB) independent. The G0 arrest is accompanied by p21 upregulation and CDK1 depletion, consistent with the observed SAMHD1 dephosphorylation at T592. Furthermore, we show by SAMHD1 knockdown that the TLR4-activated pathway potently blocks HIV-1 infection in macrophages specifically via SAMHD1. Together, these data demonstrate that macrophages can mobilize an intrinsic cell arrest and anti-viral state by activating TLR4 prior to IFN secretion, thereby highlighting the importance of cell-cycle regulation as a response to pathogen-associated danger signals in macrophages.Entities:
Keywords: E Coli; G0; G1; HIV; LPS; SAMHD1; TLR4; cell-cycle arrest; human macrophages; interferon
Mesh:
Substances:
Year: 2020 PMID: 32209460 PMCID: PMC7109521 DOI: 10.1016/j.celrep.2020.03.008
Source DB: PubMed Journal: Cell Rep Impact factor: 9.423
Figure 1TLR4 Activation Induces G0 Arrest, Dephosphorylates SAMHD1, and Blocks HIV-1 Infection in an Interferon-Independent Manner
(A) MDMs were treated with TAK242, BX795, and RUXO 6 h before addition of LPS. Cells were infected by vesicular stomatitis virus G protein (VSV-G)-pseudotyped HIV-1 18 h later. The percentage of infected cells was determined 48 h post-infection (n = 5, mean ± SEM). Cells from a representative donor were used for immunoblotting.
(B) A simplified diagram of TLR4 signaling in response to LPS. LPS activates both MyD88-dependent and -independent signaling pathways. BX795, an inhibitor of TBK1; RUXO (ruxolitinib), an inhibitor of JAK1/2 kinase that suppresses IFN signaling; TAK242, an inhibitor of TLR4 signaling.
(C) IRF3/NF-κB nuclear translocation assay. Cells were exposed to LPS in the absence or presence of TAK242, BX795, and RUXO, and 2 h later stained for IRF3/NF-κB. The percentage of cells with nuclear staining was determined (n = 3, mean ± SEM). Scale bars, 20 μm.
(D) Expression data of TRIF and TBK1 in MDMs, displayed as cycle threshold (Ct) values (n = 3, mean ± SEM).
(E–H) MDMs were transfected with control or TRIF, TBK1 siRNA. mRNA expression is shown as fold change relative to control (n = 3, mean ± SEM) (E). Cells from a representative donor were used for immunoblotting (F). Cells were exposed to LPS in control or KD cells, and 2 h later stained for IRF3/NF-κB. % of cells with nuclear staining was determined (n = 3, mean ± SEM) (G). MDMs transfected with control or TRIF, TBK1 siRNA were treated with LPS. Cells were infected by VSV-G-pseudotyped HIV-1 18 h later. The percentage of infected cells was determined 48 h post-infection (n = 3 donors, mean ± SEM). Cells from a representative donor were used for immunoblotting (H).
∗∗∗p ≤ 0.001; ∗∗p ≤ 0.01; p ≤ 0.1; nsp, non-significant, paired t test.
Figure 2TLR4-Mediated Activation of SAMHD1 Is MyD88 Independent
(A) Diagram of TLR4 activation. LPS activates both MyD88-dependent and -independent signaling pathways. Tenascin-C (TNC) and Flagellin (FLA) activate only the MyD88-dependent pathway leading to NF-κB translocation into the nucleus.
(B) IRF3/NF-κB translocation assay. Cells were exposed to TNC, FLA, and LPS and 2 h later stained for IRF3/NF-κB. The percentage of cells with nuclear staining was determined (n = 3, mean ± SEM). Scale bars, 20 μm.
(C) MDMs were treated with LPS, TNC, and FLA, and cytokines were measured by ELISA in culture media 24 h later.
(D) MDMs treated with TNC, FLA, and LPS were infected by VSV-G-pseudotyped HIV-1 18 h later. The percentage of infected cells was determined 48 h post-infection (n = 3, mean ± SEM). Cells from a representative donor were used for immunoblotting.
∗∗∗p ≤ 0.001; p ≤ 0.01; nsp, non-significant, paired t-test.
Figure 3Cell-Cycle Profiling of MDMs following TLR4 Activation and Demonstration that SAMHD1 Mediates the Interferon-Independent Blockade of HIV Infection
(A) MDMs were treated with RUXO 6 h before addition of LPS. Cells from a representative donor were used for immunoblotting 18 h later to detect changes in cell-cycle-associated proteins.
(B) A heatmap depicts differential gene expression patterns of cell-cycle-associated transcripts in MDMs treated with LPS in the presence of RUXO in three donors. The color scale bar corresponds to log-fold expression.
(C) Relative expression levels (fold changes) of statistically significantly changed cell-cycle-associated transcripts after LPS in the presence of RUXO (n = 4 donors, mean ± SEM).
(D and E) MDMs were transfected with control or pool of SAMHD1 siRNAs (KD) and 3 days later treated with RUXO and followed 6 h after that with LPS. Cells were infected in the presence of LPS with VSV-G-pseudotyped HIV-1 GFP 18 h later. The percentage of infected cells was quantified 48 h post-infection. SAMHD1 KD in four different donors. Error bars represent technical triplicates (D). Cells from a representative donor were used for immunoblotting (E).
(F) Immunoblot of SIV virus-like particles (VLPs). delX, SIV VLP with deleted Vpx; E16A, SIV VLP containing mutated Vpx (E16A mutant Vpx does not bind SAMHD1); WT, SIV VLP containing wild-type Vpx.
(G) SAMHD1 degradation in MDMs by SIV VLPs. Equal quantities of SIV VLPs were added to macrophages. Cells from a representative donor were used for immunoblotting.
(H) MDMs were treated ± LPS and infected by VSV-G-pseudotyped HIV-1 in the presence of different SIV VLPs (as indicated). The percentage of infected cells was determined 48 h post-infection (n = 4 donors, mean ± SEM).
(I) Diagram of G0 arrest following TLR4/TRIF activation resulting in block to HIV-1 infection.
∗∗∗p ≤ 0.001; ∗∗p ≤ 0.01; p ≤ 0.1; nsp, non-significant, paired t test.
Figure 4TLR4 Activation by Whole E. coli Induces Interferon-Independent G0 Arrest
(A) pHrodo-labeled E. coli were added to MDMs for 1 h. MDMs were washed and fixed. 104 cells were recorded and analyzed. Percentage of E. coli-positive cells was determined using automated cell imaging system Hermes WiScan and ImageJ.
(B) IRF3/NF-κB translocation assay. Cells were exposed to pHrodo E. coli in the presence or absence of inhibitors and 2 h later stained for IRF3/NF-κB. The percentage of cells with nuclear staining was determined (n = 3, mean ± SEM). No IRF3 or NF-κB translocation was detected in un-treated cells.
(C and D) MDMs were treated with (C) TAK242 or RUXO 6 h or (D) BX795 2 h before addition of pHrodo E. coli. Cells were infected by VSV-G-pseudotyped HIV-1 18 h later. The percentage of infected cells was determined 48 h post-infection (n = 3 donors, mean ± SEM). Cells from a representative donor were used for immunoblotting.
(E and F) Relative expression levels (fold changes) of ISGs (E) and cell-cycle-associated transcripts (F). MDMs were treated with RUXO 6 h before addition of pHrodo E. coli. Cells were collected 24 h later (n = 3 donors, mean ± SEM).
(G) Diagram of G0 arrest following exposure to E. coli and TLR4/TRIF activation resulting in block to HIV-1 infection.
∗∗∗p ≤ 0.001; p ≤ 0.01; p ≤ 0.1, paired t test.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Rabbit Anti-Human SAMHD1 Polyclonal Antibody | Proteintech | Cat# 12586-1-AP, RRID: |
| Mouse Anti-Actin, beta Monoclonal Antibody | Abcam | Cat# ab6276, RRID: |
| Rabbit polyclonal CDK1 Antibody | Bethyl | Cat# A303-664A, RRID: |
| Mouse Anti-BM28 Monoclonal Antibody | BD Biosciences | Cat# 610701, RRID: |
| Phospho-SAMHD1 (Thr592) (D7O2M) Rabbit mAb antibody | Cell Signaling Technology | Cat# 89930, RRID: |
| Mouse Anti-P21 Monoclonal antibody, Unconjugated, Clone f-5 | Santa Cruz Biotechnology | Cat# sc-6246, RRID: |
| IRF-3 (D6I4C) XP® antibody | Cell Signaling Technology | Cat# 11904, RRID: |
| NFkappaB p65 (F-6) antibody | Santa Cruz Biotechnology | Cat# sc-8008, RRID: |
| Purified anti-H2A.X Phospho (Ser139) antibody | BioLegend | Cat# 613402, RRID: |
| 53BP1 antibody | BD Biosciences | Cat# 612522, RRID: |
| Anti-IFNα/β Receptor | PBL Interferon Source | N/A |
| Mouse IgG2A Isotype Control (Clone 20102) antibody | R and D Systems | Cat# MAB003, RRID: |
| Rat Anti-IL-6 Monoclonal Antibody, Unconjugated, Clone MQ2-13A5 | BD Biosciences | Cat# 554543, RRID: |
| Mouse Anti-IL-8 Monoclonal Antibody, Unconjugated, Clone G265-5 | BD Biosciences | Cat# 554716, RRID: |
| Mouse Anti-TNF Monoclonal Antibody, Unconjugated, Clone MAb1 | BD Biosciences | Cat# 551220, RRID: |
| Rabbit Anti-Human TICAM1 Polyclonal Antibody, Unconjugated | GeneTex | Cat# GTX104744, RRID: |
| TBK1 Antibody | Bethyl | Cat# A300-093A, RRID: |
| VSV-G HIV-1 GFP virus | N/A | |
| SIVmac Virus like particles | N/A | |
| PBMC from HIV seronegative donors | This study | N/A |
| AB Human Serum | Sigma | #H4522 |
| FBS | Biosera | N/A |
| BX795 | APEXBIO | #A8222 |
| Ruxolitinib | Cell guidance system | #SM87 |
| Recombinant human IFN-b | Peprotech | #300-02BC |
| Recombinant human Tenascin C | R and D | #3358-TC-050 |
| Polymyxin B | Sigma | #P4932 |
| LPS | InvivoGen | #tlrl-prslps |
| TAK242 | Milllipore | #614316 |
| Recombinant Flagellin protein | Abcam | #Ab201366 |
| DMEM, high glucose, pyruvate | Invitrogen | #41966052 |
| RPMI 1640 medium | Invitrogen | #21875091 |
| Opti-MEM | Invitrogen | #31985047 |
| Fugene HD transfection reagent | Promega | #E2311 |
| DAPI | Sigma | #10236276001 |
| PhosSTOP | Sigma | #4906845001 |
| Fast SYRB green master mix | ThermoFisher | #4385610 |
| Total RNA Purification Kit | Norgen | #17200 |
| CellRox | Molecular Probes | #C10444 |
| NuPAGE 4-12% Bis-Tris Protein Gel | Invitrogen | #NP0322BOX |
| pHrodo E.coli BioParticles | ThermoFisher | #P35361 |
| SuperScript III First-Strand Synthesis System | ThermoFisher | #18080051 |
| Amersham ECL Prime Western Blotting Detection Reagent | GE Healthcare | #RPN2232 |
| 293T | Laboratory of G. Towers (UCL) | N/A |
| CDK1 FWD | Invitrogen | N/A |
| CDK1 R 5′ A TGGCT ACCACTTGA | Invitrogen | N/A |
| CDK2 F 5′ AAGTTGACGGGAGAG | Invitrogen | N/A |
| CDK2 R 5′ TGATGAGGGGAAGAG | Invitrogen | N/A |
| CDK4 F 5′ CAGATGGCACTTACACCCGT 3′ | Invitrogen | N/A |
| CDK4 R 5′ CAGCCCAATCAGGTC | Invitrogen | N/A |
| CDK6 F 5′ CGTGGTCAGGTTGTT | Invitrogen | N/A |
| CDK6 R 5′ CGGTGTGAATGAAGAA | Invitrogen | N/A |
| Cyclin A2 F 5′ AAGACGAGACGGGTTGC 3′ | Invitrogen | N/A |
| Cyclin A2 R 5′ | Invitrogen | N/A |
| Cyclin B1 F 5′ | Invitrogen | N/A |
| Cyclin B1 R 5′ | Invitrogen | N/A |
| Cyclin D1 F 5′ | Invitrogen | N/A |
| Cyclin D1 R 5′ | Invitrogen | N/A |
| Cyclin D3 F 5′ GGCCGGGGACCGAAACT 3′ | Invitrogen | N/A |
| Cyclin D3 R | Invitrogen | N/A |
| Cyclin E1 F 5′ | Invitrogen | N/A |
| Cyclin E1 R 5′ | Invitrogen | N/A |
| Cyclin E2 F 5′ | Invitrogen | N/A |
| Cyclin E2 R 5′ | Invitrogen | N/A |
| E2F1 F 5′ TGCCAAGAAGTCCAAGA | Invitrogen | N/A |
| E2F1 R 5′ GTCAACCCCTCAAGCCGTC 3′ | Invitrogen | N/A |
| E2F4 F 5′ CGGACCCAACCCTTCT ACCT 3′ | Invitrogen | N/A |
| E2F4 R 5′ GGGGCAAACACTTCTGAGGA 3′ | Invitrogen | N/A |
| E2F7 F 5′ CCTTTAGCCCACCCAGTATTT 3′ | Invitrogen | N/A |
| E2F7 R 5′ A TCCCTCTCTGACCCTGACC 3′ | Invitrogen | N/A |
| MCM2 F 5′CACCCGAAGCTCAACCA | Invitrogen | N/A |
| MCM2 R 5′ATCATGGACTCGATGTG | Invitrogen | N/A |
| RB1 F 5′AAAGGACCGAGAAGGACCA 3′ | Invitrogen | N/A |
| RB1 R 5′AAGGCTGAGGTTGCTTGTGT 3′ | Invitrogen | N/A |
| WIF1 F 5′TCTGTTCAAAGCCTGTCTGC 3′ | Invitrogen | N/A |
| WIF1 R 5′ACATTGGCATTTGTTGGGTT 3′ | Invitrogen | N/A |
| p14 F 5′GAGTGAGGGTTTTCGTGGTTC 3′ | Invitrogen | N/A |
| p14 R 5′ACGGGTCGGGTGAGAGTG 3′ | Invitrogen | N/A |
| p16 F 5′ CGGCTGACTGGCTGGC 3′ | Invitrogen | N/A |
| p16 R 5′ GGGTCGGGTGAGAGTGG3′ | Invitrogen | N/A |
| p21 F 5′GCCGAAGTCAGTTCCTTGTG 3′ | Invitrogen | N/A |
| p21 R 5′TCGAAGTTCCATCGCTCACG 3′ | Invitrogen | N/A |
| p27 F 5′A TGTTTCAGACGGTTCCCCA 3′ | Invitrogen | N/A |
| p27 R 5′TCCAACGCTTTTAGAGGCAG 3′ | Invitrogen | N/A |
| p53 F 5′AAGTCTAGAGCCACCGTCCA 3′ | Invitrogen | N/A |
| p53 R | Invitrogen | N/A |
| CXCL10 F 5′ TGGCATTCAAGGAGTACC | Sigma | N/A |
| CXCL10 R 5′ | Sigma | N/A |
| ISG56 F 5′CCT CCT TGG GTT CGT CTA | Sigma | N/A |
| ISG56 R 5′GGC TGA TAT CTG GGT GCC | Sigma | N/A |
| ISG54 F 5′CAGCTGAGAATTGCACTGC | Sigma | N/A |
| ISG54 R 5′CGT AGGCTGCTCTCCAAG | Sigma | N/A |
| MxA F 5′ATC CTG GGA TTT TGG GGC | Sigma | N/A |
| MxA R 5′CCG CTT GTC GCT GGT GTC G 3′ | Sigma | N/A |
| SAMHD1 F | Invitrogen | N/A |
| SAMHD1 R | Invitrogen | N/A |
| GAPDH F 5′ACC CAG AAG ACT GTG GAT | Sigma | N/A |
| GAPDH R 5′TTC TAG ACG GCA GGT CAG | Sigma | N/A |
| ON-TARGETplus Human SAMHD1 siRNA | Dharmacon | #L-013950-01 |
| Control siRNA | Santa Cruz | #sc-37007 |
| TBK1 siRNA | Santa Cruz | #sc-39058 |
| TICAM1 siRNA | OriGene | #SR315629 |
| GFP-encoding genome CSGW | Laboratory of G. Towers | N/A |
| p8.91 | Laboratory of G. Towers | N/A |
| pMDG | Laboratory of G. Towers | N/A |
| SIVmac packaging plasmid encoding | Laboratory of G. Towers | N/A |
| pCDNA Vpx E16A | Laboratory of J. Luban, | N/A |
| ImageJ | ||
| Amersham Hybond P 0.45 PVDF blotting | GE Healthcare | #10600023 |