Yongxing Lai1, Peiqiang Lin1, Manli Chen2, Yixian Zhang3, Jianhao Chen2, Mouwei Zheng2, Ji Liu2, Houwei Du2, Ronghua Chen2, Xiaodong Pan4, Nan Liu5, Hongbin Chen6. 1. Department of Neurology, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Department of Rehabilitation, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Institute of Cerebral Vascular Disease of Fujian Province, Fuzhou, 350001, China; Key Laboratory of Brain Aging and Neurodegenerative Diseases, Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou, 350001, China. 2. Department of Neurology, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Institute of Cerebral Vascular Disease of Fujian Province, Fuzhou, 350001, China; Key Laboratory of Brain Aging and Neurodegenerative Diseases, Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou, 350001, China. 3. Department of Rehabilitation, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Institute of Cerebral Vascular Disease of Fujian Province, Fuzhou, 350001, China; Key Laboratory of Brain Aging and Neurodegenerative Diseases, Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou, 350001, China. 4. Department of Neurology, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Key Laboratory of Brain Aging and Neurodegenerative Diseases, Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou, 350001, China. 5. Department of Neurology, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Department of Rehabilitation, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Institute of Cerebral Vascular Disease of Fujian Province, Fuzhou, 350001, China; Key Laboratory of Brain Aging and Neurodegenerative Diseases, Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou, 350001, China. Electronic address: xieheliunan1984@sina.com. 6. Department of Neurology, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Department of Rehabilitation, Fujian Medical University Union Hospital, Fuzhou, 350001, China; Institute of Cerebral Vascular Disease of Fujian Province, Fuzhou, 350001, China; Key Laboratory of Brain Aging and Neurodegenerative Diseases, Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou, 350001, China. Electronic address: 462501173@qq.com.
Abstract
BACKGROUND: Ischemic stroke can induce changes in mitochondrial morphology and function. As a regulatory gene in mitochondria, optic atrophy 1 (OPA1) plays a pivotal role in the regulation of mitochondrial dynamics and other related functions. However, its roles in cerebral ischemia-related conditions are barely understood. METHODS: Cultured rat primary cortical neurons were respectively transfected with OPA1-v1ΔS1-encoding and OPA1-v1-encoding lentivirus before exposure to 2-h oxygen-glucose deprivation (OGD) and subsequent reoxygenation (OGD/R). Adult male SD rats received an intracranial injection of AAV-OPA1-v1ΔS1 and were subjected to 90 min of transient middle cerebral artery occlusion (tMCAO) followed by reperfusion. OPA1 expression and function were detected by in vitro and in vivo assays. RESULTS: OPA1 was excessively cleaved after cerebral ischemia/reperfusion injury, both in vitro and in vivo. Under OGD/R condition, compared with that of the LV-OPA1-v1-treated group, the expression of OPA1-v1ΔS1 efficiently restored L-OPA1 level and alleviated neuronal death and mitochondrial morphological damage. Meanwhile, the expression of OPA1-v1ΔS1 markedly improved cerebral ischemia/reperfusion-induced motor function damage, attenuated brain infarct volume, neuronal apoptosis, mitochondrial bioenergetics deficits, oxidative stress, and restored the morphology of mitochondrial cristae and mitochondrial length. It also preserved the mitochondrial integrity and reinforced the mtDNA content and expression of mitochondrial biogenesis factors in ischemic rats. INTERPRETATION: Our results demonstrate that the stabilization of L-OPA1 protects ischemic brains by reducing neuronal apoptosis and preserving mitochondrial function, suggesting its significance as a promising therapeutic target for stroke prevention and treatment.
BACKGROUND:Ischemic stroke can induce changes in mitochondrial morphology and function. As a regulatory gene in mitochondria, optic atrophy 1 (OPA1) plays a pivotal role in the regulation of mitochondrial dynamics and other related functions. However, its roles in cerebral ischemia-related conditions are barely understood. METHODS: Cultured rat primary cortical neurons were respectively transfected with OPA1-v1ΔS1-encoding and OPA1-v1-encoding lentivirus before exposure to 2-h oxygen-glucose deprivation (OGD) and subsequent reoxygenation (OGD/R). Adult male SD rats received an intracranial injection of AAV-OPA1-v1ΔS1 and were subjected to 90 min of transient middle cerebral artery occlusion (tMCAO) followed by reperfusion. OPA1 expression and function were detected by in vitro and in vivo assays. RESULTS:OPA1 was excessively cleaved after cerebral ischemia/reperfusion injury, both in vitro and in vivo. Under OGD/R condition, compared with that of the LV-OPA1-v1-treated group, the expression of OPA1-v1ΔS1 efficiently restored L-OPA1 level and alleviated neuronal death and mitochondrial morphological damage. Meanwhile, the expression of OPA1-v1ΔS1 markedly improved cerebral ischemia/reperfusion-induced motor function damage, attenuated brain infarct volume, neuronal apoptosis, mitochondrial bioenergetics deficits, oxidative stress, and restored the morphology of mitochondrial cristae and mitochondrial length. It also preserved the mitochondrial integrity and reinforced the mtDNA content and expression of mitochondrial biogenesis factors in ischemicrats. INTERPRETATION: Our results demonstrate that the stabilization of L-OPA1 protects ischemic brains by reducing neuronal apoptosis and preserving mitochondrial function, suggesting its significance as a promising therapeutic target for stroke prevention and treatment.
As a global primary cause for death and physical disability in adults, over 80% stroke cases are ischemic as a consequence of obstruction of cerebral arteries [1,2]. Among the current clinical means to attenuate cerebral damage from ischemia, revascularization is often used to treat acute ischemic stroke by dredging the occluded vessels. However, this treatment also results in ischemia/reperfusion injury [3]. Therefore, a thorough understanding of the underlying mechanisms becomes urgent and a more potent treatment scheme is badly needed.Mitochondria, as highly dynamic intracellular organelles, play a pivotal role in the pathophysiology of ischemic neuronal death [4]. Mitochondrial morphology is vital for sustaining mitochondrial dynamic, which changes from rod to small fragment after cerebral ischemia/reperfusion injury [5]. Fragmented mitochondria can result in energetic disruption, occurrence of oxidative stress, and overproduction of ROS scavenging enzymes [6]. Moreover, an excessive accumulation of ROS may induce the opening of mitochondrial transition pore (mPTP) [7]. These pathological changes subsequently lead to impaired mitochondrial membrane potential (m) and the release of pro-apoptotic factors, such as cytochrome c (Cyt c) and apoptosis-inducing factor (AIF) in mitochondria, further activating the mitochondria-dependent apoptosis pathway and eventually aggravating the tissue injury [8]. Additionally, accumulating evidences demonstrate that several neurological diseases can trigger the increment of mitochondrial biogenesis and mitochondrial DNA (mtDNA) [9,10]. The transcriptional regulatory genes of mitochondrial biosynthesis mainly include peroxisome proliferative activated receptor-γ (PPARγ) coactivator 1α (PGC-1α), a powerfully primary regulator of mitochondrial biogenesis; nuclear respiratory factor 1 (Nrf-1), which is responsible for regulating nuclear-encoded mitochondrial genes involved in electron transport chain and activating the expression of mitochondrial transcription factor A (TFAM); TFAM, which is necessary for initiating the transcription and duplication of mtDNA [11]. Therefore, targeting mitochondrial health can serve as an alternative candidate for the development of neuroprotective strategies for treating cerebral ischemic injury.As a dynamin-like mitochondrial GTPase, optical atrophy 1 (OPA1) adheres to the inner mitochondrial membrane and participates in the structural remodeling of cristae, inner membrane fusion, and sustenance of mitochondrial DNA stability [[12], [13], [14]]. The gene has at least eight mRNA isoforms in different splicing processes [15]. Their mitochondrial targeting sequence (MTS) is subsequently removed by mitochondrial processing peptidase (MPP) in the inner mitochondrial membrane, leading to the generation of long isoforms of OPA1 (L-OPA1). L-OPA1 can be further cleaved by the IM peptidase OMA1 and the i-AAA protease YME1L at sites located in S1 and S2, respectively. The latter is required for the OPA1 processing under normal conditions and the interaction between L-OPA1 and S-OPA1 maintains the cristae structure and promotes the fusion of mitochondrial inner membrane. However, the activation of OMA1 by stress insults, such as disruption of the mitochondrial membrane potential (m) and energy deficits, can induce further cleavage of L-OPA1 and over-accumulation of S-OPA1, eventually leading to OPA1dysfunction and mitochondrial damage [12,16,17]. The overexpression of total OPA1 (T-OPA1) has also been documented to alleviate neuronal apoptosis and mitochondrial dysfunction [18,19]. and the rebalancing of L-OPA1 can more efficiently reduce neuronal loss and neurodegeneration than T-OPA1 overexpression in a retinal ischemia-reperfusion injury model [20]. However, the effects of L-OPA1 or T-OPA1 restoration on cerebral ischemia/reperfusion injury-induced mitochondrial dysfunction and tissue damage have not been thoroughly investigated.In the current study, we therefore characterized the dynamic changes of OPA1 protein expression after cerebral ischemia/reperfusion injury, both in vivo and in vitro. We respectively overexpressed OPA1 isoform 1 with a defective S1 cleavage site (OPA1-v1S1) and full-length OPA1 isoform 1 (OPA1-v1) in cultured cortical neurons and compared their protective effects on oxygen and glucose deprivation/reoxygenation (OGD/R)-induced injury. We also expressed an OPA1-v1S1 via an intracranial injection of adeno-associated virus (AAV) in vivo to determine the effect of L-OPA1 restoration on motor function, neuronal apoptosis, the structural of mitochondrial cristae, mitochondrial bioenergetics, oxidative stress, mitochondrial integrity and biogenesis after cerebral ischemia/reperfusion injury. We found that the restoration of L-OPA1 attenuated neuronal apoptosis and preserved mitochondrial function, which signifies its value as a promising therapeutic target for stroke prevention and treatment.
Materials and methods
Experimental animals
All animal procedures were approved by the Institutional Animal Care and Use Committee of Fujian Medical University and conducted according to the Guidelines for the Care and Use of Laboratory Animals. Male Sprague-Dawley (SD) rats (weighed 280–350g and aged 12–14 weeks old) were purchased from Experimental Animal Center of Fujian Medical University. The animals were given ad libitum access of food and water and housed in cages (less than five animals per cage) on a 12-h light/dark cycle with a room temperature set at C and a humidity of 60–70%.
Surgical procedure and experimental groups
Transient focal cerebral ischemia was established in rats by transient occlusion of the right middle cerebral artery occlusion (tMCAO) as previously described [21] with minor modifications. In brief, before the tMCAO surgery, rats were anaesthetized with 10% chloral hydrate (0.3 ml/100 g b. w.) and then were placed in the supine position on the operation table. A 2 cm incision was made on the midline of the neck, and the blunt dissection exposed the right common carotid artery (CCA), external carotid artery (ECA), and the internal carotid artery (ICA) bifurcation. A microvascular clip temporarily clamped the CCA and ICA, and a small cut was made on the ECA. A 4-0 silicon-coated nylon monofilament (Doccol, Corporation, USA) was advanced to the ICA along the ECA and advanced until the origin of the middle cerebral artery. The suture was removed slowly after a 90min occlusion of MCA to restore the blood flow. Rats in the Sham group received no filament insertion and otherwise same surgical procedures as the tMCAO group. The rats were returned to the cage with ad libitum access to the pellet food and water after they were resuscitated from anesthesia. Rats were randomly divided into the following groups: Sham group (28 rats); tMCAO group (40 rats), undergoing tMCAO surgery; tMCAO + AAV-empty group (24 rats), injected with AAV-empty vector before tMCAO surgery; tMCAO + AAV-OPA1-v1S1 group (24 rats), injected with AAV-OPA1-v1S1 vector before tMCAO surgery. Each experiment was performed at least 3 times.
Intracranial injection of adeno-associated virus
The rats’cortex and ipsilateral striatum posterior to it were injected with AAV-OPA1-v1S1 or AAV–empty (Hanbio, Shanghai, China) 21 days before cerebral ischemia/reperfusion injury as previously described [22]. In brief, a 10 μl microsyringe (Hamilton, Reno, NV) was inserted into the following coordinate axis, with the origin at bregma: anterior-posterior [−] 0.2 mm, mediolateral [−] 2.5 mm, at a depth of 2.5 mm (cortex) and 4.5 mm (striatum). A dosage of gc AAV-OPA1-v1S1 was injected at a rate of 0.2 μl/min. AAV-empty-treated rats were injected with identical genome copies of AAV-empty, while the Sham rats received no injection. After the injection, the syringe was left in place for at least 15 min before removal to prevent reflux and ensure a complete dispersion of the virus. The efficiency of OPA1-v1S1 overexpression was estimated by GFP fluorescence in the peri-ischemic region.
Behavioral assessment
Before the tMCAO procedures, all rats underwent a series of behavioral tests at Day 1, 2, 3 of reperfusion by an operator who was blinded to the experimental treatment groups. Modified neurological severity scores (mNSS), including motor, sensory, balance, and reflex tests, were used to evaluate neurological deficits. Neurological function was evaluated on a scale of 0–18 (0, no neurological deficit; 18, maximal neurological deficit) [23]. The higher the scores, the more serious the damage was.The rotarod test was used to evaluate sensorimotor coordination of the rats with a rat rotarod 47700 (Ugo Basile, Milan, Italy), as previously described [24] When the power was switched on, the rotarod ran at a uniform speed and then gradually accelerated from 4 rpm to 40 rpm within 5 min. The rats were placed on the rotating rod and the time they stayed on the rod was recorded. Three tests were repeated in sequence with a 15 min interval between each test. All the rats underwent adaptive training three days before tMCAO. The test data were presented as mean duration time on the rotating rod.The grip strength test was performed to assess the neuromuscular function of the rats with a grip strength tester YLS-13A (Yiyan Technology, Shang Dong, China), as previously described [25]. In brief, the tails of experimental rats were held so that their forelimb could grasp the grip plate and then gently pulled back until they released from the grip plate. The maximum muscle strength of the rats was recorded automatically by the instrument. The test was repeated three times in sequence with appropriate rest between each test. All the rats underwent adaptive training three days before tMCAO. Grip strength test was presented as grams.The cylinder test was performed to assess the forelimb asymmetry of the rats following the protocol of previously described [26]. The rats were individually placed in a transparent plexiglass cylinder (20 cm ϕ* 40 cm height) and observed for 3 min. Initial forepaw (left/right/both) preference contact with the cylinder wall during a full standing on the hind legs was recorded three times by an operator who was blinded to the experimental groups. Non-injured rats used both forepaws equally, whereas cerebral ischemia/reperfusion-injured rats relied mostly on their ipsilateral (right) forepaw. The relative percentage of no-impaired (right) forelimb contacts was calculated as:Cylinder test was performed in triplicate.
Magnetic resonance imaging (MRI)
Magnetic resonance imaging was conducted at 72 h after ischemia/reperfusion using a 7-T small animal MRI system (Bruker Medizintechnik, Germany) and the Paravision 6.0 software as previously described [27] with minor modifications. Briefly, for the imaging procedure, rats were anaesthetized with 1–3% isoflurane in a mixture of oxygen and air (1:4) for 5 min and placed on a magnetic resonance scanning bed and maintained with 100 μg/mL Dexmedetomidine Hydrochloride (0.15 μL/300 g b. w.) during the anesthesia. During MRI scanning, the body temperature, heart rate and respiration of the rats were monitored using a physiological tester (SurgiVet V3395TPR, Smiths Medical, USA). The infarct volume was estimated with T2-weighted images by using a fast spinecho (TubroRARE) sequence with the following parameters: TR/TE = 5200/32 ms, FOV = , matrix = , slices = 48, slice thickness = 0.56 mm, total scan time = 11min5s600ms. Then the T2-weighted images were quantified with ImageJ software [28,29]. The total infarct volume for each brain was calculated by summation of the infarcted area of all brain slices [area of infarct in mm2 x thickness (0.56 mm)]. Corrected infarct volume was used to exclude the effect of brain edema and was calculated by the formula: total contralateral half brain volume – (total ipsilateral half brain volume – total direct infarct volume) and was presented as the percentage of the infarct volume over the volume of the whole brain.
Primary culture of cortical neurons and oxygen-glucose deprivation/reoxygenation (OGD/R) model
Embryonic rats (aged 16–18 days) were prepared from anaesthetized pregnant Sprague – Dawley rats following previously described protocol [30] with minor modifications. In brief, cerebral cortices were isolated and the meninges and blood vessels were carefully stripped. Next, tissues were minced and digested in 0.25% trypsin (Gibco, NY, USA, Cat# 25200–072) at C for 20 min and then gently triturated. Dispersed cells were respectively plated onto poly-l-lysine (100 μg/ml) coated 6-well plates, 96-well plates, and coverslips () in a neurobasal medium (Gibco, NY, USA, Ca# 21103–049) containing 2% B27 supplement (Gibco, NY, USA, Cat# 17504–044), 0.5 mM of l-Glutamine (Gibco, NY, USA, Cat# 35050–061) and 50 U/ml of penicillin/streptomycin (Gibco, NY, USA, Cat# 15140–122) at C, which were placed in a 5% CO2 incubator. The culture medium was firstly changed after 8h and then half of the medium was refreshed every other day. After 7-9d in vitro (DIV), the cultured neurons were rinsed with PBS for three times and placed into an anaerobic chamber containing 5% CO2 and 95% N2 with glucose-free DMEM (Gibco, NY, USA, Cat# 11966–025) at C for 2h. Then, the culture medium was switched back to the normal medium and maintained in a 5% CO2 incubator at C for 12h to undergo the reoxygenation insult. The control group cells were incubated in a normal condition in a complete medium.
Lentivirus transfection
Neurons were transfected with the GFP-containing or puromycin-resistance recombinant lentivirus LV-OPA1-v1, LV-OPA1-v1S1, and empty lentiviral vectors (LV-vector) at 5 MOI following the manufacturer's instruction (Hanbio, Shanghai, China). Three days later, cortical neurons were processed for various experiments. The efficiency of OPA1-v1S1 or OPA1-v1 overexpression was estimated by GFP fluorescence. Neurons transfected with puromycin-resistance lentivirus were used for the analysis of flow cytometry. GFP-containing lentivirus-transfected neurons were processed for other experimental analysis.
Cell viability and cytotoxicity assay
Cell viability was evaluated by an enhanced cell counting kit-8 (CCK-8) assay following the manufacturer's instruction (Dojindo, Kumamoto, Japan, Cat# CK04-11) as previously described [31]. Briefly, cortical neurons were plated in 96-well plates at a concentration of (200μl/well) for 7 days. After treatments, 10 μl CCK-8 reagent was added into each well and incubated at C for 2h. The optical density (OD) values of samples were measured at 450 nm with a microplate reader (SpectraMax®i3x, Molecular Devices, USA). Cell viability was presented as percentages of the control.Cytotoxicity assay was evaluated with a Lactate Dehydrogenase Assay Kit (Sigma-Aldrich, MO, USA, Cat# MAK066-1 KT) according to the manufacturer's instruction as previously described [32]. In brief, cortical neurons were plated in 6-well plates at a concentration of in 6-well plates for 7 days. After treatments, 75 μl of supernatant from each sample was collected and reacted with 150 μl LDH reagents at room temperature for 20 min. The OD values of samples were measured at 490 nm with a microplate reader (SpectraMax®i3x, Molecular Devices, USA). LDH release was presented as percentages of supernatant LDH compared with total LDH (intracellular + supernatant LDH).
Functional imaging assays
For the detection of ROS production in live cells, primary cortical neurons plated on coverslips were washed with pre-warmed PBS and incubated with 3 μM Dihydroethidium (DHE) dye (sigma-aldrich, MO, USA, Cat# D7008) at C for 30 min. After washing, stained cells were observed under a confocal microscope with a 20 objective (LSM 750, Zeiss, Gottingen, Germany). The DHE fluorescence intensity was quantified by using the ImageJ software. ROS production was calculated as the mean fluorescence intensity from six random fields in each per experiment and was presented as the fold intensity of control.MitoTracker Red CMXRos (Invitrogen, CA, USA, Cat# M7512) was used to detection of mitochondrial morphology following the manufacturer's instruction. Briefly, primary cortical neurons plated on coverslips were washed with pre-warmed PBS and incubated with MitoTracker Red CMXRos at a concentration of 100 nM at C for 30 min. Then the cells were fixed with formalin to visualize their morphology. Images were then observed under a confocal microscope with a 100 oil objective (LSM 750, Zeiss, Gottingen, Germany).
Measurement of mitochondrial bioenergetics
Mitochondrial oxygen consumption rate (OCR) was measured using the Seahorse XFe24 Extracellular Flux Analyzer (Seahorse Bioscience, Copenhagen, Denmark). Briefly, primary cortical neurons were plated on XFe24 microplates at a concentration of 8×104/well 7 days prior to OCR measurements. After treatments, A total of 1 ml Seahorse XF Calibrant Solution (Seahorse Biosciences, Copenhagen, Denmark) was added into each well of the utility plate and the sensor cartridges were soaked in Calibrant Solution in a non-CO2 incubator at C overnight to hydrate the probes. One hour prior to measurement, the hydrated sensor cartridges were added with the following compounds existed from the Seahorse XF Cell Mito Stress Test Kit (Seahorse Bioscience, Copenhagen, Denmark, Cat# 103015–100) according to the manufacture's instruction: Oligomycin (1.0 μM), carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP) (1.0 μM), and rotenone/antimycin A (0.5 μM). Then the sensor cartridges were loaded into the XFe24 Analyzer. After calibration, the sensor cartridges were replaced with the XFe24 microplates and the measurement program was resumed to obtain the following OCR parameters: Basal mitochondrial respiration, ATP-linked respiration, proton leak respiration, maximal respiration, spare respiratory capacity and non-mitochondrial respiration. The OCR values were normalized to the protein concentration per well and were presented as pmol/minute/μg protein.
Real-time quantitative PCR
Peri-ischemic cortex tissues of rats were obtained 3days after reperfusion, and total RNA was extracted using a Trizol reagent (Thermo Fisher Scientific, MA, USA, Cat# 15596018). Then, mRNA was reverse-transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, MA, USA, Cat# K1622). The primers were used for RT-PCR experiments were as follows: PGC-1α: forward, 5′- TGACCACAAACGATGACCCTC -3′, reverse, 5′- CTTGGTTGGCTTTATGAGGAGG -3’; NRF-1: forward, 5′- GAAATGACCATCCAGACGACG -3′, reverse, 5′- ACTATCTGTCCCCCGCCTTG -3’; TFAM: forward, 5′- AATGTGGGGCGTGCTAAGAAC -3′, reverse, 5′- ACAGATAAGGCTGACAGGCGAG -3’; β-actin: forward, 5′- TGCTATGTTGCCCTAGACTTCG -3’; reverse, 5′- GTAACAGTCCGCCTAGAAGCAC -3’. The relative expression of PGC-1α, NRF-1 and TFAM mRNA were normalized to β-actin mRNA and calculated using the 2−ΔΔ method.
Quantification of mitochondrial DNA (mtDNA) content
Total DNA of peri-ischemic cortex tissues was extracted using a Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, cat# 69504) 3 days after tMCAO. Mitochondrial DNA (mtDNA) copy number was represented by normalizing the mtDNA encoded gene and NAD dehydrogenase-5 (NADH-5) against the nuclear-encoded gene and cystic fibrosis transmembrane conductance regulator (CFTR), as previously described [33]. The primer sequences were listed as follows: NADH-5: forward, 5′- GGATGATGATATGGCCTTGCA -3′, reverse, 5′- CGACTCGGTTGTAGAGGATTGC -3’; CFTR: forward, 5′- AAACTCAGGATAGCTGTCCGTTTAG -3′, reverse, 5′- GCCAAATGATAGCATGGAACTCT -3’. The relative expression of NADH-5 mRNA was normalized to CFTR mRNA and calculated using the 2−ΔΔ method.
Isolation of mitochondria from the frontal brain tissues
Mitochondria from the peri-ischemic cortex of rats were isolated with a Tissue Mitochondria Isolation Kit (Beyotime, Shanghai, China, Cat# C3606) following the manufacturer's instruction. In brief, cortex tissues were cut up and divided into small pieces. Then the tissues were homogenized in a pre-cooled mitochondrial separation reagent A and centrifuged at 600 g at 4∘C for 5 min. Subsequently, the supernatant was carefully collected and centrifuged at 11,000 g at 4∘C for 10 min. The obtained pellet was isolated mitochondria. Finally, the mitochondria were resuspended in a mitochondrial stock solution using for functional studies or added mitochondrial lysate with 1 mM PMSF (Beyotime, Shanghai, China, cat# ST506) using for protein analysis of mitochondria.
Western blot analysis
Peri-ischemic cortex tissues or cultured primary neurons were homogenized and lysed in an ice-cold RIPA lysis buffer supplemented with 1 mM PMSF and 1 protease and phosphatase inhibitor cocktail mix (Beyotime, Shanghai, China, Cat# P1005-1 and Cat# P1045). Protein concentrations were measured using a BCA Protein Assay Kit (Thermo Fisher Scientific, MA, USA, Cat# 23227) as previously described [34]. Equal amounts (20–40 μg) of protein was separated with 10–15% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and then blotted onto polyvin ylidene difluoride (PVDF) membranes (Millipore, MA, USA, Cat# ISEQ00010). Next, the PVDF membranes were blocked in TBS (pH 7.4) containing 5% bovine serum albumin (BSA, Sigma-Aldrich, MO,USA, Cat# A6003) and 0.05% Tween 20 for 90 min, and were further incubated at 4∘C overnight using the following indicated primary antibodies:mouse anti-OPA1 (1:5000, BD Biosciences, Cat# 612607, RRID:AB_399889), rabbit anti-Bcl-2 (1:1000, Abcam, Cat# ab59348, RRID:AB_ 2064155), rabbit anti-Bax (1:5000, Abcam, Cat# ab32503, RRID: AB_725631), mouse anti-caspase-3 (1:3000, Proteintech, Wuhan, China, Cat# 66470-2-Ig), mouse anti-PGC1α (1:500, Santa Cruz, CA, USA, Cat# sc-518025), mouse anti-NRF1 (1:500, Santa Cruz, CA, USA, Cat# sc-365651), mouse anti-TFAM (1:500, Santa Cruz, CA, USA, Cat# sc-166965), rabbit anti-Cyt c (1:1000, Abcam, Cat# ab90529, RRID:AB_10673869), rabbit anti-AIF (1:1000, Abcam, Cat# ab32516, RRID: AB_726995), mouse anti-Tomm20 (1:500, Abcam, Cat# ab56783, RRID:AB_945896), rabbit anti- β-actin (1:400, Boster, Wuhan, China, Cat# BM3872). After three washes with TBST, the membranes were incubated with goat anti-mouse IgG-HRP secondary antibody (1:8000, Abcam, Cat# ab97040, RRID: AB_ 10698223) and goat anti-rabbit IgG-HRP secondary antibody (1:8000, Abcam, Cat# ab97080, RRID: AB_ 10679808) at room temperature for 90min. The images of target proteins were visualized using a chemiluminescence system (Bio-Rad, CA, USA). The protein expression was quantified using the ImageJ software and normalized to β-actin or Tomm20.
Immunofluorescent staining
Immunofluorescence staining for Cyt c expression in the peri-ischemic cortex tissues was performed as previously described [35] with minor modifications. In brief, frozen coronal sections (10 μm) were prepared using a cryostat (CM1850, Leica, Wetzlar, Germany) and adhered directly to the glass slides before air-drying at room temperature for 1 h. After three washes with PBS (pH 7.4), the sections underwent antigen retrieval by heating at 95∘C-100∘C in 1 Citrate Antigen Retrieval Solution (Beyotime, Shanghai, China, Cat# P0083). After washing, sections were permeabilized and blocked in PBS (pH 7.4) containing 5% bovine serum albumin (BSA) and 0.1% Triton X-100 (Thermo Fisher Scientific, MA, USA, Cat# T8787) at 37∘C for 90 min and then incubated with The following primary antibody rabbit anti-Cyt c (1:1000 Abcam, Cat# ab90529, RRID:AB_10673869) in 5% BSA at 4∘C overnight. Subsequently, sections were incubated in the Alexa Fluor 488 Donkey anti-Rabbit secondary antibody (1:1000, Thermo Fisher Scientific, Cat# A-21206, RRID: AB_2535792) at room temperature for 2h and then DAPI (Beyotime, Shanghai, China, Cat# C3606) was incubated for 15 min. After PBS wash, the images of sections were visualized under a confocal microscope (LSM 750, Zeiss, Gottingen, Germany) with a 63 objective.
Transmission electron microscopy (TEM)
The changes in ultrastructures of mitochondria in three adult SD rats per group was observed by transmission electron microscopy (TEM) 3 days after tMCAO as previously described [22]. Briefly, these rats were perfused with precooled PBS (pH 7.4) consisting of 3% paraformaldehyde and 1.5% glutaraldehyde. Subsequently, the brains were quickly removed, and several pieces of 1 mm3 peri-ischemic cortex tissues were dissected and were post-fixed in 1% osmium tetroxide (OsO4) and 1% ferrocyanide for 90min. After washing, the tissues underwent graded ethanol and acetonedehydration and embedded in Epon 618 epoxy resin. Ultrathin sections (80 nm) were prepared and followed by uranyl acetate and lead citrate staining. The mitochondrial ultrastructures of cortex tissues were visualized under a Philips transmission electron microscope (EM208, Philips, Eindhoven, the Netherlands).
Assessment of apoptosis by performing flow cytometry and TUNEL assay
Apoptosis was detected with a FITC-Annexin V apoptosis detection kit I (BD Biosciences, CA, USA, Cat# 556547) following the manufacturer's instruction. In brief, primary cortical neurons (5 105 cells/well) cultured in 6-well plates were harvested. After two washes with pre-cooled PBS, neurons were resuspended in 500 μl binding buffer (1X) and then incubated with 5 μl FITC-Annexin V and 5 μl propidium iodide (PI) in the dark at room temperature for 15 min. Samples were then analyzed by flow cytometry (BD Biosciences, CA, USA). Data were processed with the FlowJo software. The percentage of apoptotic neurons was shown as the early apoptotic neuron percentage + the late apoptotic neuron percentage.TdT-mediated dUTP nick end labelling (TUNEL) staining was conducted to assess the neuronal apoptosis of peri-ischemic cortex tissues 3 days after reperfusion with an In Situ Cell Death Detection Kit (Roche Applied Science, Penzberg, Germany, Cat# 11684817910) following the manufacturer's instruction. In brief, the coronal sections were fixed with formalin and rinsed. Then the sections were incubated with 2% H2O2, washed with TBS, and underwent enzyme reaction with the TUNEL reaction mixture before rinsing. Finally, freshly-prepared 3,3-diaminobenzidine (DAB) solution was directly added to the tissue sections and hematoxylin was used for counter-staining. The quantification of TUNEL staining was performed as previously described [36]. In brief, the sections were observed under a fluorescence microscope (Nikon eclipse Ti–U, Tokyo, Japan) with 400 magnification and TUNEL-positive cells were counted. Data were presented as a mean percentage of the number of TUNEL-positive cells in the whole fields of view from six randomly-selected fields in each per experiment.
Measurement of mitochondrial membrane potential (m) and mPTP opening
The m change was determined using a JC-1 Assay Kit (Thermo Fisher Scientific, MA, USA, Cat# M34152) following the manufacturer's instruction. In brief, primary cortical neurons (5 105 cells/well) cultured in 6-well plates were harvested. After washing, neurons were resuspended in 500 μl growth medium and incubated with JC-1 working solution (2 μM final concentration) in the dark at 37∘C for 30 min. For control neurons, the mitochondrial uncoupler, CCCP (50 μM final concentration), was added simultaneously with JC-1. Samples were then analyzed by using flow cytometry (BD Biosciences, CA, USA). Data were processed with the FlowJo software, and the results were represented as the average ratio of red to green fluorescence intensity.The increase of the mitochondrial permeability was measured by Ca2+-induced mitochondrial swelling as previously described [37]. Briefly, purified mitochondria were resuspended in an ice-cold mitochondrial swelling buffer without BSA and EDTA (300 mmol sucrose and 10 mmol/L Tris base, pH 7.4) to make the final concentration of mitochondrial protein at 0.25 mg/ml. An aliquot of mitochondria suspension (25 μl) and 200 μM CaCl2 was added to 1 ml mitochondrial swelling buffer mentioned above and monitored at 540 nm for 5 min with a microplate reader (SpectraMax®i3x, Molecular Devices, USA). The percentage of CaCl2-induced decrease in light transmission were used for statistical analysis.
Measurement of oxidative stress-induced damage
The homogenate of the peri-ischemic cortex tissues was collected. The levels of cellular MDA, SOD, GSH-PX GSH/GSSG in cortex tissues were detected with a Lipid Peroxidation MDA Assay Kit (Beyotime, Shanghai, China, Cat# S0131), SOD Assay Kit (Beyotime, Shanghai, China, Cat# S0103), Glutathione Peroxidase Activity (GSH-PX) Assay Kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China, Cat# A005), and GSH and GSSG Assay Kit (Beyotime Biotechnology, Shanghai, China, Cat# S0053) were used for detecting the levels of cellular MDA, SOD, GSH-PX GSH/GSSG in cortex tissues according to the instructions of the manufacturer.
Measurement of ATP content
ATP content was detected with an Enhanced ATP assay kit (Beyotime Biotechnology, Shanghai, China, Cat# S0027), following the manufacturer's instructions. In brief, the homogenate of peri-ischemic cortex tissues was collected and centrifuged at 12,000 g at 4∘C for 5 min. Then 20 μl supernatant and 100 μl ATP detection working solution were mixed and then luminescence was detected with a microplate reader (SpectraMax®i3x, Molecular Devices, USA). ATP concentration was first quantified according to a standard curve and then normalized to the protein concentration of each experimental group.
Statistical analysis
All statistical analyses were performed using SPSS 20.0 software. Data were presented as mean ± standard error of the mean (SEM). The normal distribution of the data was tested by Shapiro-Wilk normality test and variance was evaluated by the Levene's test for homogeneity of variance. The treatment effect on the behavior scores (mNSS score, rotarod test, grip strength test and cylinder test) was analyzed by a two-way repeated-measures analysis of variance (ANOVA) with Bonferroni post hoc test. For data of equal variance, Bonferroni's post hoc test was applied after one-way analysis of ANOVA; when the variance of data was unequal, one-way analysis of ANOVA with Dunnett's T3 post hoc test was performed. A value of p < 0.05 was considered statistically significant.
Results
OPA1 cleavage in response to cerebral ischemia/reperfusion injury in vivo and in vitro
To explore the effects of ischemic insult on OPA1 cleavage, the protein expression of OPA1 was examined at different time points in rat brains and cultured cortical neurons that respectively underwent transient middle cerebral artery occlusion (tMCAO) and OGD/reoxygenation (OGD/R). The results showed that the protein level of L-OPA1 significantly decreased and S-OPA1 level markedly elevated at 24h after tMCAO and persisted until 72 h; total OPA1 (T-OPA1) protein remained unchanged until 24 h after tMCAO and started to decline markedly at 72h after tMCAO (Fig. 1A and B). Similarly, the protein level of L-OPA1 decreased at 4h while S-OPA1 level increased at 8h after OGD/R and persisted until 12 h, Meanwhile, a marked reduction in the protein level of T-OPA1 was found at 12 h after OGD/R (Fig. 1C and D). These results indicate that OPA1 suffers a significant cleavage during the cerebral ischemia/reperfusion.
Fig. 1
OPA1 cleavage in animal and cellular models of ischemia/reperfusion. (A, B) Representative immunoblots(A) and quantitative results of the levels of OPA1 (B) in the peri-ischemic cortex after tMCAO. n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, *p < 0.05, ***p < 0.001 when compared with the Sham group. (C, D) Representative immunoblots (C) and quantitative results of the levels of OPA1 (D) in cultured neurons after OGD/R. n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, **p < 0.01, ***p < 0.001 when compared with the Cont group; (Cont = control).
OPA1 cleavage in animal and cellular models of ischemia/reperfusion. (A, B) Representative immunoblots(A) and quantitative results of the levels of OPA1 (B) in the peri-ischemic cortex after tMCAO. n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, *p < 0.05, ***p < 0.001 when compared with the Sham group. (C, D) Representative immunoblots (C) and quantitative results of the levels of OPA1 (D) in cultured neurons after OGD/R. n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, **p < 0.01, ***p < 0.001 when compared with the Cont group; (Cont = control).
Overexpression of L-OPA1 alleviates OGD/R-induced neuronal death and mitochondrial morphological damage
To investigate the effect of L-OPA1 level on cerebral ischemic insult, wild-type OPA1 variant 1 (OPA1-v1) and OPA1 variant 1 with a deficiency at the S1 cleavage site (190–200 amino-acid residues) (OPA1-v1S1) were generated (Fig. 2A) and respectively transfected with LV-OPA1-v1S1 and LV-OPA1-v1 into the cultured rat primary neurons. The results showed that both LV-OPA1-v1S1 and LV-OPA1-v1 transfection elevated the levels of L-OPA1 and T-OPA1; whereas, in LV-OPA1-v1S1-treated neurons, the overexpression of OPA1-v1S1 more markedly increased the L-OPA1 level when compared with the LV-OPA1-v1-treated group 12h after OGD/R (Fig. 2B–D). Moreover, the overexpression of L-OPA1 by LV-OPA1-v1S1 transfection more efficiently promoted cell viability and decreased LDH release when compared with the LV-OPA1-v1-treated group 12h after OGD/R condition (Fig. 2E and F). The changes of mitochondrial morphology in vitro were next observed under a confocal microscope. In normal condition, cultured neurons mainly exhibit long tubular mitochondria. However, 12h after OGD/R damage, the mitochondrial network of most neurons was almost completely fragmented when compared with the control neurons (approximately 72% vs. 9.6%). In OGD/R + LV-vector-transfected group, about 70% of neurons showed fragmented mitochondria, which was similar with the OGD/R group. Nevertheless, the LV-OPA1-v1S1-treated group significantly alleviated the OGD/R-induced mitochondrial damage by reducing the percentage of fragmented mitochondria to 27%, while the LV-OPA1-v1-treated group reported nearly 46% fragmented mitochondria (Fig. 2G and H). These results indicate that OPA1-v1S1 is a preferred regulator for attenuating OGD/R-induced neuronal death and mitochondrial network fragmentation. Hence, subsequent experiments concentrated on the roles of OPA1-v1S1 overexpression in mitochondrial morphology and neuronal death after cerebral ischemia/reperfusion injury.
Fig. 2
OPA1-v1S1 expression-induced L-OPA1 restoration and alleviation of OGD/R-induced neuronal death and mitochondrial morphological damage in vitro. (A) Schematic representation of OPA1-v1 and OPA1-v1S1 constructs and their process sites. (B) Representative immunofluorescence image exhibiting the overexpression of OPA1-v1S1 using GFP-containing lentivirus in cultured neurons. n = 3. (C, D) Representative immunoblots(C) and quantitative analysis of the levels of OPA1(D) in cultured neurons of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. *p < 0.05, ***p < 0.001 when compared with the Cont group, ##p < 0.01, ###p < 0.001 when compared with the OGD/R group,§§p < 0.01, §§§p < 0.001 when compared with the OGD/R + LV-OPA1-v1 (Cont = control). (E) Cell viability was detected by CCK-8 assay; n = 5. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Cont group, #p < 0.05, ###p < 0.001 when compared with the OGD/R group, §p < 0.05 when compared with the OGD/R + LV-OPA1-v1 (Cont = control). (F) Cell cytotoxicity was determined by LDH release assay; n = 5. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used. ***p < 0.001 when compared with the Cont group, #p < 0.05, ###p < 0.001, when compared with the OGD/R group, §p < 0.05 when compared with the OGD/R + LV-OPA1-v1 (Cont = control). (G) Representative confocal images of mitochondrial morphologies in different experimental groups are shown (magnification ). Cells with fragmented mitochondria: the majority mitochondria in a cell displayed a short, fragmented shape with a length shorter than 20 pixels. (H) Representative quantitative results of the percentage of cells with fragmented mitochondria, about 70–80 cells per experiment were scored. n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Cont group, ##p < 0.01, ###p < 0.001 when compared with the OGD/R group, §p < 0.05 when compared with the OGD/R + LV-OPA1-v1 (Cont = control).
OPA1-v1S1 expression-induced L-OPA1 restoration and alleviation of OGD/R-induced neuronal death and mitochondrial morphological damage in vitro. (A) Schematic representation of OPA1-v1 and OPA1-v1S1 constructs and their process sites. (B) Representative immunofluorescence image exhibiting the overexpression of OPA1-v1S1 using GFP-containing lentivirus in cultured neurons. n = 3. (C, D) Representative immunoblots(C) and quantitative analysis of the levels of OPA1(D) in cultured neurons of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. *p < 0.05, ***p < 0.001 when compared with the Cont group, ##p < 0.01, ###p < 0.001 when compared with the OGD/R group,§§p < 0.01, §§§p < 0.001 when compared with the OGD/R + LV-OPA1-v1 (Cont = control). (E) Cell viability was detected by CCK-8 assay; n = 5. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Cont group, #p < 0.05, ###p < 0.001 when compared with the OGD/R group, §p < 0.05 when compared with the OGD/R + LV-OPA1-v1 (Cont = control). (F) Cell cytotoxicity was determined by LDH release assay; n = 5. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used. ***p < 0.001 when compared with the Cont group, #p < 0.05, ###p < 0.001, when compared with the OGD/R group, §p < 0.05 when compared with the OGD/R + LV-OPA1-v1 (Cont = control). (G) Representative confocal images of mitochondrial morphologies in different experimental groups are shown (magnification ). Cells with fragmented mitochondria: the majority mitochondria in a cell displayed a short, fragmented shape with a length shorter than 20 pixels. (H) Representative quantitative results of the percentage of cells with fragmented mitochondria, about 70–80 cells per experiment were scored. n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Cont group, ##p < 0.01, ###p < 0.001 when compared with the OGD/R group, §p < 0.05 when compared with the OGD/R + LV-OPA1-v1 (Cont = control).
Overexpression of L-OPA1 improves motor function recovery and attenuates infarct volume after cerebral ischemia/reperfusion injury
To further ascertain the role of L-OPA1 level in cerebral ischemia/reperfusion injury, AAV-OPA1-v1S1 was injected into rat cortex and striatum. The levels of L-OPA1 and T-OPA1 were notably enhanced in rat brain injected with AAV-OPA1-v1S1 (Fig. 3A–C). Afterwards, four neurobehavioral tests (mNSS score, rotarod test, grip strength test, and cylinder test) were conducted to assess the effect of the AAV-OPA1-v1S1 on the motor function recovery of contralateral limbs in tMCAOrats. Performance on the mNSS score, evaluated at day 1, 2 and 3 after tMCAO, showed that neurological deficit in the AAV-OPA1-v1S1-treated group was notably curtailed at day 3 after tMCAO when compared with that of ischemicrats (Fig. 3D). Similar to the results of mNSS score, the time rats stayed on the rod was markedly longer in AAV-OPA1-v1S1-treated group than that of those in tMCAO group rats at day 2 after tMCAO (Fig. 3E). The grip strength test demonstrated improved recovery of grip strength in the AAV-OPA1-v1S1-treated group when compared with tMCAO group rats at day 2 after tMCAO (Fig. 3F). Similar results were also observed in cylinder test: the AAV-OPA1-v1S1-treated ischemicrats displayed decreased ipsilateral forepaw preference when compared with the tMCAO group rats at 3 days after tMCAO (Fig. 3G). Besides, the brain infarct volume determined at day 3 after tMCAO was also notably smaller in the AAV-OPA1-v1S1-treated group than in the tMCAO group rats (Fig. 3H and I). These results indicate that L-OPA1 overexpression exert beneficial effects on in acute ischemic stroke.
Fig. 3
The improved motor function recovery and decreased infarct volume by OPA1-v1S1 expression after cerebral ischemia/reperfusion injury in vivo. (A) Representative immunofluorescence image exhibiting the overexpression of OPA1-v1S1 using GFP-containing adeno-associated virus in brain cortex (magnification ). n = 3. (B, C) Representative immunoblots(B) and quantitative analysis of the levels of OPA1(C) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. *p < 0.05, ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group (D–G) Behavioral, functional tests including mNSS score(D), rotarod test(E), grip strength test(F), cylinder test(G) were performed to evaluate the motor function in different experimental groups; n = 10. Data are expressed as mean ± SEM. Repeated-measures analysis of variance (ANOVA) followed by Bonferroni's multiple comparisons posttest was used. ***p < 0.001 when compared with the Sham group, ##p < 0.01, ###p < 0.001 when compared with the tMCAO group. (H, I) Representative T2-weighted MR images(H) and quantitative analysis of infarct volume(I) in different experimental groups; n = 10. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used. ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group.
The improved motor function recovery and decreased infarct volume by OPA1-v1S1 expression after cerebral ischemia/reperfusion injury in vivo. (A) Representative immunofluorescence image exhibiting the overexpression of OPA1-v1S1 using GFP-containing adeno-associated virus in brain cortex (magnification ). n = 3. (B, C) Representative immunoblots(B) and quantitative analysis of the levels of OPA1(C) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. *p < 0.05, ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group (D–G) Behavioral, functional tests including mNSS score(D), rotarod test(E), grip strength test(F), cylinder test(G) were performed to evaluate the motor function in different experimental groups; n = 10. Data are expressed as mean ± SEM. Repeated-measures analysis of variance (ANOVA) followed by Bonferroni's multiple comparisons posttest was used. ***p < 0.001 when compared with the Sham group, ##p < 0.01, ###p < 0.001 when compared with the tMCAO group. (H, I) Representative T2-weighted MR images(H) and quantitative analysis of infarct volume(I) in different experimental groups; n = 10. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used. ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group.
Overexpression of L-OPA1 inhibits cerebral ischemia/reperfusion injury-induced neuronal apoptosis
The effects of L-OPA1 level on neuronal apoptosis were subsequently explored. A significant decrease in Bcl-2 protein and a notable activation of Bax and Cleaved caspase-3 proteins were observed in the cortex of tMCAO-operated rats and AAV-empty-treated rats 3 days after tMCAO. The injection of OPA1-v1S1 markedly elevated Bcl-2 protein level and downregulated the expression of Bax and Cleaved caspase-3 when compared with the tMCAO-operated group. However, no marked alteration of pro-Caspase-3 level was found in each group (Fig. 4A–E). Consistently, the cortex from the tMCAO-operated group and AAV-empty-treated group exhibited a progressively-increased percentage of TUNEL positive cells 3 days after tMCAO. However, the percentage of TUNEL positive cells was significantly curtailed after OPA1-v1S1 injection when compared with the tMCAO-operated group (Fig. 4F and G). On the other hand, the flow cytometry analysis further demonstrated that excessive apoptosis of cultured neurons was triggered at 12h after OGD/R, which was markedly attenuated in LV-OPA1-v1S1-treated group (Fig. 4H and I). Altogether, the results indicate that the upregulation of L-OPA1 is involved in inhibiting neuronal apoptosis after cerebral ischemia/reperfusion insult in vivo and in vitro.
Fig. 4
The inhibited cerebral ischemia/reperfusion injury-induced neuronal apoptosis in vivo and in vitro by OPA1-v1S1 expression. (A–D) Representative immunoblots (A) and quantitative results of the levels of Cleaved caspase-3(B), Caspase-3(C) and Bcl-2(D) and in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Sham group, ##p < 0.01 when compared with the tMCAO group. (E) Representative quantitative results of the levels of Bax in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used. **p < 0.01 when compared with the Sham group, #p < 0.05 when compared with the tMCAO group. (F, G) Representative images of terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining(F) and quantitative results of the percentage of TUNEL-positive cells(G) in the cortex of different experimental groups, Red arrows indicate TUNEL-positive cells; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Sham group; ###p < 0.001 when compared with the tMCAO group. (H, I) Flow cytometry analysis of cultured primary neurons apoptotic percentage in different experimental groups; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Cont group; ###p < 0.001 when compared with the OGD/R group (Cont = control). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
The inhibited cerebral ischemia/reperfusion injury-induced neuronal apoptosis in vivo and in vitro by OPA1-v1S1 expression. (A–D) Representative immunoblots (A) and quantitative results of the levels of Cleaved caspase-3(B), Caspase-3(C) and Bcl-2(D) and in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Sham group, ##p < 0.01 when compared with the tMCAO group. (E) Representative quantitative results of the levels of Bax in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used. **p < 0.01 when compared with the Sham group, #p < 0.05 when compared with the tMCAO group. (F, G) Representative images of terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining(F) and quantitative results of the percentage of TUNEL-positive cells(G) in the cortex of different experimental groups, Red arrows indicate TUNEL-positive cells; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Sham group; ###p < 0.001 when compared with the tMCAO group. (H, I) Flow cytometry analysis of cultured primary neurons apoptotic percentage in different experimental groups; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Cont group; ###p < 0.001 when compared with the OGD/R group (Cont = control). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Overexpression of L-OPA1 restores the morphology of the mitochondrial cristae and the mitochondrial length after cerebral ischemia/reperfusion injury
To assess the therapeutic effects of L-OPA1 overexpression on abnormal mitochondrial ultrastructure in the brain after ischemia/reperfusion insult, the changes in mitochondrial ultrastructure in tMCAO models were investigated by transmission electron microscopy 3 days after tMCAO. Mitochondria were classified into the following types as previously described [38]: beyond four cristae (Class I), two or three cristae (Class II), no more than one cristae (Class III); mitochondria with a dense matrix (Class A), swollen mitochondria with hypodense matrix (Class B) (Fig. 5A). In the Sham rats, brain cortex exhibited nearly 79% Class I and 95% Class A mitochondria. However, in tMACO-injured group, mitochondria underwent extensive damage with approximately 67% Class III and 80% Class B mitochondria, and significantly shorter mitochondrial length. The mitochondrial ultrastructure and length in the AAV-empty-treated group were analogous to those of the tMACO group, with nearly 73% Class III and 85% Class B mitochondria. Nevertheless, the overexpression of OPA1-v1S1 significantly alleviated abnormal mitochondrial ultrastructure, which showed approximately 50% Class I, 20% Class III, and 34% class B mitochondria. In addition, the improved mitochondrial length was also observed in the AAV-OPA1S1-treated group (Fig. 5B–E). These data show that after cerebral ischemia/reperfusion injury, L-OPA1 overexpression can effectively remodel the mitochondrial ultrastructure.
Fig. 5
The restored mitochondrial cristae morphology and mitochondrial length after cerebral ischemia/reperfusion injury in vivo by OPA1-v1S1 expression. (A) Representative transmission electron microscopy (TEM) images of mitochondrial cristae number and matrix density and swelling in brain cortex. (B) Representative TEM images in the cortex of different experimental groups. (C) 50–60 mitochondria per experiment were scored in three categories: beyond four cristae (Class I), two or three cristae (Class II), no more than one cristae (Class III) per mitochondrion. (D) 50–60 mitochondria per experiment were scored based on matrix density and swelling: mitochondria with a dense matrix (Class A), swollen mitochondria with hypodense matrix (Class B). (E) Representative quantitative results of mitochondrial length with 50–60 mitochondria per experiment. n = 3, Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test, ***p < 0.001 when compared with the Sham; ###p < 0.001 when compared with the tMCAO group.
The restored mitochondrial cristae morphology and mitochondrial length after cerebral ischemia/reperfusion injury in vivo by OPA1-v1S1 expression. (A) Representative transmission electron microscopy (TEM) images of mitochondrial cristae number and matrix density and swelling in brain cortex. (B) Representative TEM images in the cortex of different experimental groups. (C) 50–60 mitochondria per experiment were scored in three categories: beyond four cristae (Class I), two or three cristae (Class II), no more than one cristae (Class III) per mitochondrion. (D) 50–60 mitochondria per experiment were scored based on matrix density and swelling: mitochondria with a dense matrix (Class A), swollen mitochondria with hypodense matrix (Class B). (E) Representative quantitative results of mitochondrial length with 50–60 mitochondria per experiment. n = 3, Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test, ***p < 0.001 when compared with the Sham; ###p < 0.001 when compared with the tMCAO group.
Overexpression of L-OPA1 inhibits OGD/R-induced mitochondrial bioenergetics deficits in cortical neurons
To further explore the role of L-OPA1 level in regulating cerebral ischemia/reperfusion-induced mitochondrial dysfunction, we assessed mitochondrial oxygen consumption rate (OCR) in cortical neurons using the Seahorse XFe24 analyzer (Fig. 6A). A marked decrease in the basal respiration was observed in OGD/R and OGD/R + LV-vector group 12 h after OGD/R, which was largely reversed by the expression of LV-OPA1-v1S1. The first compound oligomycin, an ATP-synthase inhibitor, was added to evaluate the ATP-linked respiration. The next compound FCCP, a mitochondrial uncoupler, was added to evaluate the maximal respiration and determine the spare respiratory capacity. Finally, rotenone (the complex I inhibitor) and antimycin A (the complex III inhibitor) were respectively added to measure the non-mitochondrial respiration. Similar to the results of basal respiration, the ATP-linked respiration, the maximal respiration, and the spare respiratory capacity declined in OGD/R and OGD/R + LV-vector neurons, and the reductions of the four phases of respiration were significantly reinforced in the OGD/R + LV-OPA1-v1S1-treated neurons. What's more, a significantly-enhanced non-mitochondrial respiration was detected in the OGD/R neurons transfected with OPA1-v1S1. However, no distinguishable differences were observed in the proton leak respiration of each group (Fig. 6B–G). In addition, in vivo studies found that cerebral ischemia/reperfusion-induced ATP depletion in the cortex was also prevented in the AAV-OPA1-v1S1-treated group, which further confirmed the changes in ATP levels (Fig. 6H). These results evidence the key role of L-OPA1 in maintaining mitochondrial bioenergetics.
Fig. 6
The inhibited OGD/R-induced mitochondrial bioenergetics deficits in vitro by OPA1-v1S1 expression. (A) Representative OCR profile at baseline and after the injection of oligomycin (1 μM), FCCP (1 μM), and rotenone/antimycin (0.5 μM). (B–G) Quantitative results of basal respiration(B), ATP-linked respiration(C), proton leak respiration(D), maximal respiration(E), spare respiratory capacity(F), and non-mitochondrial respiration(G); n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Cont group, #p < 0.05, ###p < 0.001 when compared with the OGD/R group (Cont = control). (H) Quantitative results of the levels of ATP in the cortex of different experimental groups; n = 5. ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group.
The inhibited OGD/R-induced mitochondrial bioenergetics deficits in vitro by OPA1-v1S1 expression. (A) Representative OCR profile at baseline and after the injection of oligomycin (1 μM), FCCP (1 μM), and rotenone/antimycin (0.5 μM). (B–G) Quantitative results of basal respiration(B), ATP-linked respiration(C), proton leak respiration(D), maximal respiration(E), spare respiratory capacity(F), and non-mitochondrial respiration(G); n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used. ***p < 0.001 when compared with the Cont group, #p < 0.05, ###p < 0.001 when compared with the OGD/R group (Cont = control). (H) Quantitative results of the levels of ATP in the cortex of different experimental groups; n = 5. ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group.
Overexpression of L-OPA1 attenuates cerebral ischemia/reperfusion-induced oxidative stress
Oxidative stress is one of the crucial pathogenic factors involved in cerebral ischemia/reperfusion injury. The activity of MDA was significantly elevated in the cortex of tMCAO-operated rats and AAV-empty-treated rats 3 days after tMCAO, whereas OPA1-v1S1 expression reduced the generation of MDA (Fig. 7A). Besides, the levels of SOD, GSH-Px and GSH/GSSG ratio decreased as a result of cerebral ischemia/reperfusion damage, while the expression of OPA1-v1S1 reinforced the activity of these antioxidative factors when compared with the tMCAO-operated group (Fig. 7B–D). In addition, ROS, a major factor regulating cellular oxidative stress, was overproduced characterized by enhanced DHE fluorescence intensity 12h after OGD/R in the cultured primary neurons, which was markedly attenuated in the LV-OPA1-v1S1-treated group (Fig. 7E). These results demonstrate that L-OPA1 overexpression alleviates the oxidative damage after cerebral ischemia/reperfusion injury.
Fig. 7
The attenuated cerebral ischemia/reperfusion-induced oxidative stress in vivo and in vitro by OPA1-v1S1 expression. (A–D) Quantitative results of the levels of MDA(A), SOD(B), GSH-Px(C) and GSH/GSSG ratio(D) in the cortex of different experimental groups; n = 5. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used,***p < 0.001 when compared with the Sham group; #p < 0.05, ###p < 0.001 when compared with the tMCAO group. (E, F) Representative confocal images of DHE fluorescence staining(E) and quantitative assays of fluorescence intensity(F) in cultured neurons of different experimental groups; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Cont group; ###p < 0.001 when compared with the OGD/R group (Cont = control).
The attenuated cerebral ischemia/reperfusion-induced oxidative stress in vivo and in vitro by OPA1-v1S1 expression. (A–D) Quantitative results of the levels of MDA(A), SOD(B), GSH-Px(C) and GSH/GSSG ratio(D) in the cortex of different experimental groups; n = 5. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used,***p < 0.001 when compared with the Sham group; #p < 0.05, ###p < 0.001 when compared with the tMCAO group. (E, F) Representative confocal images of DHE fluorescence staining(E) and quantitative assays of fluorescence intensity(F) in cultured neurons of different experimental groups; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Cont group; ###p < 0.001 when compared with the OGD/R group (Cont = control).
Overexpression of L-OPA1 preserves mitochondrial integrity after cerebral ischemia/reperfusion injury
The disruption of mitochondrial integrity is a critical initial change in response to post-ischemic damage. Therefore, we tested the potential effects of L-OPA1 level on mitochondrial integrity. The results showed that OGD/R induced extensive mitochondrial membrane potential (m) depolarization, as reflected by a dramatical increase in JC-1 monomers formation (green uorescence) and a notable loss of JC-1 aggregates (red uorescence) in cultured neurons, while OPA1-v1S1 expression relieved this membrane depolarization (Fig. 8A–B). Meanwhile, a significant opening of mPTP as evidenced by the decreased light transmission was observed in the cortex of the tMCAO-operated rats and AAV-empty-treated rats 3 days after tMCAO, which was notably alleviated by OPA1-v1S1 expression when compared with the tMCAO-operated group (Fig. 8C). Besides, cytosolic Cyt c levels increased progressively while mitochondrial Cyt c levels reduced gradually in the cortex of the tMCAO-operated rats and AAV-empty-treated rats 3 days after tMCAO. The expression of OPA1-v1S1 markedly diminished the Cyt c level in the cytosol, which was associated with a dramatical increment of Cyt c level in the mitochondrial fraction when compared with the tMCAO-operated group (Fig. 8D–G). Consistently, an extended diffusion of Cyt c into the nucleus was observed by immunofluorescence assay 3 days post-tMCAO. However, it was attenuated by the OPA1-v1S1 expression when compared with the tMCAO-operated group (Fig. 8H and I). These results indicate that the therapeutic role of mitochondrial function is linked with the preservation of mitochondrial integrity.
Fig. 8
Expression of OPA1-v1S1 preserves mitochondrial integrity after cerebral ischemia/reperfusion injury in vivo and vitro. (A, B) Representative flow cytometric analysis of JC-1 expression(A) and quantitation results of JC-1 aggregates (red uorescence) compare to JC-1 monomers (green uorescence) (B) in cultured primary neurons of different experimental groups; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Cont group; ##p < 0.05 when compared with the OGD/R group (Cont = control). (C) Quantitative results of mPTP opening in the cortex of different experimental groups; n = 5. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, ***p < 0.001 when compared with the Sham group; #p < 0.05 when compared with the tMCAO group. (D, E) Representative immunoblots(D) and quantitative results of the Cyt c level(E) in the mitochondrial fractions in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Sham group; ###p < 0.001 when compared with the tMCAO group. (F–H) Representative immunoblots(F) and quantitative results of the levels of Cyt c(G) and AIF(H) in the cytosol fractions in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Sham group; #p < 0.05, ##p < 0.01 when compared with the tMCAO group. (I, J) Representative confocal images of Cyt c fluorescence(I) and quantitative results of Cyt c expression(J) in the cortex of different experimental groups. DAPI was used to label the nuclei; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Expression of OPA1-v1S1 preserves mitochondrial integrity after cerebral ischemia/reperfusion injury in vivo and vitro. (A, B) Representative flow cytometric analysis of JC-1 expression(A) and quantitation results of JC-1 aggregates (red uorescence) compare to JC-1 monomers (green uorescence) (B) in cultured primary neurons of different experimental groups; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Cont group; ##p < 0.05 when compared with the OGD/R group (Cont = control). (C) Quantitative results of mPTP opening in the cortex of different experimental groups; n = 5. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, ***p < 0.001 when compared with the Sham group; #p < 0.05 when compared with the tMCAO group. (D, E) Representative immunoblots(D) and quantitative results of the Cyt c level(E) in the mitochondrial fractions in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Sham group; ###p < 0.001 when compared with the tMCAO group. (F–H) Representative immunoblots(F) and quantitative results of the levels of Cyt c(G) and AIF(H) in the cytosol fractions in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ***p < 0.001 when compared with the Sham group; #p < 0.05, ##p < 0.01 when compared with the tMCAO group. (I, J) Representative confocal images of Cyt c fluorescence(I) and quantitative results of Cyt c expression(J) in the cortex of different experimental groups. DAPI was used to label the nuclei; n = 3. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, ***p < 0.001 when compared with the Sham group, ###p < 0.001 when compared with the tMCAO group. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Overexpression of L-OPA1 promotes mitochondrial biogenesis after cerebral ischemia/reperfusion injury
The mitochondrial self-renewal in the cortex after cerebral ischemia/reperfusion injury and alternations in mitochondrial biogenesis were then explored to determine their potential role in L-OPA1-mediated neuroprotection. Western-blot assays indicated that the protein level of PGC-1α was mildly increased 3 days after tMCAO, while cerebral ischemia/reperfusion-induced alternations in either NRF-1 or TFAM protein levels were not detected (Fig. 9A–D). Interestingly, the expression of OPA1-v1S1 significantly upregulated the protein levels of PGC-1α, NRF-1 and TFAM. Consistently, a concomitant increment in PGC-1α mRNA level was also detected, but the NRF-1 and TFAM mRNA levels were not observed by RT-PCR. The OPA1-v1S1 expression notably elevated their mRNA levels (Fig. 9E–G). In addition, the mtDNA content was detected, and a notable increase of mtDNA content by OPA1-v1S1 expression was observed when compared with the tMCAO-operated group (Fig. 9H). These results suggest that L-OPA1 overexpression enhance mtDNA content and mitochondrial biogenesis in ischemicrats.
Fig. 9
The promoted mitochondrial biogenesis after cerebral ischemia/reperfusion injury in vivo by OPA1-v1S1 expression. (A–D) Representative immunoblots(A) and quantitative results of the levels of PGC-1α(B), NRF-1(C) and TFAM(D) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, *p < 0.05 when compared with the Sham group; #p < 0.05, ##p < 0.01 when compared with the tMCAO group. (E, F) Quantitative results of the mRNA levels of PGC-1α(E) and NRF-1(F) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, *p < 0.05, **p < 0.01 when compared with the Sham group; ##p < 0.01, ###p < 0.001 when compared with the tMCAO group. (G) Quantitative results of the mRNA levels of TFAM in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ###p < 0.001 when compared with the tMCAO group. (H) Quantitative results of relative mtDNA amount (mtDNA copy number per nuclear DNA copy number) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, **p < 0.01, ***p < 0.001 when compared with the Sham group; #p < 0.05 when compared with the tMCAO group.
The promoted mitochondrial biogenesis after cerebral ischemia/reperfusion injury in vivo by OPA1-v1S1 expression. (A–D) Representative immunoblots(A) and quantitative results of the levels of PGC-1α(B), NRF-1(C) and TFAM(D) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, *p < 0.05 when compared with the Sham group; #p < 0.05, ##p < 0.01 when compared with the tMCAO group. (E, F) Quantitative results of the mRNA levels of PGC-1α(E) and NRF-1(F) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, *p < 0.05, **p < 0.01 when compared with the Sham group; ##p < 0.01, ###p < 0.001 when compared with the tMCAO group. (G) Quantitative results of the mRNA levels of TFAM in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Bonferroni's post hoc test was used, ###p < 0.001 when compared with the tMCAO group. (H) Quantitative results of relative mtDNA amount (mtDNA copy number per nuclear DNA copy number) in the cortex of different experimental groups; n = 4. Data are expressed as mean ± SEM. One-way analysis of ANOVA with Dunnett's T3 post hoc test was used, **p < 0.01, ***p < 0.001 when compared with the Sham group; #p < 0.05 when compared with the tMCAO group.
Discussion
In the current study, we investigated the effects of L-OPA1 on cerebral ischemia/reperfusion injury in rats. We found a significant cleavage of OPA1 in response to cerebral ischemia/reperfusion injury in vivo and in vitro. We also showed that the restoration of L-OPA1 levels markedly alleviated OGD/R-induced cytotoxicity in neurons and prompted neurological functional recovery after ischemia/reperfusion insult. Furthermore, the overexpression of L-OPA1 resulted in curtailed neuronal apoptosis by enhancing Bcl-2 and decreasing the activation of Bax and caspase-3. Last, the overexpression of L-OPA1 improved mitochondrial dysfunction by restoring mitochondrial morphology and ultrastructure, inhibiting mitochondrial bioenergetics deficits and oxidative stress, preserving mitochondrial integrity and promoting mitochondrial biogenesis in the post-ischemic brain.It is well known that mitochondrial dynamics is critical for neuronal development and maturation. Among the genes regulating mitochondrial dynamics, the roles of OPA1 have attracted widespread attention. The OPA1 protein exists widely in different tissues, containing eight mRNA variants due to the alternative splicing at exons 4, 4b and 5b [39]. After imported into mitochondria, the OPA1 precursors undergo various forms of proteolytic processing, resulting in long-form and short-form physiological homeostasis under normal conditions [40]. However, the previous study has reported that OPA1 is cleaved to S-OPA1 after retinal ischemia/reperfusion injury, leading to a markedly-decreased L-OPA1 level [20]. Additionally, a rapid cleavage of OPA1 is evidenced after neonatal hypoxic-ischemic injury [41]. Similarly, we observed a dramatic decrease in L-OPA1 and T-OPA1 levels after cerebral ischemia/reperfusion damage in rats and OGD/reoxygenation insult in cortical neurons. The change of L-OPA1 levels is mainly due to the continuous activation of ATP-independent metalloprotease OMA1 under pathological conditions, which cleaves OPA1 at the site S1 in exon 5, leading to the increase of s-forms [42]. The current findings suggest that the decline of L-OPA1 level may participate in the initiation of cerebral ischemia/reperfusion insult and L-OPA1 administration may be an endogenous therapeutic candidate under ischemia/reperfusion conditions. However, unlike our finding, a previous study reported no significant reduction of long-forms of OPA1 in hippocampus after global ischemia [43]. This discrepancy may arise from the differences in animal models and tissues used for analysis.Existent studies mainly focus on the vital role of T-OPA1 in various stress-induced tissue damage and cell loss, such as ischemia-injured hearts and brains and Fas-associated liver apoptosis [19]. Studies have found that T-OPA1 overexpression delays the degeneration of DOA-induced retinal ganglion cells in mice [44] and that alterations of T-OPA1 levels delays neuronal maturation by affecting the synaptic formation and dendritic outgrowth in rat primary cortical neurons [45]. Additional evidence suggests that OPA1 administration prolongs cerebellar granule neuronal survival and rescues mitochondrial morphology after NMDA-induced excitotoxicity [46]. The current study, however, found that OPA1-S1 transfection in primary cortical neurons markedly elevated L-OPA1 levels when compared with OPA1 transfection and was accompanied by lower neurotoxicity, longer neuron survival and more efficient restoration of mitochondrial morphology. This discrepancy may be accounted for the fact that OPA1-S1 injection achieves a dynamic balance between s-forms and l-forms by more efficiently recovering L-OPA1 levels, which is more closely analogous to physiological conditions. Such view is supported by previous studies demonstrating a neuroprotective role of L-OPA1 involving alleviating neurodegeneration [20,47]. Therefore, these results indicate that OPA1-S1 may be a preferred candidate for neuroprotection after ischemia/reperfusion damage.Neurological damage is mainly caused by the severe damage of brain tissues after ischemia/reperfusion injury. At the same time, muscle weakness, impaired motor coordination and asymmetry in forelimb use also occur due to the contralateral limb motor dysfunction and sensory disturbance located in the cerebral cortex and striatum. We, therefore, explored the effects of L-OPA1 on functional outcome after ischemia/reperfusion insult by evaluating the mNSS scores, rotarod performance, forelimb symmetry, and grip strength of tMCAO-injured rats. We found that the administration of OPA1-S1 inhibited neurological deficits, improved motor coordination, and enhanced the muscle strength and use of ipsilateral forelimbs. Moreover, in line with a previous study [19], we also found a remarkable reduction in the infarct size after OPA1-S1 was injected into the brain of rats. This reduction of infarct size in the cortex may be associated with neurological functional recovery.The initiation of neuronal apoptosis is a typical pattern of programmed cell death tightly regulated by secondary death pathway and influences the pathological process of various diseases, including cerebral ischemia/reperfusion injury [48]. Apoptotic body morphology characterized by profound DNA fragmentation is a crucial feature of apoptotic cell death [49]. Among the genes regulating apoptosis, antiapoptotic gene Bcl-2 and pro-apoptotic gene Bax of the Bcl-2 family are widely studied. Furthermore, caspase-3 is the primary executor of apoptosis. We found a marked decline of Bcl-2 and apparent activation of Bax and caspase-3, accompanied by more TUNEL-positive cells in the peri-ischemic cortex after stroke and a significant increment of apoptotic rates following OGD/R injury, which is consistent with previous research [50,51]. However, in the current study, L-OPA1 overexpression ameliorated neurons loss by improving the above toxic effects. Similar to our present findings, a recent study evidences an anti-apoptotic effect in OPA1transgenic mice with Fas-induced liver injury by reducing TUNEL-positive hepatocytes [19]. Therefore, our results suggest the restoration of L-OPA1 is associated with the protection of ischemia-induced apoptotic brain damage.The structure and number of mitochondrial cristae play a vital role in maintaining mitochondrial function. Tight cristae junctions can prevent the spread of small molecules and membrane proteins under physiological conditions [52]. However, stress-induced cristae modulation characterized by wide cristae junctions and decreased cristae number both result in the release of Cyt c [53]. Our observation of significant damage to the mitochondrial cristae and the mitochondrial length after cerebral ischemia/reperfusion indicates severe neuronal dysfunction, while the injection with OPA1-v1S1 alleviated damage effects of cerebral ischemia/reperfusion on the mitochondrial ultrastructure. Such results are in agreement with previous studies demonstrating the involvement of OPA1 in ameliorating the remodeling of mitochondrial cristae [18,19,38]. Additionally, mitochondria can regulate their activity by adjusting the morphology of mitochondrial cristae upon various metabolic conditions: “orthodox” mitochondria characterized by a hypodense matrix with tight cristae would be converted to “condensed” mitochondria accompanied by a dense matrix with expanded cristae when mitochondrial respiration is activated [54]. Moreover, cristae structure has been demonstrated to regulate mitochondrial respiratory function [55], suggesting that the L-OPA1-induced improvement of mitochondrial ultrastructure might be associated with the bioenergetic status. Given the OCR data, we found that L-OPA1 maintains mitochondrial bioenergetics by reversing the OGD/R-induced reduction of related bioenergetics parameters and tMCAO-induced depletion of ATP, which is also consistent with previous studies demonstrating a decreased mitochondrial respiration in OPA1-depleted cortical neurons and enhanced mitochondrial bioenergetics in other OPA1-overexpressing cell models [[56], [57], [58]].The oxidative stress have been well-established as a key pathological feature of cerebral ischemic stroke. The oxidative stress is activated by excessive production of ROS and limited antioxidant enzyme activities, eventually leading to neuronal death, as evidenced by abnormal changes in proteins, lipids, and DNA [[59], [60], [61]]. Therefore, it is essential for cell survival to increase the activity of enzymatic and nonenzymatic components in antioxidant defense systems that participate in ROS detoxification. Influenced by the excessive ROS production, MDA, a lipid peroxidation product with an aldehyde group, can indirectly reflect the degree of tissue oxidative stress damage. In addition, as important endogenous free-radical scavengers, the antioxidant enzymes SOD and GPx and the non-enzymatic ingredient GSH directly neutralize reactive oxygen by synergistic action, thereby reducing cellular peroxidative damage [62,63]. Recent studies show that excessive ROS accumulation is present in OPA1-mutant drosophila and cardiomyocytes [64,65]. Such results are evidenced by in vivo study suggesting the involvement of OPA1 overexpression in decreasing mitochondrial ROS production [19]. In agreement with previous studies, we also found that the stabilization of L-OPA1 reduced cerebral ischemia/reperfusion-induced exorbitant ROS and MDA generation by increasing the activity of antioxidant components such as SOD, GPX, and GSH/GSSG ratio. These results suggest that L-OPA1 may act as an attractive target for quenching oxidative stress-induced neuronal damage after ischemia/reperfusion.Mitochondrial permeability transition pore (mPTP), a high conductance pathway associated with the permeabilization of the mitochondrial membrane, has aroused great interest in recent years. Transient mPTP opening can maintain physiological Ca2+ homeostasis; whereas, persistent mPTP opening results in Ca2+ overload and Cyt c release from mitochondria to the cytosol through a wave of membrane depolarization and the remodeling of cristae, eventually triggering necrotic cell death under stressful conditions [66,67]. Previous research demonstrates that mitochondrial swelling is involved in ischemia-induced brain injury [68]. In our current study, an unusual mitochondrial swelling was found following cerebral ischemia/reperfusion damage, which induced mPTP opening and the release of Cyt c and AIF. However, the treatment with OPA1-v1S1 was able to preserve mitochondrial integrity by blocking mPTP opening and the release of Cyt c and AIF. Our results are consistent with the notion that OPA1 is involved in maintaining cristae structure and resisting Cyt c release [13,57]. In addition, ischemia-induced excessive mitochondrial ROS generation can also trigger the disruption of m except for oxidative stress [69]. Recent evidence has suggested that m is altered in lymphoblastoid cell lines with OPA1 mutation [70]. In our study, we performed flow cytometry to monitor JC-1 fluorescence and found a sharp drop in m, as reflected by a significant decrease in red/green fluorescence intensity, which was markedly reversed after administration of OPA1-v1S1. These results illustrate that the therapeutic effects of L-OPA1 on ischemia/reperfusion-induced neuronal injury are linked to improved mitochondrial integrity.Mitochondrial biogenesis, a highly-regulated procedure responsible for cellular adaptation, presents a novel therapeutic target for ischemic heart disease [71]. NRF-1, TFAM, and PGC-1α are the most widely-studied protein factors controlled by nuclear genes and are involved in mitochondrial biogenesis [72]. It has been demonstrated that ischemia/reperfusion and neonatal hypoxia-ischemia rapidly elicit mitochondrial biogenesis in rats [10,73]. Contrarily, no significant changes in the expression of NRF-1 and TFAM were detected in rats following ischemia/reperfusion. These inconsistent findings might be attributed to the fact that the ability of adaptive mitochondrial biogenesis may decline with age [74]. Additionally, the different expression levels of tissues in different regions may also result in a controversial result. mtDNA content reflects the abundance of mitochondria and is also a typical marker of mitochondrial biogenesis. Another study has proven the involvement of L-OPA1 overexpression in regulating mitochondrial content in ischemia-induced retinal injury [20]. Similarly, our current study demonstrated that the overexpression of L-OPA1 increased the mtDNA copy number after cerebral ischemia/reperfusion damage. In addition, an upregulation of NRF-1, TFAM, and PGC-1α expression was also observed in the peri-ischemic cortex in the AAV-OPA1-v1S1-treated group, indicating that the restoration of L-OPA1 may evoke a mitochondrial protective effect through promoting mitochondrial biogenesis after cerebral ischemia/reperfusion injury.Several limitations need mentioning in our study. First, we mainly investigated the effects of L-OPA1 expression in cultured primary neurons at 12 h after OGD/R and rats at 72 h after tMCAO, but we did not examine the changes of mitochondrial function at other time points. Further studies are awaited to explore the changes at other time-points. Second, the current study addressed the neuroprotective role of L-OPA1 restoration on cortical tissues and neurons and other brain regions and cell types in the brain after cerebral ischemia/reperfusion need further examination. Furthermore, the present study primarily concentrated on the effects of L-OPA1 restoration on acute ischemic stroke, but further efforts need to investigate the effects of L-OPA1 restoration on the long-term cell survival and functional recovery outcomes in ischemicrats.In summary, our current study has provided novel evidence demonstrating that the restoration of L-OPA1 can protect neurons against acute ischemia/reperfusion damage via attenuating neuronal apoptosis and preserving mitochondrial function. Thus, L-OPA1 may appear to be a potential therapeutic target for stroke prevention and treatment.
Authors: Florian L Muller; Michael S Lustgarten; Youngmok Jang; Arlan Richardson; Holly Van Remmen Journal: Free Radic Biol Med Date: 2007-04-10 Impact factor: 7.376
Authors: C Delettre; J M Griffoin; J Kaplan; H Dollfus; B Lorenz; L Faivre; G Lenaers; P Belenguer; C P Hamel Journal: Hum Genet Date: 2001-10-30 Impact factor: 4.132
Authors: Christian Frezza; Sara Cipolat; Olga Martins de Brito; Massimo Micaroni; Galina V Beznoussenko; Tomasz Rudka; Davide Bartoli; Roman S Polishuck; Nika N Danial; Bart De Strooper; Luca Scorrano Journal: Cell Date: 2006-07-14 Impact factor: 41.582
Authors: Anne Korwitz; Carsten Merkwirth; Ricarda Richter-Dennerlein; Simon E Tröder; Hans-Georg Sprenger; Pedro M Quirós; Carlos López-Otín; Elena I Rugarli; Thomas Langer Journal: J Cell Biol Date: 2016-01-18 Impact factor: 10.539
Authors: Daniel M Maloney; Naomi Chadderton; Sophia Millington-Ward; Arpad Palfi; Ciara Shortall; James J O'Byrne; Lorraine Cassidy; David Keegan; Peter Humphries; Paul Kenna; Gwyneth Jane Farrar Journal: Front Neurosci Date: 2020-11-26 Impact factor: 4.677