Epithelial cell polarity defects support cancer progression. It is thus crucial to decipher the functional interactions within the polarity protein network. Here we show that Drosophila Girdin and its human ortholog (GIRDIN) sustain the function of crucial lateral polarity proteins by inhibiting the apical kinase aPKC. Loss of GIRDIN expression is also associated with overgrowth of disorganized cell cysts. Moreover, we observed cell dissemination from GIRDIN knockdown cysts and tumorspheres, thereby showing that GIRDIN supports the cohesion of multicellular epithelial structures. Consistent with these observations, alteration of GIRDIN expression is associated with poor overall survival in subtypes of breast and lung cancers. Overall, we discovered a core mechanism contributing to epithelial cell polarization from flies to humans. Our data also indicate that GIRDIN has the potential to impair the progression of epithelial cancers by preserving cell polarity and restricting cell dissemination.
Epithelial cell polarity defects support cancer progression. It is thus crucial to decipher the functional interactions within the polarity protein network. Here we show that DrosophilaGirdin and its human ortholog (GIRDIN) sustain the function of crucial lateral polarity proteins by inhibiting the apical kinase aPKC. Loss of GIRDIN expression is also associated with overgrowth of disorganized cell cysts. Moreover, we observed cell dissemination from GIRDIN knockdown cysts and tumorspheres, thereby showing that GIRDIN supports the cohesion of multicellular epithelial structures. Consistent with these observations, alteration of GIRDIN expression is associated with poor overall survival in subtypes of breast and lung cancers. Overall, we discovered a core mechanism contributing to epithelial cell polarization from flies to humans. Our data also indicate that GIRDIN has the potential to impair the progression of epithelial cancers by preserving cell polarity and restricting cell dissemination.
The ability of epithelia to form physical barriers is provided by specialized cell-cell junctions, including the zonula adherens (ZA). The latter is a belt-like adherens junction composed primarily of the transmembrane homotypic receptor E-cadherin, which is linked indirectly to circumferential F-actin bundles through adaptor proteins such as β-catenin and α-catenin [1,2]. In Drosophila embryonic epithelia, the protein Girdin stabilizes the ZA by reinforcing the association of the cadherin–catenin complex with the actin cytoskeleton [3]. This function in cell–cell adhesion is preserved in mammals, and supports collective cell migration [4,5]. Fly and humanGirdin also contribute to the coordinated movement of epithelial cells through the organization of supracellular actin cables [3,4].In addition to creating barriers, epithelial tissues generate vectorial transport and spatially oriented secretion. The unidirectional nature of these functions requires the polarization of epithelial cells along the apical-basal axis. In Drosophila, the scaffold protein Bazooka (Baz) is crucial to the early steps of epithelial cell polarization, and for proper assembly of the ZA [6-9]. Baz recruits atypical Protein Kinase C (aPKC) together with its regulator Partitioning defective protein 6 (Par-6) to the apical membrane [10-12]. The small GTPase Cdc42 contributes to the activation of aPKC and p21-activated kinase (Pak1), thereby acting as a key regulator of cell polarity [13-16]. Baz also contributes to apical positioning of the Crumbs (Crb) complex, which is composed mainly of Crb, Stardust (Sdt), and PALS1-associated Tight Junction protein (Patj) [10,17]. Once properly localized, the aPKC–Par-6 and Crb complexes promote the apical exclusion of Baz, which is then restricted to the ZA [12,18,19]. The apical exclusion of Baz is essential to the positioning of the ZA along the apical-basal axis [18], and for full aPKC activation [20-22].The function of aPKC is evolutionarily preserved, and human atypical PKC⍳ (PKCλ in other mammals) and PKCζ contribute to epithelial cell polarization [23]. aPKC maintains the identity of the apical domain through phospho-dependent exclusion of lateral polarity proteins such as Yurt (Yrt) and Lethal (2) giant larvae (Lgl) [15,24-26]. In return, these proteins antagonize the Crb- and aPKC-containing apical machinery to prevent the spread of apical characteristics to the lateral domain [8,14,15,24,27-31]. In combination with the function of Baz, these feedback mechanisms provide a fine-tuning of aPKC activity in addition to specifying its subcellular localization. This is crucial, as both over- and under-activation of aPKC is deleterious to epithelial polarity in fly and mammalian cells, and ectopic activation of aPKC can lead to cell transformation [11,32-35].Cell culture work has established that mammalianGIRDIN interacts physically with PAR3 –the ortholog of Baz–and PKCλ [36-38]. Depletion of GIRDIN in Madin-Darby Canine Kidney (MDCK) epithelial cells delays the formation of tight junctions in Ca2+ switch experiments [38]. GIRDIN is also an effector of AMP-activated protein kinase (AMPK) in the maintenance of tight junction integrity under energetic stress [39]. Moreover, mammalianGIRDIN is required for the formation of epithelial cell cysts with a single lumen, supporting a role for this protein in epithelial morphogenesis as reported in flies [3,36,38,39]. As cyst morphogenesis is linked to epithelial cell polarity [40], these studies suggest that GIRDIN is involved in establishing the apical-basal axis. However, further studies are required to clarify the role of GIRDIN in apical-basal polarity per se, as other cellular processes could explain the phenotype associated with altered GIRDIN expression. For instance, spindle orientation defects impair the formation of epithelial cysts [41]. Of note, PAR3, aPKC, and AMPK are all required for proper spindle positioning in dividing epithelial cells [42-45]. The molecular mechanisms sustaining the putative role of GIRDIN in epithelial cell polarity also need to be better deciphered. Here, we further investigated the role of fly and humanGirdin proteins in the regulation of epithelial cell polarity, and showed that these proteins are part of the lateral polarity protein network. One crucial function of Girdin proteins is to repress aPKC function. We also discovered that loss of Girdin proteins promotes overgrowth of cell cysts, and cell dissemination from these multicellular structures. Consistent with these data, we found that low GIRDIN expression correlates with poor overall survival in subtypes of breast and lung cancers.
Results
Girdin is a crucial component of the genetic network supporting lateral membrane stability in polarized epithelial cells
To explore the role of Girdin in epithelial cell polarity regulation, we investigated its functional relationship with Yrt and Lgl, which are known polarity regulators in Drosophila embryos. These lateral proteins prevent overactivation of the Crb- and aPKC-containing apical machinery, thereby precluding apicalization of the lateral membrane [8,24,27,30,31]. Similar to Girdin, Yrt and Lgl are provided maternally [3,27,46]. Although suboptimal, the maternal contribution is sufficient to maintain apical-basal polarity in zygotic mutant embryos carrying null alleles for Girdin, yrt or lgl [3,27,46] (Figs 1A-I and 2A–2C). Zygotic loss of these genes thus represents a sensitized background. In contrast, a complete loss of Lgl expression in lgl maternal and zygotic (M/Z) mutants is associated with strong polarity defects characterized by ectopic localization of the apical protein Crb to the lateral membrane in post-gastrulating embryos [30]. This phenotype is clearly visible at stage 11 of embryogenesis as shown by the partial co-localization of Crb with the lateral protein Discs large 1 (Dlg1; Fig 1J). At stage 13, the monolayered architecture of the differentiating epidermis is compromised, and polarity defects were attenuated but still apparent (Fig 1K). Toward the end of embryogenesis (stage 16), Lgl-deficient epidermal cells formed polarized cysts of cells with their extended–cuticle secreting–apical membrane facing out (Fig 1L). As a consequence, lgl M/Z mutant embryos assembled a highly convoluted cuticle (Fig 1R), whereas zygotic lgl and Girdin mutant embryos displayed a normal cuticle (Fig 1P and 1Q). Strikingly, a combination of zygotic lgl and Girdin mutations phenocopied a total loss of Lgl (Fig 1M–1O and 1S). Similarly, depletion of Girdin, which is not sufficient to cause obvious polarity defects [3] (Fig 2D–2F), strongly enhanced the zygotic yrt mutant phenotype. Indeed, Girdinyrt double mutant specimens were indistinguishable from yrt M/Z embryos [27] (Fig 2G–2L, 2O and 2P), and presented an expansion of Crb expression territories at stages 13 of embryogenesis (Fig 2H and 2K). These strong genetic interactions suggest that Girdin cooperates with Yrt and Lgl to maintain lateral characteristics in polarized epithelial cells.
Fig 1
Girdin cooperates with Lgl to support epithelial cell polarity.
A-O, Embryos of the indicated genotypes were fixed and co-stained for Crb and Dlg1. M/Z stands for maternal and zygotic mutant. Panels depict a portion of the ventral ectoderm or epidermis at stage (St) 11 (A, D, G, J, M), stage 13 (B, E, H, K, N), or stage 16 (C, F, I, L, O) of embryogenesis. In each case, the apical membrane is facing up. Scale bar in A represents 10 μm, and also applies to B-O. P-S, Panels depict cuticle preparations of whole mounted embryos of the indicated genotypes. The anterior part of the embryo is oriented to the left, and the dorsal side is facing up. Scale bar in P represents 100 μm, and also applies to Q-S. Panels in A-S show representative results taken from experiments that were repeated at least three times [replicate (r) ≥3], and a minimum of 25 embryos of the indicated genotypes were analyzed in each replicate.
Fig 2
Girdin mutation enhances the delocalization of the apical protein Crb in yrt mutants.
A-L, Embryos were immunostained for Crb and Dlg1, and a part of the ventral ectoderm or epidermis was imaged by confocal microscopy (the apical side of the epithelial tissue is facing up). The developmental stage of embryos (St) is indicated in the upper right corner of panels. Scale bar in A represents 10 μm, and also applies to B-L. M-P, Cuticle preparations of whole mounted embryos are shown. Scale bar in M represents 100 μm, and also applies to N-P. Panels in A-P depict representative results taken from experiments that were repeated at least three times (r ≥3), and a minimum of 55 embryos of the indicated genotypes were analyzed in each replicate.
Girdin cooperates with Lgl to support epithelial cell polarity.
A-O, Embryos of the indicated genotypes were fixed and co-stained for Crb and Dlg1. M/Z stands for maternal and zygotic mutant. Panels depict a portion of the ventral ectoderm or epidermis at stage (St) 11 (A, D, G, J, M), stage 13 (B, E, H, K, N), or stage 16 (C, F, I, L, O) of embryogenesis. In each case, the apical membrane is facing up. Scale bar in A represents 10 μm, and also applies to B-O. P-S, Panels depict cuticle preparations of whole mounted embryos of the indicated genotypes. The anterior part of the embryo is oriented to the left, and the dorsal side is facing up. Scale bar in P represents 100 μm, and also applies to Q-S. Panels in A-S show representative results taken from experiments that were repeated at least three times [replicate (r) ≥3], and a minimum of 25 embryos of the indicated genotypes were analyzed in each replicate.
Girdin mutation enhances the delocalization of the apical protein Crb in yrt mutants.
A-L, Embryos were immunostained for Crb and Dlg1, and a part of the ventral ectoderm or epidermis was imaged by confocal microscopy (the apical side of the epithelial tissue is facing up). The developmental stage of embryos (St) is indicated in the upper right corner of panels. Scale bar in A represents 10 μm, and also applies to B-L. M-P, Cuticle preparations of whole mounted embryos are shown. Scale bar in M represents 100 μm, and also applies to N-P. Panels in A-P depict representative results taken from experiments that were repeated at least three times (r ≥3), and a minimum of 55 embryos of the indicated genotypes were analyzed in each replicate.Girdin plays an important role in strengthening DE-cadherin (DE-cad)-dependent cell–cell adhesion in developing embryos [3]. We thus wondered whether alteration of ZA properties could explain the genetic interaction between Girdin and lgl. We investigated this possibility by combining zygotic loss of Lgl expression with mutant alleles of shotgun (shg) and α-Catenin (α-Cat), which encode core ZA components (DE-cad and α-Cat, respectively; [47-49]). The cuticles of lgl shg and lgl α-Cat double mutant embryos were similar to single shg or α-Cat mutants, respectively (S1A–S1D Fig). Moreover, immunostaining of Crb and Dlg1 revealed no major polarity defects in double mutant embryos (S1H–S1J and S1N–S1P Fig), which were similar to single shg or α-Cat mutant specimens (S1E–S1G and S1K–S1M Fig). This led us to conclude that the weakening of the ZA is not sufficient to enhance the lgl mutant phenotype. Although these results do not exclude the possibility that Girdin sustains epithelial cell polarity in part by strengthening cell-cell adhesion, they strongly argue that Girdin has additional roles directly impacting on the protein network supporting the stability of the lateral domain.
Fly Girdin and human GIRDIN repress the function of aPKC to support epithelial cell polarity
Although Yrt and Lgl control Crb activity independently and in separate time windows during fly embryogenesis [27,28,30], they are both inhibited by aPKC-dependent phosphorylation [24,25,50,51]. It is thus plausible that Girdin supports the function of these parallel pathways by acting as a repressor of aPKC activity, which impacts on the function of both Lgl and Yrt. Accordingly, Yrt, which is a substrate of aPKC [24], showed reduced electrophoretic mobility in Girdin null embryos compared to control animals. This was due to enhanced phosphorylation of Yrt, as treatment of samples with the λ Protein Phosphatase abolished the delayed migration profile of Yrt in Girdin null embryos (Fig 3A). The aPKC inhibitor CRT-006-68-54 largely suppressed the hyper-phosphorylation of Yrt in Girdin null embryos (Fig 3B). These results strongly argue that the activity of aPKC increases in the absence of Girdin. To obtain functional evidence that Girdin represses aPKC activity, we performed genetic interactions. Maternal knockdown of aPKC resulted in strong epithelial morphogenesis defects, as revealed by analysis of the cuticle, and a fully penetrant lethality. Indeed, most knocked-down embryos displayed epithelial tissue collapse (referred to as class I embryos, Fig 3C and 3F). Remaining embryos showed a weaker phenotype, and secreted either small patches of cuticle (class II; Fig 3D and 3F), or large continuous sheets of cuticle with differentiated structure such as denticle belts (class III; Fig 3E and 3F). Knockdown of aPKC in zygotic Girdin mutants, which show a normal cuticle phenotype ([3] and Fig 1Q), significantly changed the distribution of embryos in each category. However, reduction of Girdin levels in aPKC knockdown embryos was not sufficient to modify the degree of lethality. Specifically, a decrease in class I embryos concomitant with an increase in class II and III specimens was observed (Fig 3F). This shows that reduction of Girdin levels alleviates the impact of aPKC knockdown, and suggests that Girdin normally limits the function of residual aPKC in knocked-down embryos (S2A Fig). In accordance with this conclusion, overexpression of FLAG-Girdin enhanced the severity of the phenotype associated with the knockdown of aPKC (Fig 3G). FLAG-Girdin displayed a similar distribution to endogenous Girdin [3], and overexpression of this protein in a wild type background had no impact on epithelial tissue morphogenesis (S2C–S2E Fig). Thus, DrosophilaGirdin opposes aPKC function, and supports apical-basal polarity in epithelial cells.
Fig 3
Girdin antagonizes aPKC functions.
A, Stage 11–13 wild type embryos or maternal and zygotic (M/Z) Girdin mutant embryos were homogenized and processed for Western blotting. Where indicated, samples were treated with the λ Protein Phosphatase prior to electrophoresis. Arrow indicates the position of phosphorylated Yrt proteins (PYrt). Immunoblotting of Girdin validates the genotype of embryos, whereas Gapdh1 was used as loading control. B, Girdin null embryos were incubated in a saline solution in the absence or presence of the aPKC inhibitor CRT-006-68-54 for 1h. Embryos were then homogenized and processed for Western blotting. Arrow points to phosphorylated Yrt proteins (PYrt). Immunoblotting of Girdin confirms the genotype of embryos, and β-Tubulin was used as loading control. C-E, Cuticle preparations of aPKC knockdown (kd) embryos. Embryos were separated in three classes (I, II, or III) to account for phenotypic variability. Scale bar in C represents 100 μm, and also applies to D and E. F, Histogram showing the phenotypic distribution in percentage (%; according to the classes defined in C-E) in collections of embryos of the following genotypes: aPKC knockdown in a wild type background (aPKC kd; n = 1312), aPKC knockdown in a Girdin mutant background (aPKC kd Girdin; n = 1573). The specified number of embryos (n) represents the sum of specimens analyzed in three independent experiments. G, Phenotypic distribution of aPKC knockdown embryos expressing GFP (aPKC kd GFP; n = 603) or FLAG-Girdin (aPKC kd FLAG-Girdin; n = 697). For F and G, embryos were analyzed in three blinded experiments, and a Chi-squared test of independence was performed (****: ρ < 0.0001).
Girdin antagonizes aPKC functions.
A, Stage 11–13 wild type embryos or maternal and zygotic (M/Z) Girdin mutant embryos were homogenized and processed for Western blotting. Where indicated, samples were treated with the λ Protein Phosphatase prior to electrophoresis. Arrow indicates the position of phosphorylated Yrt proteins (PYrt). Immunoblotting of Girdin validates the genotype of embryos, whereas Gapdh1 was used as loading control. B, Girdin null embryos were incubated in a saline solution in the absence or presence of the aPKC inhibitor CRT-006-68-54 for 1h. Embryos were then homogenized and processed for Western blotting. Arrow points to phosphorylated Yrt proteins (PYrt). Immunoblotting of Girdin confirms the genotype of embryos, and β-Tubulin was used as loading control. C-E, Cuticle preparations of aPKC knockdown (kd) embryos. Embryos were separated in three classes (I, II, or III) to account for phenotypic variability. Scale bar in C represents 100 μm, and also applies to D and E. F, Histogram showing the phenotypic distribution in percentage (%; according to the classes defined in C-E) in collections of embryos of the following genotypes: aPKC knockdown in a wild type background (aPKC kd; n = 1312), aPKC knockdown in a Girdin mutant background (aPKC kd Girdin; n = 1573). The specified number of embryos (n) represents the sum of specimens analyzed in three independent experiments. G, Phenotypic distribution of aPKC knockdown embryos expressing GFP (aPKC kd GFP; n = 603) or FLAG-Girdin (aPKC kd FLAG-Girdin; n = 697). For F and G, embryos were analyzed in three blinded experiments, and a Chi-squared test of independence was performed (****: ρ < 0.0001).To explore the intriguing possibility that humanGIRDIN also restricts aPKC activity to control polarity, we used the humancolon carcinomaCaco-2 cell line. These cells adopt a monolayered organization in 3D culture, and form hollow cysts with a single lumen. Cells forming the cysts are polarized along the apical-basal axis, with the PAR6- and F-ACTIN-enriched apical domain facing the central lumen (Fig 4A, 4H, 4L and 4N; [41]). PAR6 segregates from the lateral adhesion protein E-CADHERIN (E-CAD; Fig 4H–4L). Consistent with our hypothesis, knockdown of GIRDIN in Caco-2 cells mimicked the phenotype associated with increased PKCζ activity (expression of the constitutively active PKCζ−T410E), and resulted in the formation of solid cysts, or cysts with multiple atrophic lumens (Fig 4A, 4B, 4E, 4F and S2B Fig). GIRDIN knockdown cells forming the disorganized 3D structures were mispolarized, as shown by the peripheral accumulation of PAR6 (Fig 4I and 4M, arrow) and F-ACTIN (Fig 4O). Despite that GIRDIN knockdown cysts displayed a similar size to controls, they contained more cells resulting from lumen filling (Fig 4N–4P). The overgrowth phenotype was exacerbated and resulted in larger cysts when GIRDIN knockdown was combined with overexpression of wild type PKCζ, whereas overexpression of the latter had no impact on cyst size (Fig 4C, 4D and 4G). Again, this is consistent with a stronger PKCζ activation in GIRDIN knocked-down cells compared to cells expressing a scrambled shRNA, as expression of PKCζ−T410E also caused enlargement of cysts (Fig 4E and 4G). To confirm that aPKC activation contributes to the phenotypes associated with depletion of GIRDIN, we used the aPKC inhibitor CRT-006-68-54. Strikingly, inhibition of aPKC activity suppressed the defects caused by knockdown of GIRDIN (Fig 4Q–4U). Expression of the dominant negative aPKC-K281W in GIRDIN knockdown cysts resulted in a similar rescue of lumen formation (S3A–S3G Fig). Together, these results indicate that, similar to fly Girdin, GIRDIN restrains aPKC function to support epithelial morphogenesis and apical-basal polarity.
Fig 4
Human GIRDIN is essential for epithelial morphogenesis and polarity.
A-G, Caco-2 cell cysts after 7 days in culture were observed by DIC microscopy, and the proportion of 3D cellular structures with a single prominent lumen and size were assessed (shScr, n = 27; shGIR, n = 39, r = 3 independent experiments). Arrows in B and D highlight dissociated cells. Scale bar represents 25 μm. F, Histogram displaying the luminal phenotypes observed in A-E. Error bars = sd. G, Histogram displaying mean sizes (cross-sectional area) of cysts. Error bars = sd. H-M, Caco-2 cell cysts after 7 days in culture were immunostained for PAR6 and E-CAD and visualized by confocal microscopy. Arrows show an example of a structure with PAR6 localized basally. Scale bar represents 25 μm. N-O, Caco-2 cell cysts after 7 days in culture were stained with phalloidin (F-ACTIN) and Hoechst (nuclei) and visualized by confocal microscopy. Scale bar represents 25 μm. P, Histogram displaying the number of cells counted in cross-sectional images through the middle of 3D cellular aggregates. Error bars = sd. Q-T, Caco-2 cell cysts after 7 days in culture were visualized by DIC microscopy. Cells were treated with 1.5 μM of the aPKC inhibitor CRT-006-68-54 (inhib) or vehicle control (water) for the duration of the 3D culture period. Scale bar represents 100 μm. U, Histogram displaying the proportion of 3D cellular structures with a single prominent lumen (shScr, n = 278; shGIR, n = 181; shScr+Inhib, n = 321; shGIR+Inhib, n = 196; r = 3 independent experiments). Error bars = sd. Differences were determined using ANOVA with Tukey HSD (F, G, U) or Student’s t-test (P).
Human GIRDIN is essential for epithelial morphogenesis and polarity.
A-G, Caco-2 cell cysts after 7 days in culture were observed by DIC microscopy, and the proportion of 3D cellular structures with a single prominent lumen and size were assessed (shScr, n = 27; shGIR, n = 39, r = 3 independent experiments). Arrows in B and D highlight dissociated cells. Scale bar represents 25 μm. F, Histogram displaying the luminal phenotypes observed in A-E. Error bars = sd. G, Histogram displaying mean sizes (cross-sectional area) of cysts. Error bars = sd. H-M, Caco-2 cell cysts after 7 days in culture were immunostained for PAR6 and E-CAD and visualized by confocal microscopy. Arrows show an example of a structure with PAR6 localized basally. Scale bar represents 25 μm. N-O, Caco-2 cell cysts after 7 days in culture were stained with phalloidin (F-ACTIN) and Hoechst (nuclei) and visualized by confocal microscopy. Scale bar represents 25 μm. P, Histogram displaying the number of cells counted in cross-sectional images through the middle of 3D cellular aggregates. Error bars = sd. Q-T, Caco-2 cell cysts after 7 days in culture were visualized by DIC microscopy. Cells were treated with 1.5 μM of the aPKC inhibitor CRT-006-68-54 (inhib) or vehicle control (water) for the duration of the 3D culture period. Scale bar represents 100 μm. U, Histogram displaying the proportion of 3D cellular structures with a single prominent lumen (shScr, n = 278; shGIR, n = 181; shScr+Inhib, n = 321; shGIR+Inhib, n = 196; r = 3 independent experiments). Error bars = sd. Differences were determined using ANOVA with Tukey HSD (F, G, U) or Student’s t-test (P).
GIRDIN maintains the cohesion of epithelial cysts
In addition to the morphogenesis and polarity defects associated with decreased GIRDIN expression, we observed the presence of isolated cells or small cell aggregates in the proximity of most GIRDIN knocked-down Caco-2 cell cysts (Fig 4B and 4D, arrows). As we previously reported that cell cysts detach from the epidermis and survive outside of it in Girdin mutant Drosophila embryos [3], we hypothesized that some cells separate from GIRDIN knockdown Caco-2 cell cysts. To test this hypothesis, we performed time-lapse microscopy of control (expressing a scrambled shRNA) and GIRDIN knocked-down cysts. Over a period of 26 hours, control cysts showed cell–cell rearrangements, which were resolved to maintain the monolayered organization (Fig 5A and S1 Video). In GIRDIN knockdown cysts, cells were frequently observed extending from the periphery of cysts and detaching (Fig 5B arrow, 5E–5G and S2 Video). In control cysts, the extensions were less frequent, and detachment was not observed (Fig 5A, 5E–5G and S1 Video). Further analysis also revealed that loss of GIRDIN expression is associated with budding from a large group of cells from the cyst (Fig 5C and S3 Video), or the fragmentation of cysts into multiple smaller cell aggregates (Fig 5D, S4 Video). Staining for viability revealed that all cells were alive prior to detachment from cysts, and some cell survived outside of their cyst of origin (Fig 5H–5N). Expression of oncogenic KRAS (KRASG12V), which is an important driver of colon cancer [52], improved the survival of detached cells (Fig 5O–5S). Collectively, our results show that GIRDIN is required to maintain the cohesion of multicellular epithelial structures, and that its loss is associated with cell dispersion in control and cancer-mimetic contexts. This suggests that reduced GIRDIN levels may confer a more aggressive phenotype to cancer cells, and sustain tumor progression.
Fig 5
Human GIRDIN prevents cell dissemination.
A-D, Caco-2 cells were cultured for 7 days, then observed by time-lapse confocal microscopy every 20 min for 26 h. Still frames from videos display representative events observed (shScr, n = 19; shGIR, n = 28; r = 3 independent experiments). Scale bar represents 25 μm. E, Proportion of control (shScr) and GIRDIN-knockdown cysts displaying transient cellular extensions. F, Distribution of the number of transient cellular extensions per cyst. G, Proportion of control (shScr) and GIRDIN-knockdown cysts from which cells disseminated. H-M, GIRDIN knockdown and control (shScr) Caco-2 cells were cultured for 7 days, then stained with calcein AM and ethidium homodimer to visualize live (green) and dead (magenta) cells by confocal microscopy. Scale bars represent 25 μm. N, Histogram displaying the mean number of cells detached from Caco-2 cell aggregates (shScr, n = 27; shGIR, n = 30; r = 2 independent experiments) and the proportion of live and dead detached cells. O-R, GIRDIN knockdown (n = 27, r = 2) and control (shScr, n = 27, r = 2) KRASG12V-expressing Caco-2 cells were stained with calcein AM and ethidium homodimer to visualize live (green) and dead (magenta) cells by confocal microscopy. Scale bars represent 25 μm. S, Histogram displaying the mean number of cells detached from cyst and the proportion of live and dead detached cells. Differences were determined using Chi-squared test (E, G) or ANOVA with Tukey HSD (N, S).
Human GIRDIN prevents cell dissemination.
A-D, Caco-2 cells were cultured for 7 days, then observed by time-lapse confocal microscopy every 20 min for 26 h. Still frames from videos display representative events observed (shScr, n = 19; shGIR, n = 28; r = 3 independent experiments). Scale bar represents 25 μm. E, Proportion of control (shScr) and GIRDIN-knockdown cysts displaying transient cellular extensions. F, Distribution of the number of transient cellular extensions per cyst. G, Proportion of control (shScr) and GIRDIN-knockdown cysts from which cells disseminated. H-M, GIRDIN knockdown and control (shScr) Caco-2 cells were cultured for 7 days, then stained with calcein AM and ethidium homodimer to visualize live (green) and dead (magenta) cells by confocal microscopy. Scale bars represent 25 μm. N, Histogram displaying the mean number of cells detached from Caco-2 cell aggregates (shScr, n = 27; shGIR, n = 30; r = 2 independent experiments) and the proportion of live and dead detached cells. O-R, GIRDIN knockdown (n = 27, r = 2) and control (shScr, n = 27, r = 2) KRASG12V-expressing Caco-2 cells were stained with calcein AM and ethidium homodimer to visualize live (green) and dead (magenta) cells by confocal microscopy. Scale bars represent 25 μm. S, Histogram displaying the mean number of cells detached from cyst and the proportion of live and dead detached cells. Differences were determined using Chi-squared test (E, G) or ANOVA with Tukey HSD (N, S).
Alteration of GIRDIN expression is associated with a poor prognosis in a subset of breast and lung cancers
To further investigate the relevance of our data to humancancer, we examined GIRDIN mRNA expression and patient survival outcomes. We observed that low GIRDIN expression was associated with reduced overall survival in more aggressive breast cancer types (Luminal B, HER2+, and basal Breast Cancer), compared to less aggressive Luminal A subtype (Fig 6A–6D). Low GIRDIN was also associated with poorer survival in lung adenocarcinoma, but not lung squamous cell carcinoma (Fig 6E and 6F). Therefore, GIRDIN expression is linked to survival outcomes, and displays specificity for certain cancer types.
Fig 6
Altered GIRDIN expression correlates with survival in epithelial cancers.
A-F, Kaplan-Meier survival plots for GIRDIN expression in breast cancer subtypes [luminal A (A), Luminal B (B), HER2-enriched (C), and basal (D)], and lung cancer subtypes [adenocarcinoma (E), squamous (F)]. p-values for differences between groups were determined using a Log-Rank test.
Altered GIRDIN expression correlates with survival in epithelial cancers.
A-F, Kaplan-Meier survival plots for GIRDIN expression in breast cancer subtypes [luminal A (A), Luminal B (B), HER2-enriched (C), and basal (D)], and lung cancer subtypes [adenocarcinoma (E), squamous (F)]. p-values for differences between groups were determined using a Log-Rank test.
Discussion
Using classical genetics in flies, we have shown that mutation in Girdin exacerbates the polarity defects in zygotic lgl or yrt mutant embryos and concluded that Girdin is part of the lateral polarity network. We also found that Girdin opposes the function of aPKC, which plays a crucial role in the establishment and maintenance of the apical domain by antagonizing lateral proteins such as Lgl and Yrt [10,23]. We thus propose a model in which Girdin supports the activity of Yrt and Lgl by restricting the activity of aPKC (S4 Fig). Our work demonstrates that the role of Girdin in restricting aPKC activity is evolutionarily conserved. This function confers on humanGIRDIN the ability to maintain apical-basal polarity in Caco-2 cells, and to support epithelial cyst morphogenesis. These results are in line with previous studies suggesting a role for GIRDIN in polarity and cystogenesis in MDCK and MCF10A epithelial cells [36,38]. It was shown that PKCλ enhances GIRDIN expression in MDCK cells [38]. Moreover, knockdown of aPKC or GIRDIN gives a similar phenotype characterized by defects in tight junction integrity and cyst formation [38,53-55]. It was thus proposed that GIRDIN is an effector of PKCλ [38]. Although cell-type-specific mechanisms may exist, our data suggest that this hypothesis needs to be revisited in favor of a model in which the induction of GIRDIN expression by PKCλ in MDCK cells initiates a negative feedback loop instead of cooperation between these proteins. The fact that both overactivation of aPKC or inhibition of its activity is deleterious to epithelial cell polarity and cyst morphogenesis may underlie the conflicting interpretations of the data in the literature [34,55]. GIRDIN is also known to modulate heterotrimeric G protein signaling [56,57]–a role that seems to contribute to the formation of normal cysts by MDCK cells [38]. In addition, it was demonstrated recently that GIRDIN acts as an effector of AMP-activated protein kinase (AMPK) under energetic stress to maintain tight junction function [39]. Of note, these two functions are not shared by fly Girdin [58,59], and were thus acquired by GIRDIN during evolution to fulfill specialized functions. In contrast, our discovery of the Girdin-dependent inhibition of aPKC reveals a core mechanism contributing to epithelial cell polarization from flies to humans.GIRDIN is considered to be an interesting target in cancer due to its role in cell motility, and high levels of GIRDIN have been reported to correlate with a poor prognosis in some humancancers [60,61]. Notwithstanding that GIRDIN may favor tumor cell migration, our study indicates that inhibition of GIRDIN function in the context of cancer would be a double-edged sword for many reasons. Indeed, we showed that knockdown of GIRDIN exacerbates the impact of aPKC overexpression, and leads to overgrowth and lumen filling of Caco-2 cell cysts. Of note, overexpression of aPKC can lead to cell transformation, and was associated with a poor outcome in several epithelial cancers [34,62]. Our study thus establishes that inhibiting GIRDIN in patients showing increased aPKC expression levels could worsen their prognosis. According to our data, abolishing GIRDIN function in tumor cells with decreased levels of the humanLgl protein LLGL1, as reported in many cancers [63], could also support the progression of the disease by altering the polarity phenotype. We observed cell detachment and dissemination from GIRDIN knockdown cysts, thus showing that GIRDIN is required for the cohesion of multicellular epithelial structures. Of note, cells, either individually or as clusters, detaching from cysts are alive and some of them remain viable. This is analogous to what was reported in Girdin mutant Drosophila embryos in which cell cysts detach from the ectoderm and survive outside of it [3]. Other phenotypes in Girdin mutant embryos are consistent with a role for Girdin in epithelial tissue cohesion, including rupture of the ventral midline and fragmentation of the dorsal trunk of the trachea. Mechanistically, Girdin strengthens cell–cell adhesion by promoting the association of core adherens junction components with the actin cytoskeleton [3]. A recent study established that this molecular function is evolutionarily conserved, and that GIRDIN favors the association of β-CATENIN with F-ACTIN [4]. Since knockdown of GIRDIN results in cell dispersion from Caco-2 cell cysts, and since weakening of E-CADHERIN-mediated cell–cell adhesion contributes to cancer cell dissemination and metastasis [64], it is plausible that reduced GIRDIN expression contribute to the formation of secondary tumors and cancer progression. This may explain why we found that low mRNA expression levels of GIRDIN correlates with decreased survival in more aggressive breast cancer subtypes and lung adenocarcinoma. Future studies using xenograft in mice, and investigating the expression of GIRDIN protein in cancerpatients will help validating whether GIRDIN can repress the progression of certain types of epithelial cancers.In conclusion, using a sophisticated experimental scheme combining in vivo approaches in D. melanogaster with 3D culture of human cells, we defined a conserved core mechanism of epithelial cell polarity regulation. Specifically, we showed that Girdin represses the activity of aPKC to support the function of Lgl and Yrt, and ensure stability of the lateral domain. This is of broad interest in cell biology, as proper epithelial cell polarization is crucial for the morphogenesis and physiology of most organs [10]. In addition, the maintenance of a polarized epithelial architecture is crucial to prevent various pathological conditions such as cancer progression [65]. Importantly, we show that normal GIRDIN function potentially impairs the progression of epithelial cancers by preserving cell polarity whilst restricting cell growth and cell dissemination. Thus, our results place a caveat on the idea that GIRDIN could be an interesting target to limit cancer cell migration, and indicate that inhibition of GIRDIN in the context of cancer could be precarious. Potential drugs targeting GIRDIN would thus be usable only in the context of precision medicine where a careful analysis of aPKC, LLGL1, and E-CAD expression, as well as the polarity status of tumor cells would be analyzed prior to treatment. Inhibition of GIRDIN in patients carrying tumors with altered expression of these proteins would likely worsen the prognosis.
Materials and methods
Drosophila genetics
The following mutant alleles and transgenic lines were used in this study: Girdin [3], lgl [66], yrt [27], UAS-GFP.nls (Bloomington Drosophila Stock Center [BDSC] Stock No. 4776), and UAS-FLAG-Girdin [3]. Germ line clone females were produced using the FLP-DFS technique [67], and were used to produce maternal and zygotic (M/Z) mutant embryos. Maternal knockdown of aPKC and lgl was achieved by crossing the driver line matαtub67;15 (obtained from D. St-Johnston, University of Cambridge, Cambridge, UK) to a line containing an inducible shRNA directed against aPKC (BDSC Stock No. 34332) or lgl (BDSC Stock No. 35773) at 25°C.
3D cell culture
Human intestinal epithelial cell line Caco-2 cells were purchased from American Type Culture Collection (ATCC). Caco-2 cells were cultured at 37°C in 5% CO2 in DMEM (Wisent) supplemented with 10% fetal bovine serum (Wisent), 100 U/ml penicillin (Wisent), 0.1 mg/ml streptomycin (Wisent), and 2 mM L-glutamine (Wisent). For 3D culture, cells were seeded onto Geltrex-coated dishes at a density of 1.25 × 104 cells per well and were maintained in 2% Geltrex in complete medium at 37°C under humidified atmosphere of 5% CO2. After 10 days in adherent culture, cells were collected for further experiments. For inhibitor studies 1.5 μM CRT-006-68-54 or water control was added to culture medium at the time of seeding cells in 3D cultures. All cell lines were routinely verified to be mycoplasma free.
Lentivirus production and shRNA
Humanembryonic kidney cell line HEK293LT (ATCC) were cultured at 37°C in 5% CO2 in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin. Lentiviruses were produced by calcium phosphate transfecting HEK293LT cells in 10-cm dishes with 20 μg of lentiviral plasmid, 15 μg of packaging plasmid (psPAX2; Addgene plasmid 12260), and 6 μg of VSVG coat protein plasmid (pMD2.G; Addgene plasmid 12259; both from D. Trono, Ecole Polytechnique Federale de Lausanne, Switzerland). Viral supernatants were collected after 48 h, aliquoted, and frozen at –80°C. shRNAs targeting the humanGIRDIN mRNA were obtained in pLKO.1-puro vectors from the RNAi Consortium (TRC). Caco-2 cells were infected with lentiviral supernatants and selected by the addition of 20 μg/ml puromycin. The target sequences of TRC clone number TRCN0000148551 is CCGGCTTCATTAGTTCTGCGGGAAACTCGAGTTTCCCGCAGAAC TAATGAAGTTTTTTG.
Immunofluorescence on Drosophila embryos
Embryos were dechorionated in 3% sodium hypochlorite for 5 min, rinsed in water, and submitted to a flash heat fixation by sequential addition of 5 ml of E-wash buffer (7% NaCl, 0.5% Triton X-100) at 80°C and 15 ml of E-wash buffer at 4°C. Embryos were then washed with PBS prior to devitellinization by strong agitation in methanol under a heptane phase (1:1), and further incubated in fresh methanol for 1 h. Saturation of non-specific binding sites was achieved by a 1-h incubation in NGT (2% normal goat serum, 0.3% Triton X-100 in PBS), which was also used to dilute primary antibodies. The following primary antibodies were used overnight at 4°C, under agitation: rat anti-Crb [68], 1:250; mouse anti-Dlg1 [clone 4F3, Developmental Studies Hybridoma Bank (DSHB)], 1:25; mouse anti-FLAG (M2, Sigma), 1/250; rabbit anti-Lgl D300 (Santa Cruz Biotechnology) 1:100. Embryos were washed three times for 20 min in PBT (0.3% Triton X-100 in PBS) before and after incubation with secondary antibodies (1:400 in NGT, 1 h at room temperature), which were conjugated to Cy3 (Jackson ImmunoResearch Laboratories) or Alexa Fluor 488 (Molecular Probes). Embryos were mounted in Vectashield mounting medium (Vector Labs), and imaged with a FV1000 confocal microscope coupled to FluoView 3.0 (Olympus), using a 40× Apochromat lens with a numerical aperture of 0.90. Images were uniformly processed with Olympus FV1000 viewer (v.4.2b), ImageJ (National Institutes of Health), or Photoshop (CC 2017; Adobe).
Cuticle preparation
Embryos were dechorionated, mounted in 100 μl of Hoyer's mounting medium (prepared by mixing 50 ml of distilled water, 20 ml of glycerol, 30 g of gum Arabic, and 200 g of chloral hydrate)/lactic acid (1:1) and incubated overnight at 80°C. Embryos were imaged with an Eclipse 600 microscope (Nikon) through a 10× Plan Fluor objective with a numerical aperture of 0.30, and a CoolSNAP fx camera (Photometrics) coupled to MetaVue 7.77 (Molecular Devices). Images were processed with Photoshop (CC 2017; Adobe).
Antibody production
Antibodies against the amino acids 696 to 972 of Yrt in fusion with GST were produced in rabbits (Medimabs).
Phosphatase assays
Dechorionated embryos were homogenized in ice-cold lysis buffer (1% Triton X-100, 50 mM TRIS-HCl pH 7.5, 5% glycerol, 150 mM NaCl, 1 mM PMSF, 0.5 μg/mL aprotinin, 0.7 μg/mL pepstatin, and 0.5 μg/mL leupeptin). Lysates were cleared by centrifugation at 4°C, and 400 units of λ Phosphatase (New England Biolabs) was added to 50 μg of proteins extracted from embryos. The volume of the reaction mix was completed to 30 μl with the MetalloPhosphatase buffer (New England Biolabs) containing 1 mM of MnCl2 prior to a 30-min incubation at 30°C. The reaction was stopped by addition of Laemmli’s buffer.
Western blot
Dechorionated embryos were homogenized in ice-cold lysis buffer (1% Triton X-100, 50 mM TRISHCl pH 7.5, 5% glycerol, 100 mM NaCl, 50 mM NaF, 5 mM EDTA pH 8, 40 mM β-glycerophosphate, 1 mM PMSF, 0.5 μg/mL aprotinin, 0.7 μg/mL pepstatin, 0.5 μg/mL leupeptin and 0.1 mM orthovanadate) and processed for SDS-PAGE and western blotting as previously described (Laprise et al., 2002). Primary antibodies used were: guinea pig anti-Girdin 163 [3], 1:2,000; rabbit anti-Yrt (this study), 1:5000; mouse anti-Gapdh1 (Medimabs), 1:500; rabbit anti-Lgl D300 (Santa Cruz Biotechnology) 1:1,000; rabbit anti-PKCζ C20 (Santa Cruz Biotechnology), 1:2,000; mouse anti-Actin (Novus Biologicals), 1:10,00; mouse anti- β−Tubulin (DM1A, Sigma), 1:10,000; rabbit anti-GIRDIN (ABT80, Millipore), 1:1,000. HRP-conjugated secondary antibodies were used at a 1:2,000 to 1:10,000 dilution.
Chemical treatment of embryos
Dechorionated embryos were incubated with 500 μM of the aPKC inhibitor CRT-006-68-54 (diluted in PBS with 0,9% NaCl) under an octane phase (1:1) for 1h at room temperature.
Immunofluorescence on human 3D cysts
Three-dimensional cysts were transfected with plasmids and fixed with 2% paraformaldehyde/PBS for 10 min and permeabilized in PBS supplemented with 0.5% Triton X-100/10% goat serum for 1 h, and incubated overnight in primary antibodies. The following primary antibodies were used: mouse anti-PAR6 (1:100, Santa Cruz Biotechnology); rabbit anti-E-cadherin (1:100, Cell Signaling Technology). Cysts were washed three times for 15 min in 0.5% Triton X-100/PBS before and after incubation with secondary antibodies. Proteins were visualized with 647 Phalloidin (1:100, Invitrogen), Cy3-Donkey anti-Rabbit (1:750, Jackson IR through Cedarlane), Alexa Fluor 647-Donkey anti-Rabbit (1:200, Jackson IR through Cedarlane). DNA was detected with Hoechst dye 33258 (Sigma Aldrich). Cysts were imaged with ZEISS LSM700 confocal microscope at Plan-Apochromat 20X/0.8 M27 objective lens. Images were uniformly processed with ImageJ (National Institutes of Health).
Cell survival assays
CaAM (calcein AM)/EthD-I (ethidium homodimer I) staining was performed in three-dimensional cysts with 2 mM calcein AM and 4 mM ethidium homodimer I (Live/Dead Viability/Cytotoxicity kit; Life Technologies) for 40 min at 37°C in the dark. DNA was detected with Hoechst dye 33312 (Invitrogen).
Live imaging
Three-dimensional cysts were imaged using ZEISS LSM700 confocal microscope at 20X/0.4 Korr M27 objective lens. Cells were imaged every 20 min for 26 h in a humidified chamber with 5% CO2 and heated to 37°C.
Patient cancer survival
Survival data was retrieved from the kmplot resource (kmplot.com; [69]) for breast, lung, ovarian, and gastric mRNA expression. Jetset optimal probes were selected for analysis. The breast cancer intrinsic subtypes were selected for Luminal A, Luminal B, HER2-positive, and basal cancers. Lung cancer subtypes were selected using the histology selection option for adenocarcinoma and squamous lung cancers. Survival plots with were generated using JMP14 statistical software.
Statistical analysis
Pairwise statistics were performed using Student’s tests. Multiple comparisons were compared using ANOVA, with Tukey HSD tests. Distributions were examined using a chi-square goodness of fit test. Differences in survival were determined using a Log-Rank test. Statistical analyses were performed with JMP14 statistical software, with α = 0.05 for all tests.
Weakening of the zonula adherens is not sufficient to cause polarity defects in lgl mutant embryos.
A-D, Cuticle preparations of whole mounted embryos of the indicated genotypes. Scale bar in A represents 100 μm, and also applies to B-D. E-P, Embryos at embryonic stage (St) 11, 13 or 16 were fixed and processed for immunofluorescence. The distribution of the apical marker Crb and of the lateral protein Dlg1 was then assessed by confocal microscopy in the ventral ectoderm or the ventral epidermis. Scale bar in E represents 10 μm, and also applies to F-P. A-P show representative results of experiments that were performed in triplicate. At least 20 embryos were analyzed in each replicate.(TIF)Click here for additional data file.
Related to Fig 3.
A-B, Western blots showing knockdown efficiency for aPKC (A), and GIRDIN (B). Actin (A) or TUBULIN (B) were used as loading control. C, Embryos expressing FLAG-Girdin were fixed and immunostained with anti-FLAG antibodies. D-E, Crb (green) and Lgl (magenta) distribution in a wild type embryo (D) or a FLAG-Girdin expressing specimen (E). Panels depict whole embryo view (anterior is to the left, and dorsal is up). Scale bar in C = 10 μm, scale bar in D, E = 100 μm.(TIF)Click here for additional data file.
Related to Fig 4.
Kinase-deficient aPKC restores lumen formation in GIRDIN-deficient cells. A-F, Caco-2 cell cysts after 7-days in culture were visualized by DIC microscopy. GIRDIN-deficient (shGIR) or control cells (shScr) expressed GFP (control), wild-type (aPKC-WT), or kinase-deficient (aPKC-K281W) aPKC. Scale bars represent 50 μm. G, Histogram displaying the proportion of 3D cellular structures with a single prominent lumen (shScr/GFP, n = 486; shScr/aPKC-K281W, n = 309; shScr/aPKCWT, n = 341; shGIR/GFP, n = 292; shGIR/aPKC-K281W, n = 229; shGIR/aPKC-WT, n = 227; r = 3 independent experiments). Error bars = sd. Differences were determined using ANOVA with Tukey HSD.(TIF)Click here for additional data file.
Girdin restricts aPKC activity to maintain apical-basal polarity.
Our data indicate that Girdin cooperates with Lgl and Yrt. The latter two proteins act in parallel pathways to antagonize the apical machinery, thereby supporting lateral membrane stability [8,27,28,30]. Although Lgl and Yrt act independently, they have in common that they are both negatively regulated by aPKC [15,24,25]. We provide evidence that Girdin antagonizes aPKC function. We thus propose a model in which Girdin supports the function of Yrt and Lgl by restricting the activity of aPKC.(TIF)Click here for additional data file.
Imaging of a Caco-2 cell cyst.
Live imaging of a wild type Caco-2 cell cyst, which was imaged every 20 min for 26 h.(AVI)Click here for additional data file.
Cells detach from GIRDIN knockdown epithelial cysts.
A GIRDIN knockdown Caco-2 cell cyst was imaged every 20 min for 26 h.(AVI)Click here for additional data file.
Cell clusters are extruded from GIRDIN knockdown cell cysts.
A GIRDIN knockdown Caco-2 cell cyst was imaged every 20 min for 26 h.(AVI)Click here for additional data file.
GIRDIN maintains the cohesion of epithelial structures.
Live imaging of a GIRDIN knockdown Caco-2 cell cyst. The latter was imaged every 20 min for 26 h.(AVI)Click here for additional data file.
Transfer Alert
This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.2 Oct 2019Dear Patrick,Thank you very much for submitting your Research Article entitled 'Girdin is a component of the lateral polarity protein network restricting cell dissemination' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by three independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review again a much-revised version. We cannot, of course, promise publication at that time.Should you decide to revise the manuscript for further consideration here, your revisions should address in some way each of the specific points made by each reviewer. From our analysis of the reviews, there are two major issues that need to be addressed, each involving strengthening one of the major conclusions of the manuscript. Reviewers 1 and 2 point out that the evidence using epistasis for this being a simple linear pathway is weak . Reviewer 2 offers clear suggestions for how to strengthen this point. Second, both Reviewers 2 and 3 feel that the argument that Girdin represses aPKC activity is weak, and both request some more direct evidence that this is the case. Reviewer 2 requests some additional quantification, which should be straightforward. We feel that Reviewer 3's requests for more analysis of the cancer data go beyond the scope of the current manuscript, and should be addressed by adjusting the text of that section. Having addressed these issues, you will need to provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.Accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see our guidelines.Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.Yours sincerely,Mark PeiferGuest EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: Biehler et al.This is an interesting manuscript. The authors identify a genetic requirement for Girdin protein in epithelial cell polarity in Drosophila and mammalian cells. Girdin acts in parallel or upstream of Lgl and Yurt to maintain basolateral identity and repress spreading of the apical determinants in Drosophila. In polarised epithelial cysts in culture, RNAi knockdown of GIRDIN also disrupts normal cyst polarisation, causing collapse of lumens and fragmentation. Finally, they implicate GIRDIN levels in various cancers.Overall, these are some nice phenotypic observations that deserve publication in PLoS Genetics after addressing some points.Minor comments:1. In the results section, the authors state that Girdin is epistatic to Yurt, which acts downstream of Girdin. It is quite hard to establish robust epistasis in polarity, as it normally requires expression of the downstream component to produce a phenotype in the mutant background of the upstream component. Furthermore, epistasis is hard to do properly in the presence of maternal Girdin protein. Nevertheless, I understand what they are trying to say, and would just suggest modification of the text to soften the interpretation. If the authors want to conclude that Girdin is upstream of Lgl and Yurt, they would need to show mis-localisation of Lgl and Yurt in Girdin mutants, and also examine Girdin localisation in Lgl and Yurt mutants.2. What's the effect of expressing Flag-Girdin alone in Fig 4? Presumably no effect, so it should be possible to examine the Flag-Girdin subcellular localisation in these embryos.3. In the introduction, the authors mention many key apical determinants in Drosophila epithelia except for Cdc42. Any reason why this is left out?Reviewer #2: Biehler et al describe genetic interactions between Girdin and cell polarity regulators in both Drosophila embryos and 3D cultures of Caco-2 cells. They also show effects of Girdin depletion on the structure of Caco-2 cell cysts, and describe a correlation between low Girdin expression and poor prognoses for certain cancer types. In Drosophila embryos, for girdin and lgl mutants, or girdin and yurt mutants, certain double mutant phenotypes are shown to be worse than either corresponding single mutant phenotype. In contrast, girdin loss-of-function is shown to suppress the phenotype of aPKC RNAi embryos, and also to reduce phosphorylated species of Yurt. In Caco-2 cell culture, girdin RNAi samples are shown to share defects of aPKC over-expression samples, and the combination of girdin RNAi plus aPKC over-expression mimics the even worse effects of over-expressing constitutive active aPKC (abnormal cyst structure and increased cyst size). The cyst defects of girdin RNAi are also shown to be suppressed with application of an aPKC inhibitor. The girdin RNAi cysts are shown to shed cells whose survival can be enhanced with additional expression of KRASG12V. Finally, the authors derive a correlation between low girdin expression and poor prognoses for certain cancers by analyzing publicly available data. The study is of potential interest to those studying epithelial cell biology and cancers, but substantial issues exist.1. Alternate interpretations are possible for the Drosophila genetic interaction studies. The following conclusions of the authors are in question:1a. “Thus, these genes act in a common genetic pathway in which yrt acts downstream of Girdin”; and “Our results thus suggest that lgl is epistatic to Girdin, and that lgl is downstream of Girdin in this newly defined pathway.”In these cases, lack of enhancement of the yrt null allele m/z phenotype, or the lgl maternal RNAi phenotype, by zygotic null mutants of girdin is taken as evidence for a single pathway, and of girdin being upstream. However, the girdin reduction is not null because of the maternal supplies of the normal gene product. It remains possible that the phenotype could be worsened in a fully null context for both yrt and girdin, or for both lgl and girdin. Also, clear conclusions about upstream-downstream relationships cannot be made from these data (combining gain-of-function and loss-of-function effects could allow clearer conclusions, as could incorporation of protein localization studies with the mutant analyses).Other data from the authors indicate that Girdin does not sit atop a single pathway upstream of Yrt or Lgl. For one, the phenotype of girdin m/z mutants is much milder than that of either lgl m/z mutants or yrt m/z mutants. Also, the relationship between Yurt and Lgl is unclear—the yurt null m/z phenotype is weaker than the lgl knock-down phenotype. How could Girdin be restricted to a single pathway with either Yrt or Lgl if these players have different loss-of-function phenotypes and Girdin genetically interacts with both of them?It seems all the authors can conclude is that Girdin cooperates positively with Yrt and Lgl for epithelial cell polarity and development. Bases for the cooperation remain unclear, and could be through previously reported roles for Girdin (e.g. effects on AJs). The authors say (with data not shown) that they “observed no genetic interaction between genes coding for core components of the ZA and lgl”, but lack of a genetic interaction is not necessarily conclusive, and thus these ZA data should be strengthened with positive controls and shown.1b. “we showed that Girdin represses the activity of aPKC to support the function of Lgl and Yrt”; and “Girdin-dependent inhibition of aPKC reveals a core mechanism contributing to epithelial cell polarization”.The authors’ data indicate that Girdin has effects that are antagonistic to those of aPKC, but the mechanism(s) involved remain unclear. An alternate possibility is that Girdin could antagonize the effects of aPKC by supporting the effects of Lgl and Yrt (upstream-downstream relationships are not yet clear). Also, no evidence is provided for Girdin inhibiting the kinase activity of aPKC (phosphorylated species of Yrt are shown to be increased in girdin mutant embryo samples but it is unclear if aPKC phosphorylation is generating these species).2. The number of experimental replicates, and embryo numbers assessed in each replicate, need to be provided to show the penetrance of effects in the in situ staining studies and cuticle analyses in Figures 1-3.3. For Figure 4E-F, quantifications of the degree of embryo lethality should accompany the quantifications of the cuticle phenotypes of the embryos that have died. Are the genetic interactions also affecting the degree of induced lethality? This applies to Figures 1-3 as well.4. For the Caco-2 cyst experiments, the number of separate experiments conducted should be indicated in all cases.5. The genotype labelled for Fig 5C is not consistent with that in Fig 5F and G ("shScr” is missing in 5C).6. For the experiment with the aPKC inhibitor, specificity should be confirmed with aPKC RNAi.7. N values, and thus the statistical tests, are unclear for Figure 7. More explanation is needed.Reviewer #3: Biehler et al report roles of Girdin in epithelial polarity and cell-cell adhesion, combining in vivo genetic approaches in D. melanogaster with 3D culture of humancancer cells and clinical data set. Girdin is known to regulate several cellular processes such as actin dynamics, cell motility, heterotrimeric G protein activity, postnatal angiogenesis and neurogenesis. In this study, the authors showed that Girdin plays a crucial role in lateral polarity by inhibiting aPKC. Using Drosophila mutants, they conclude that Girdin is an upstream regulator of lateral polarity proteins, Yrt and Lgl. Also, loss of Girdin expression resulted in aPKC-dependent overgrowth of tumor-like structure (disorganized cell cysts) in 3D culture of human intestinal epithelial Caco-2 cells, supporting Girdin’s function in cell polarity. Moreover, lack of Girdin reduced cell-cell cohesion and increased the dissemination of individual cells or cell clusters from Caco-2 cell cysts and Kras-V12-induced tumorspheres, suggesting the possibility that Girdin could restrict cancer progression and metastasis. Finally, authors argue that reduced Girdin levels correlate with a poor outcome in patients with aggressive breast and lung cancers.The study on Girdin’s function in epithelial polarity using Drosophila mutants seems to be logically sound. However, authors’ claim that reduced Girdin’s level correlates with poor outcome in cancerpatients is not supported from the presented data. More experiments are needed to address this point.Major comments1. Authors showed that lack of Girdin expression enhanced the dissemination of individual cells or cell cluster from Caco-2 cells and Kras V12-induced tumorspheres. This finding does not necessarily mean that lack of Girdin promotes cancer metastasis. They argue that this correlates with poor outcome of certain cancerpatients without any experimental evidence. There is a big gap between cell biological finding and clinical data. To address this point, authors should perform further in vitro and in vivo experiments including mouse xenograft models and 3D-invasion assay of cancer cells using matrigel.2. In Fig. 7, analysis of patient survival outcome is based on mRNA levels of Girdin. The correlation between Girdin and patient outcome must be validated by investigating Girdin proteins expression in cancer cells with immunohistochemical analysis.3. How does Girdin regulate aPKC activity? Is there direct association between two molecules? In addition to cell biological analysis shown in Fig. 5, biochemical analysis is needed to confirm direct or indirect regulation of aPKC activity by Girdin.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: NoneReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No14 Feb 2020Dear PatrickWe are pleased to inform you that your manuscript entitled "Girdin is a component of the lateral polarity protein network restricting cell dissemination" has been editorially accepted for publication in PLOS Genetics. Congratulations!Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made.Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Mark PeiferGuest EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Comments from the reviewers (if applicable):Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #2: My past comments have been addressed effectively. This is an important paper that should be of substantial interest.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in thePLOS Geneticsdata availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #2: None**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review?For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: No----------------------------------------------------Data DepositionIf you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-19-01511R1More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.----------------------------------------------------Press QueriesIf you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.13 Mar 2020PGENETICS-D-19-01511R1Girdin is a component of the lateral polarity protein network restricting cell disseminationDear Dr Laprise,We are pleased to inform you that your manuscript entitled "Girdin is a component of the lateral polarity protein network restricting cell dissemination" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!With kind regards,Jason NorrisPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics