Literature DB >> 32193153

MCM3AP-AS1 KD Inhibits Proliferation, Invasion, and Migration of PCa Cells via DNMT1/DNMT3 (A/B) Methylation-Mediated Upregulation of NPY1R.

Xin Li1, Jiancheng Lv2, Shuai Liu3.   

Abstract

Prostate cancer (PCa) is a heterogeneous tumor that commonly occurs among males worldwide. This study explored the potential role that long non-coding RNA MCM3AP antisense RNA 1 (MCM3AP-AS1) plays in PCa progression, and investigated its mechanism. MCM3AP-AS1 and neuropeptide Y receptor Y1 (NPY1R) expression was determined in PCa cells. The regulatory role of MCM3AP-AS1 in PCa cells was defined using scratch test, Transwell assay, 5-ethynyl-2'-deoxyuridine (EdU) assay, and flow cytometry. Methylation-specific PCR (MSP) was used to test the methylation level of NPY1R. Subsequently, the interaction among MCM3AP-AS1, DNA methyltransferase (DNMT)1/DNMT3 (A/B), and NPY1R was investigated using RNA immunoprecipitation, RNA pull-down, and chromatin immunoprecipitation. Finally, we observed xenograft tumor in nude mice. MCM3AP-AS1 was highly, whereas NPY1R was poorly, expressed in PCa. Lentivirus-mediated overexpression of MCM3AP-AS1 promoted proliferation, invasion, and migration while suppressing apoptosis of PCa cells, whereas opposite trends were detected after inhibition of the mitogen-activated protein kinase (MAPK) pathway. MCM3AP-AS1 promoted methylation of NPY1R promoter via recruitment of DNMT1/DNMT3 (A/B), thereby downregulating NPY1R expression to activate the MAPK pathway. Furthermore, overexpressed MCM3AP-AS1 was observed to facilitate PCa development in vivo, which could be reversed by overexpressed NPY1R. Altogether, MCM3AP-AS1 silencing inhibits PCa progression by disrupting methylation of the NPY1R promoter to inactivate the MAPK pathway.
Copyright © 2020 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  DNA methyltransferase; MAPK pathway; apoptosis; invasion; long non-coding RNA MCM3AP-AS1; migration; neuropeptide Y receptor Y1; proliferation; prostate cancer; xenograft in nude mice

Year:  2020        PMID: 32193153      PMCID: PMC7078492          DOI: 10.1016/j.omtn.2020.01.016

Source DB:  PubMed          Journal:  Mol Ther Nucleic Acids        ISSN: 2162-2531            Impact factor:   8.886


Introduction

Prostate cancer (PCa) is considered to be a heterogeneous tumor that ranks as the second most deadly malignancy and the most commonly occurring cancer in males. Statistics show that 1.6 million men are diagnosed with PCa, and 366,000 men die of PCa on an annual basis. This tumor is usually connected to lower urinary tract symptoms. The pathogenesis of PCa involves multiple factors, including genetics and environment. In addition, methylation also participates in both the etiology and pathogenesis of PCa. The research of protein methylation mainly focuses on lysine and arginine residues because they play different roles in essential cellular processes. Histone methylation is known to modulate the expression of gene at the transcriptional level. However, the early detection of PCa is still short of specificity, in spite of improved plasma quantification of prostate-specific antigen (PSA). The major treatment strategies of PCa comprised surgical removal, radiotherapy, as well as hormone therapy. Notably, accumulating reports have revealed that long non-coding RNAs (lncRNAs) can exert crucial functions in PCa tumorigenesis. lncRNAs are identified as transcripts that are longer than 200 nt, and they are found to be associated with tumorigenesis, as well as cancer progression. For example, LINC01138 and SUZ12P1 can stimulate the proliferation and inhibited apoptosis of PCa. Based on our bioinformatics prediction, a novel lncRNA, MCM3AP antisense RNA 1 (MCM3AP-AS1), was found to be differentially expressed in the PCa GSE3868 database. Moreover, the correlation analysis predicted a negative correlation between the expression of MCM3AP-AS1 and neuropeptide Y receptor Y1 (NPY1R). The mitogen-activated protein kinase (MAPK) pathway is a RAS-RAFMEK-extracellular signal-regulated kinase (ERK) signaling cascade that can mediate various physiological activities, such as cell proliferation, differentiation, survival, and death, by transmitting the upstream signals to its downstream effectors. Activation of the MAPK pathway in a PCa cell experiment was reported to be responsible for the progression of PCa. Taking all of the aforementioned findings into consideration, it was hypothesized that MCM3AP-AS1 and NPY1R are possible participants in the development of PCa, with the involvement of the MAPK pathway. Therefore, this study was conducted to explore the effects of MCM3AP-AS1, NPY1R, and the MAPK pathway on PCa.

Results

MCM3AP-AS1 Is Highly Expressed in PCa

By analyzing the data in the PCa profile, Gene Expression Omnibus (GEO): GSE3868, through the “R language,” it was revealed that MCM3AP-AS1 was highly expressed in PCa (Figure 1A). Meanwhile, the expression of MCM3AP-AS1 was retrieved in The Cancer Genome Atlas (TCGA) database using the Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database (Figure 1B). Similarly, MCM3AP-AS1 expression was upregulated in PCa. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was conducted to further detect MCM3AP-AS1 expression in PCa. Relative to the adjacent normal tissues, the expression of MCM3AP-AS1 was increased in PCa tissues (Figure 1C). To elucidate the expression of MCM3AP-AS1 in PCa, we determined MCM3AP-AS1 expression in the PCa cell lines 22RV1, LNCaP, and DU145, and in the immortalized RWPE1 prostate epithelial cell line using qRT-PCR. The results (Figure 1D) showed that MCM3AP-AS1 was highly expressed in all three PCa cell lines in comparison with the immortalized prostate epithelial cells (p < 0.05). The aforementioned results suggested that MCM3AP-AS1 is expressed at a high level in PCa.
Figure 1

MCM3AP-AS1 Shows High Expression in PCa

(A) The expression of MCM3AP-AS1 in the GSE3868 microarray data. (B) The expression of MCM3AP-AS1 in PCa of TCGA. The x label represents sample type, whereas the y label indicates expression value. In box diagrams, the color gray represents normal samples, whereas red indicates tumor samples. (C) The expression of MCM3AP-AS1 in PCa and adjacent normal tissues detected using qRT-PCR. (D) The expression of MCM3AP-AS1 in the PCa cell lines (22RV1, LNCaP, DU145) and the immortalized RWPE1 prostate epithelial cell line as determined by qRT-PCR. N = 10. *p < 0.05 versus the normal control or RWPE1 cell line. These data were measurement data and were expressed as mean ± standard deviation. Unpaired t test was performed to analyze the data between two groups. One-way analysis of variance was used to compare the data among multiple groups, with Tukey’s post hoc test used. The experiment was repeated three times independently. MCM3AP-AS1, MCM3AP antisense RNA 1; PCa, prostate cancer; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

MCM3AP-AS1 Shows High Expression in PCa (A) The expression of MCM3AP-AS1 in the GSE3868 microarray data. (B) The expression of MCM3AP-AS1 in PCa of TCGA. The x label represents sample type, whereas the y label indicates expression value. In box diagrams, the color gray represents normal samples, whereas red indicates tumor samples. (C) The expression of MCM3AP-AS1 in PCa and adjacent normal tissues detected using qRT-PCR. (D) The expression of MCM3AP-AS1 in the PCa cell lines (22RV1, LNCaP, DU145) and the immortalized RWPE1 prostate epithelial cell line as determined by qRT-PCR. N = 10. *p < 0.05 versus the normal control or RWPE1 cell line. These data were measurement data and were expressed as mean ± standard deviation. Unpaired t test was performed to analyze the data between two groups. One-way analysis of variance was used to compare the data among multiple groups, with Tukey’s post hoc test used. The experiment was repeated three times independently. MCM3AP-AS1, MCM3AP antisense RNA 1; PCa, prostate cancer; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

MCM3AP-AS1 Silencing Inhibits PCa Cell Migration, Invasion, and Proliferation while Suppressing PCa Cell Apoptosis

To further explore the role of MCM3AP-AS1 in PCa, we subjected LNCaP cells to treatment with the MCM3AP-AS1 overexpression vector or short hairpin RNA (shRNA) against MCM3AP-AS1, or their relevant negative control (NC), respectively. The results of qRT-PCR revealed that the expression of MCM3AP-AS1 was elevated in cells treated with MCM3AP-AS1 overexpression vector compared with the relevant NC. However, MCM3AP-AS1 expression declined in cells transfected with shRNA against MCM3AP-AS1 (Figure 2A) (p < 0.05). According to the results from the scratch test, Transwell assay, and 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay, lentivirus-mediated overexpression of MCM3AP-AS1 promoted cell migration, invasion, and proliferation, whereas lentivirus-mediated delivery of sh-MCM3AP-AS1 had an inhibitory role in cell migration, invasion, and proliferation (Figures 2B–2D) (p < 0.05). Meanwhile, flow cytometry was employed to detect the potential effect of MCM3AP-AS1 on PCa cell apoptosis and cell-cycle distribution. It was found that lentivirus-mediated overexpression of MCM3AP-AS1 arrested more cells in the S phase while decreasing the cell apoptosis. However, lentivirus-mediated delivery of sh-MCM3AP-AS1 brought up more cells arrested in the G0/G1 phase and promoted the cell apoptosis (Figures 2E and 2F) (p < 0.05). Taken together, these results suggest that suppression of MCM3AP-AS1 can inhibit proliferation, migration, and invasion but accelerate apoptosis of PCa cells.
Figure 2

PCa Cell Migration, Invasion, and Proliferation Are Inhibited by Lentivirus-Mediated Delivery of sh-MCM3AP-AS1, whereas PCa Cell Apoptosis Is Suppressed

(A) The expression of MCM3AP-AS1 in LNCaP cells as detected by qRT-PCR. (B) LNCaP and DU145 cell migration as detected by scratch test (original magnification ×40). (C) LNCaP and DU145 cell invasion as detected by Transwell assay (original magnification ×200). (D) The proliferation of LNCaP and DU145 cells as detected by EdU incorporation assay (original magnification ×200). (E) LNCaP and DU145 cell apoptosis as detected by flow cytometry. (F) Cell-cycle distribution of LNCaP and DU145 cells as detected by flow cytometry. *p < 0.05 versus cells transfected with shRNA target NC; #p < 0.05 versus cells transfected with NC overexpression vector. These data were measurement data and were expressed as mean ± standard deviation. Data between two groups were compared using unpaired t test. The cell experiment was repeated three times independently. EdU, 5-ethynyl-2′-deoxyuridine; oe, overexpression; sh, short hairpin.

PCa Cell Migration, Invasion, and Proliferation Are Inhibited by Lentivirus-Mediated Delivery of sh-MCM3AP-AS1, whereas PCa Cell Apoptosis Is Suppressed (A) The expression of MCM3AP-AS1 in LNCaP cells as detected by qRT-PCR. (B) LNCaP and DU145 cell migration as detected by scratch test (original magnification ×40). (C) LNCaP and DU145 cell invasion as detected by Transwell assay (original magnification ×200). (D) The proliferation of LNCaP and DU145 cells as detected by EdU incorporation assay (original magnification ×200). (E) LNCaP and DU145 cell apoptosis as detected by flow cytometry. (F) Cell-cycle distribution of LNCaP and DU145 cells as detected by flow cytometry. *p < 0.05 versus cells transfected with shRNA target NC; #p < 0.05 versus cells transfected with NC overexpression vector. These data were measurement data and were expressed as mean ± standard deviation. Data between two groups were compared using unpaired t test. The cell experiment was repeated three times independently. EdU, 5-ethynyl-2′-deoxyuridine; oe, overexpression; sh, short hairpin.

NPY1R Is Poorly Expressed in PCa and Is Negatively Correlated with MCM3AP-AS1

Next, the GEO: GSE3868 profile showed a low expression of NPY1R in PCa (Figure 3A), which was further verified through the UALCAN database (Figure 3B). The results of qRT-PCR displayed that the expression of NPY1R was reduced in PCa instead of the normal control (Figure 3C). Furthermore, expression of NPY1R in LNCaP and RWPE1 cells was determined using qRT-PCR and western blot analysis (Figures 3D and 3E). Based on the results, expression of NPY1R in the LNCaP cells was significantly lower than that in the RWPE1 cells (p < 0.05), suggesting that NPY1R was poorly expressed in PCa. In addition, a correlation analysis was performed to investigate the relationship between MCM3AP-AS1 and NPY1R, the results of which showed that the expression of NPY1R was negatively correlated with MCM3AP-AS1 (Figure 3F). In order to verify this relationship, the expression of NPY1R was determined using qRT-PCR and western blot analysis. It was found that the expression of NPY1R decreased with overexpression of MCM3AP-AS1 but increased with the silencing of MCM3AP-AS1 in cells (Figures 3G and 3H). After overexpression of NPY1R in cells, no significant changes in the expression of MCM3AP-AS1 were detected using qRT-PCR (Figure 3I), suggesting that NPY1R was a downstream gene regulated by MCM3AP-AS1. Meanwhile, the expression of MCM3AP-AS1 and NPY1R was determined using qRT-PCR in PCa tissues collected from PCa patients, the results of which were shown in Table 1. The expression of MCM3AP-AS1 and NPY1R was correlated with pathological stage, Gleason score, and androgen receptor (AR) expression. However, it was not significantly related with the preoperative PSA serum levels. The low survival rate was significantly correlated with highly expressed MCM3AP-AS1 or poorly expressed NPY1R in PCa patients (Figure 3J). Collectively, these results suggest the low expression of NPY1R in PCa and its negative correlation with MCM3AP-AS1.
Figure 3

NPY1R Shows Low Expression in PCa and Shares a Negative Correlation with MCM3AP-AS1

(A) Low expression of NPY1R in the GSE3868 profile. (B) Low expression of NPY1R found in the UALCAN database. (C) Low expression of NPY1R confirmed in PCa tissues using qRT-PCR. (A–C) *p < 0.05 versus normal controls. (D and E) The expression of NPY1R in the LNCaP and RWPE1 cells as determined using qRT-PCR and western blot analysis. *p < 0.05 versus RWPE1 cells. (F) The correlation analysis of MCM3AP-AS1 and NPY1R expression in GEO: GSE3868 microarray. (G) qRT-PCR was used to examine the transcription level histogram of NPY1R in each group of cells. (H) Western blot analysis of the NPY1R protein electrophoresis band diagram and histogram of each group of cells. (G and H) *p < 0.05 versus sh-NC; #p < 0.05 versus oe-NC. (I) The transcription level histogram of MCM3AP-AS1 examined by qRT-PCR in each group of cells. (J) Correlation among the expression of MCM3AP-AS1, NPY1R, and PCa patients’ PSA recurrence-free survival rate analyzed using Kaplan-Meier method (PSA recurrence-free survival difference was analyzed using log rank test; n = 46). These data were measurement data, expressed as mean ± standard deviation. Data between two groups were compared using unpaired t test. Data among multiple groups were compared using one-way analysis of variance, with Tukey’s post hoc test used. The cell experiment was repeated three times independently. GAPDH, gyceraldehyde-3-phosphate dehydrogenase; NPY1R, neuropeptide Y receptor Y1.

Table 1

Correlation among Expression of MCM3AP-AS1, NPY1R, and Clinicopathological Features of PCa Patients

Clinicopathological ParametersNo. of CasesMCM3AP-AS1 Expressionp ValueNPY1R Expressionp Value
Age, years0.5420.226
<65232.53 ± 0.810.29 ± 0.06
≥65232.69 ± 0.950.31 ± 0.05
Gleason score0.0060.001
≤7242.28 ± 0.730.32 ± 0.05
>7222.97 ± 0.880.28 ± 0.05
Pathological stage<0.001< 0.001
pT2272.25 ± 0.710.33 ± 0.05
pT3193.12 ± 0.840.27 ± 0.04
Preoperative PSA level0.2790.105
<10352.53 ± 0.920.31 ± 0.05
≥10112.86 ± 0.680.28 ± 0.06
Expression of AR<0.0010.002
Low212.42 ± 0.050.33 ± 0.06
High252.77 ± 0.060.28 ± 0.04

AR, androgen receptor; MCM3AP-AS1, MCM3AP antisense RNA 1; NPY1R, neuropeptide Y receptor Y1; PSA, prostate-specific antigen.

NPY1R Shows Low Expression in PCa and Shares a Negative Correlation with MCM3AP-AS1 (A) Low expression of NPY1R in the GSE3868 profile. (B) Low expression of NPY1R found in the UALCAN database. (C) Low expression of NPY1R confirmed in PCa tissues using qRT-PCR. (A–C) *p < 0.05 versus normal controls. (D and E) The expression of NPY1R in the LNCaP and RWPE1 cells as determined using qRT-PCR and western blot analysis. *p < 0.05 versus RWPE1 cells. (F) The correlation analysis of MCM3AP-AS1 and NPY1R expression in GEO: GSE3868 microarray. (G) qRT-PCR was used to examine the transcription level histogram of NPY1R in each group of cells. (H) Western blot analysis of the NPY1R protein electrophoresis band diagram and histogram of each group of cells. (G and H) *p < 0.05 versus sh-NC; #p < 0.05 versus oe-NC. (I) The transcription level histogram of MCM3AP-AS1 examined by qRT-PCR in each group of cells. (J) Correlation among the expression of MCM3AP-AS1, NPY1R, and PCa patients’ PSA recurrence-free survival rate analyzed using Kaplan-Meier method (PSA recurrence-free survival difference was analyzed using log rank test; n = 46). These data were measurement data, expressed as mean ± standard deviation. Data between two groups were compared using unpaired t test. Data among multiple groups were compared using one-way analysis of variance, with Tukey’s post hoc test used. The cell experiment was repeated three times independently. GAPDH, gyceraldehyde-3-phosphate dehydrogenase; NPY1R, neuropeptide Y receptor Y1. Correlation among Expression of MCM3AP-AS1, NPY1R, and Clinicopathological Features of PCa Patients AR, androgen receptor; MCM3AP-AS1, MCM3AP antisense RNA 1; NPY1R, neuropeptide Y receptor Y1; PSA, prostate-specific antigen.

Lentivirus-Mediated Overexpression of MCM3AP-AS1 Promotes the Development of PCa by Inhibiting NPY1R Expression via Activation of the MAPK Pathway

Next, we attempted to validate the hypothesis that MCM3AP-AS1 plays a role in PCa by inhibiting NPY1R expression via activation of the MAPK pathway. The results from qRT-PCR showed that the treatment with SB203580 (P38 MAPK inhibitor), PD98059 (ERK MAPK inhibitor), and SP600125 (c-Jun amino-terminal kinase [JNK] MAPK inhibitor) did not result in significant change in MCM3AP-AS1 expression (Figure 4A) (p > 0.05). These results suggested that the MAPK pathway inhibitors did not affect the transcription of MCM3AP-AS1. As shown in Figures 4B and 4C, lentivirus-mediated overexpression of MCM3AP-AS1 inhibits NPY1R expression. When the above three MAPK pathway inhibitors were added to MCM3AP-AS1-overexpressed cells, the NPY1R expression remained unchanged, which also demonstrated that MAPK pathway inhibitors did not affect NPY1R expression.
Figure 4

Lentivirus-Mediated Overexpression of MCM3AP-AS1 Promotes PCa Progression by Downregulating NPY1R Expression to Activate the MAPK Pathway

(A) The expression of MCM3AP-AS1 in cells with different treatments as detected by qRT-PCR. (B) The expression of NPY1R in cells with different treatments as detected by qRT-PCR. (C) The protein bands of NPY1R expression in the PCa cells and RWPE1 cells as determined by western blot analysis. (D) The protein expression of p38, ERK, JNK, p-p38, p-ERK, and p-JNK and the ratios of p-p38/p38, p-ERK/ERK, and p-JNK/JNK as determined by western blot analysis. (E) Cell migration in response to different treatment as detected by scratch test (original magnification ×40). (F) Cell invasion in response to different treatment as detected by Transwell assay (original magnification ×200). (G) Cell proliferation in response to different treatment as detected by EdU incorporation assay (original magnification ×200). (H) Cell apoptosis in response to different treatment as detected by flow cytometry. (I) Cell-cycle distribution as detected by flow cytometry. *p < 0.05 versus oe-NC; #p < 0.05 versus oe-MCM3AP-AS1 + DMSO. These data were measurement data, expressed as mean ± standard deviation. Data among multiple groups were compared using one-way analysis of variance, with Tukey’s post hoc test used. The cell experiment was repeated three times independently. DMSO, dimethylsulfoxide; ERK, extracellular signal-regulated kinase; JNK, c-Jun amino-terminal kinase; p-, phosphorylated.

Lentivirus-Mediated Overexpression of MCM3AP-AS1 Promotes PCa Progression by Downregulating NPY1R Expression to Activate the MAPK Pathway (A) The expression of MCM3AP-AS1 in cells with different treatments as detected by qRT-PCR. (B) The expression of NPY1R in cells with different treatments as detected by qRT-PCR. (C) The protein bands of NPY1R expression in the PCa cells and RWPE1 cells as determined by western blot analysis. (D) The protein expression of p38, ERK, JNK, p-p38, p-ERK, and p-JNK and the ratios of p-p38/p38, p-ERK/ERK, and p-JNK/JNK as determined by western blot analysis. (E) Cell migration in response to different treatment as detected by scratch test (original magnification ×40). (F) Cell invasion in response to different treatment as detected by Transwell assay (original magnification ×200). (G) Cell proliferation in response to different treatment as detected by EdU incorporation assay (original magnification ×200). (H) Cell apoptosis in response to different treatment as detected by flow cytometry. (I) Cell-cycle distribution as detected by flow cytometry. *p < 0.05 versus oe-NC; #p < 0.05 versus oe-MCM3AP-AS1 + DMSO. These data were measurement data, expressed as mean ± standard deviation. Data among multiple groups were compared using one-way analysis of variance, with Tukey’s post hoc test used. The cell experiment was repeated three times independently. DMSO, dimethylsulfoxide; ERK, extracellular signal-regulated kinase; JNK, c-Jun amino-terminal kinase; p-, phosphorylated. We further validated whether NPY1R inhibited the activation of the MAPK signaling pathway by using western blot analysis to determine protein expression of the MAPK pathway-related genes (p38, ERK, and JNK) and the extent of their phosphorylation in cells (Figure 4D). From the results, it was obvious that the protein expression of p38, ERK, and JNK was not significantly changed by lentivirus-mediated overexpression of MCM3AP-AS1 (p > 0.05). However, lentivirus-mediated overexpression of MCM3AP-AS1 contributed to significant increases in the ratio of phosphorylated (p-) p38/p38, p-ERK/ERK, and p-JNK/JNK, as well as the protein extent of phosphorylation of p38, ERK, and JNK (p < 0.05), suggesting elevated phosphorylation levels. Moreover, compared with a combination of lentivirus-mediated overexpression of MCM3AP-AS1 and dimethyl sulfoxide (DMSO), lentivirus-mediated overexpression of MCM3AP-AS1 plus SB203580 led to no marked change in the p-p38/p38 ratio (p > 0.05), along with significantly elevated p-ERK/ERK and p-JNK/JNK ratios (p < 0.05). Lentivirus-mediated overexpression of MCM3AP-AS1 plus PD98059 contributed to increased p-p38/p38 and p-JNK/JNK ratios (p < 0.05), whereas the p-ERK/ERK ratio remained unchanged (p > 0.05). Besides, the p-p38/p38 and p-ERK/ERK ratios were significantly increased by lentivirus-mediated overexpression of MCM3AP-AS1 plus SP600125 (p < 0.05), with the p-JNK/JNK ratio remaining unchanged (p > 0.05). Overall, the aforementioned results suggested that overexpression of MCM3AP-AS1 could promote phosphorylation of the MAPK pathway-related proteins. In addition, scratch test (Figure 4E), Transwell assay (Figure 4F), and EdU incorporation assay (Figure 4G) were conducted so as to explore the role of MCM3AP-AS1 in PCa cell migration, invasion, and proliferation. Based on the obtained results, the lentivirus-mediated overexpression of MCM3AP-AS1 enhanced the cell migration, invasion, and proliferation (p < 0.05), whereas the addition of SB203580, PD98059, or SP600125 resulted in obvious declines in these cellular activities compared with the addition of DMSO (p < 0.05). These results demonstrated that overexpression of MCM3AP-AS1 could promote PCa cell migration, invasion, and proliferation, which could be suppressed by inhibition of the MAPK pathway. Furthermore, flow cytometry was conducted to detect the possible effects of MCM3AP-AS1 on PCa cell apoptosis (Figure 4H) and cell-cycle distribution (Figure 4I). The results displayed that lentivirus-mediated overexpression of MCM3AP-AS1 arrested more cells in the S phase but less cells in the G0/G1 phase, and caused a decrease in the cell apoptosis (p < 0.05). However, after the addition of either SB203580, PD98059, or SP600125, there were less cells arrested in the S phase but more cells in the G0/G1 phase, along with increased cell apoptosis (p < 0.05). Collectively, it was demonstrated that overexpression of MCM3AP-AS1 could suppress PCa cell apoptosis, whereas inhibition of the MAPK pathway could promote this process.

DNA Methylation Involves the Regulation of NPY1R

In order to study the regulatory mechanism between MCM3AP-AS1 and NPY1R in PCa cells, we used the lncATLAS website (http://lncatlas.crg.eu/) to predict the subcellular localization of MCM3AP-AS1, the results of which revealed that MCM3AP-AS1 was mainly localized in the nucleus (Figure 5A). This localization was then further confirmed by fluorescence in situ hybridization (FISH) (Figure 5B), which suggested the potential functionality of MCM3AP-AS1 in transcriptional regulation. Meanwhile, a BLAST online comparison revealed that MCM3AP-AS1 might bind to the NPY1R promoter in the form of RNA-DNA (Figure 5C). Moreover, CPG islands were detected (Figure 5D) in the promoter region of NPY1R using the MethPrimer website (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi), suggesting that DNA methylation may exist in NPY1R.
Figure 5

MCM3AP-AS1 Results in Hypomethylation of CpG Islands to Downregulate the Expression of NPY1R

(A) Analysis of MCM3AP-AS1 localization in PCa cells through the lncATLAS website (http://lncatlas.crg.eu/). (B) Subcellular localization of MCM3AP-AS1 in PCa cells as detected by FISH. (C) The results of BLAST online comparison between the MCM3AP-AS1 sequence and the NPY1R sequence. (D) CpG Island enrichment analysis of NPY1R promoter region on the MethPrimer website. (E) NPY1R expression determined by qRT-PCR. (F and G) Protein bands of NPY1R determined using (F) western blot analysis and the (G) corresponding statistical plot. (H) Methylation level of NPY1R promoter determined by MSP. *p < 0.05 versus oe-MCM3AP-AS1 + DMSO. These data were measurement data, expressed as mean ± standard deviation. Data between two groups were compared using unpaired t test. The experiment was repeated three times independently. The cell experiment was repeated three times. DAPI, 4′,6-diamidino-2-phenylindole; FISH, fluorescence in situ hybridization RNA; M, methylation; MSP, methylation-specific PCR; U, unmethylation.

MCM3AP-AS1 Results in Hypomethylation of CpG Islands to Downregulate the Expression of NPY1R (A) Analysis of MCM3AP-AS1 localization in PCa cells through the lncATLAS website (http://lncatlas.crg.eu/). (B) Subcellular localization of MCM3AP-AS1 in PCa cells as detected by FISH. (C) The results of BLAST online comparison between the MCM3AP-AS1 sequence and the NPY1R sequence. (D) CpG Island enrichment analysis of NPY1R promoter region on the MethPrimer website. (E) NPY1R expression determined by qRT-PCR. (F and G) Protein bands of NPY1R determined using (F) western blot analysis and the (G) corresponding statistical plot. (H) Methylation level of NPY1R promoter determined by MSP. *p < 0.05 versus oe-MCM3AP-AS1 + DMSO. These data were measurement data, expressed as mean ± standard deviation. Data between two groups were compared using unpaired t test. The experiment was repeated three times independently. The cell experiment was repeated three times. DAPI, 4′,6-diamidino-2-phenylindole; FISH, fluorescence in situ hybridization RNA; M, methylation; MSP, methylation-specific PCR; U, unmethylation. To further verify whether DNA methylation is involved in the regulation of NPY1R, we added 5-aza-dc, a DNA methyltransferase (DNMT) inhibitor, to LNCaP cells. Next, western blot analysis was used to determine the expression of NPY1R after treatment of DMSO or 5-aza-dC (Figures 5E–5G). Based on the results, LNCaP cells treated with 5-aza-dC displayed significantly higher expression of NPY1R than those treated with DMSO, which suggested that DNA methylation was involved in the regulation of NPY1R. Subsequently, we detected the methylation level of NPY1 in PCa cells using methylation-specific PCR (MSP). The results displayed that, compared with that in the human immortalized RWPE1 prostate epithelial cells, the CpG island of the NPY1R gene promoter region in the LNCaP cells was completely methylated. However, after treatment with 5-aza-dc, the methylation level was downregulated, with only partial methylation detected. Therefore, we speculated that MCM3AP-AS1 might inhibit the expression of NPY1R by recruiting DNMTs to the promoter region of NPY1R.

MCM3AP-AS1 Promotes Methylation of the NPY1R Promoter to Downregulate NPY1R Expression by Recruiting DNMT1, DNMT3A, and DNMT3B to the NPY1R Promoter Region

In order to study the binding relationship between the three DNMTs (DNMT1, DNMT3A, and DNMT3B) and MCM3AP-AS1, we conducted an RNA immunoprecipitation (RIP) experiment (Figure 6A). The obtained results showed that after overexpression of MCM3AP-AS1, the enrichment of MCM3AP-AS1 on DNMT1, DNMT3A, and DNMT3B displayed a notable increase, which was significantly reduced on silencing of MCM3AP-AS1 (p < 0.05). In order to study the ability of MCM3AP-AS1 to enrich DNMT1, DNMT3A, and DNMT3B, we conducted the RNA pull-down experiment (Figure 6B). Based on the results, the ability of MCM3AP-AS1 to enrich DNMT1, DNMT3A, and DNMT3B was significantly increased by overexpression of MCM3AP-AS1, whereas it was decreased after silencing of MCM3AP-AS1 (p < 0.05); these results were consistent with those obtained from the RIP experiment.
Figure 6

MCM3AP-AS1 Recruits DNMT1, DNMT3A, and DNMT3B to the NPY1R Promoter Region, Thereby Promoting Methylation of the NPY1R Promoter to Downregulate NPY1R Expression

(A) DNMT1/DNM3T (A/B) binding to MCM3AP-AS1 as detected by RIP; the enrichment of MCM3AP-AS1 on DNMT1, DNMT3A, and DNMT3B as detected by qRT-PCR. (B) The ability of MCM3AP-AS1 to enrich DNMT1, DNMT3A, and DNMT3B as detected by RNA pull-down; the protein expression of DNMT1, DNMT3A, and DNMT3B as detected by western blot analysis. (C) Binding relation between MCM3AP-AS1 and DNMTs was predicted using the bioinformatics website (http://pridb.gdcb.iastate.edu/RPISeq). A RF value > 0.5 and SVM value > 0.5 indicate binding relation. (D) The enrichment of DNMT1, DNMT3A, and DNMT3B in the NPY1R promoter as detected by ChIP; NPY1R promoter fragments as detected by qPCR. *p < 0.05 versus sh-NC; #p < 0.05 versus oe-NC. These data were measurement data and expressed as mean ± standard deviation. Data among multiple groups were compared by one-way analysis of variance, with Tukey’s post hoc test used. The experiment was repeated three times independently. ChIP, chromatin immunoprecipitation; DNMT1, DNA methyltransferase 1; DNMT3A, DNA methyltransferase 3A; DNMT3B, DNA methyltransferase 3B; RF, radiofrequency; RIP, immunoprecipitation; SVM, support vector machine.

MCM3AP-AS1 Recruits DNMT1, DNMT3A, and DNMT3B to the NPY1R Promoter Region, Thereby Promoting Methylation of the NPY1R Promoter to Downregulate NPY1R Expression (A) DNMT1/DNM3T (A/B) binding to MCM3AP-AS1 as detected by RIP; the enrichment of MCM3AP-AS1 on DNMT1, DNMT3A, and DNMT3B as detected by qRT-PCR. (B) The ability of MCM3AP-AS1 to enrich DNMT1, DNMT3A, and DNMT3B as detected by RNA pull-down; the protein expression of DNMT1, DNMT3A, and DNMT3B as detected by western blot analysis. (C) Binding relation between MCM3AP-AS1 and DNMTs was predicted using the bioinformatics website (http://pridb.gdcb.iastate.edu/RPISeq). A RF value > 0.5 and SVM value > 0.5 indicate binding relation. (D) The enrichment of DNMT1, DNMT3A, and DNMT3B in the NPY1R promoter as detected by ChIP; NPY1R promoter fragments as detected by qPCR. *p < 0.05 versus sh-NC; #p < 0.05 versus oe-NC. These data were measurement data and expressed as mean ± standard deviation. Data among multiple groups were compared by one-way analysis of variance, with Tukey’s post hoc test used. The experiment was repeated three times independently. ChIP, chromatin immunoprecipitation; DNMT1, DNA methyltransferase 1; DNMT3A, DNA methyltransferase 3A; DNMT3B, DNA methyltransferase 3B; RF, radiofrequency; RIP, immunoprecipitation; SVM, support vector machine. The binding relations of MCM3AP-AS1 to DNMTs and the MCM3AP-AS1 sequence to the protein sequences of DNMT1, DNMT3A, and DNMT3B were predicted using the bioinformatics website (http://pridb.gdcb.iastate.edu/RPISeq). The results suggested that MCM3AP-AS1 was able to bind to DNMTs (Figure 6C). Moreover, chromatin immunoprecipitation (ChIP) was performed in an attempt to study the enrichment of DNMT1, DNMT3A, and DNMT3B in the NPY1R promoter region (Figure 6D). According to the results, overexpression of MCM3AP-AS1 contributed to significant increases in the enrichment of DNMT1, DNMT3A, and DNMT3B in the NPY1R promoter region, whereas silencing of MCM3AP-AS1 led to notable declines with regard to the enrichment of DNMT1, DNMT3a, and DNMT3b in the NPY1R promoter region (p < 0.05). Conjointly, these results demonstrated that MCM3AP-AS1 could inhibit the expression of NPY1R by recruiting DNMTs to the NPY1R promoter region.

Overexpression of NPY1R Reverses the Promoting Effect of MCM3AP-AS1 on PCa Progression

To further investigate the effect of MCM3AP-AS1 and NPY1R expression on tumor growth of PCa in vivo, we analyzed the growth curve and body weight of nude mice on the 7th, 14th, 21st, 28th, and 35th day after different inoculations. Based on the results, overexpression of MCM3AP-AS1 led to a significantly faster growth rate, and increased volume and weight of transplanted tumors (Figures 7A–7C) (all p <0.05). In addition, overexpression of MCM3AP-AS1 resulted in a decrease in NPY1R expression (Figures 7D and 7E), and increases in phosphorylation of p38, ERK, and JNK in the MAPK pathway, along with the elevated ratios of p-p38/p38, p-ERK/ERK, and p-JNK/JNK (Figure 7F) (all p <0.05). By contrast, overexpression of NPY1R resulted in a markedly lowered growth rate and decreased volume and weight of transplanted tumors (Figures 7A–7C) (all p <0.05); increased NPY1R expression (Figures 7D and 7E) and decreased phosphorylation of p38, ERK, and JNK in the MAPK pathway; and reduced ratio of p-p38/p38, p-ERK/ERK, and p-JNK/JNK (Figure 7F) (all p <0.05). These results demonstrated that overexpression of NPY1R can inhibit activation of the MAPK pathway, thereby suppressing the stimulating role of MCM3AP-AS1 in PCa progression.
Figure 7

The Promoting Effect of MCM3AP-AS1 on PCa Progression Is Reversed by Overexpression of NPY1R

(A) The volume of transplanted tumors in nude mice of each group after 35 days. (B) The weight of transplanted tumors in nude mice of each group. (C) The growth curve of transplanted tumors in nude mice (repeated-measures analysis of variance was applied for the analysis). (D) The effect of MCM3AP-AS1 on the expression of NPY1R in vivo as detected by qRT-PCR. (E) The effect of MCM3AP-AS1 on the protein expression of NPY1R in vivo as detected by western blot analysis. (F) The effect of NPY1R on the protein expression of p38, ERK, JNK, p-p38, p-ERK, and p-JNK and the ratios of p-p38/p38, p-ERK/ERK, p-JNK/JNK in vivo as determined by western blot analysis. *p < 0.05 versus M-oe-NC; #p < 0.05 versus M-oe-MCM3AP-AS1 + oe-NC. These data were measurement data, expressed as mean ± standard deviation. Data among multiple groups were compared using one-way analysis of variance, with Tukey’s post hoc test used. The experiment was repeated three times independently.

The Promoting Effect of MCM3AP-AS1 on PCa Progression Is Reversed by Overexpression of NPY1R (A) The volume of transplanted tumors in nude mice of each group after 35 days. (B) The weight of transplanted tumors in nude mice of each group. (C) The growth curve of transplanted tumors in nude mice (repeated-measures analysis of variance was applied for the analysis). (D) The effect of MCM3AP-AS1 on the expression of NPY1R in vivo as detected by qRT-PCR. (E) The effect of MCM3AP-AS1 on the protein expression of NPY1R in vivo as detected by western blot analysis. (F) The effect of NPY1R on the protein expression of p38, ERK, JNK, p-p38, p-ERK, and p-JNK and the ratios of p-p38/p38, p-ERK/ERK, p-JNK/JNK in vivo as determined by western blot analysis. *p < 0.05 versus M-oe-NC; #p < 0.05 versus M-oe-MCM3AP-AS1 + oe-NC. These data were measurement data, expressed as mean ± standard deviation. Data among multiple groups were compared using one-way analysis of variance, with Tukey’s post hoc test used. The experiment was repeated three times independently.

Discussion

PCa, the second most commonly diagnosed tumor among males across the world, is difficult to treat completely upon its progression to the metastatic stage. It is reported that lncRNAs are important regulators in PCa. In the present study, the roles of MCM3AP-AS1 and methylation of NPY1R in PCa were explored. The results demonstrated that knockdown of MCM3AP-AS1 could potentially inhibit the progression of PCa, in association with the disruption of NPY1R promoter methylation and the inactivation of the MAPK pathway. Initially, the current study elucidated that MCM3AP-AS1 was highly expressed, whereas NPY1R was poorly expressed in the PCa GEO: GSE3868 dataset and the PCa cell lines 22RV1, LNCaP, and DU145. Similarly, a previous cell experiment demonstrated an upregulation in MCM3AP-AS1 expression in glioma-associated endothelial cells in comparison with the immortalized human brain endothelial cells. Besides, upregulation of MCM3AP-AS1 was found in both papillary thyroid cancer tissues and cells. Consistent with our results, poorly expressed NPY1R was detected in human PCa specimens in comparison with healthy glands of the peripheral zone based on the gene expression microarray analysis. In addition, NPY1R was identified as a downregulated gene in breast cancer in both clinical data from TCGA dataset and cellular data. In the present study, the correlation analysis demonstrated a negative correlation between MCM3AP-AS1 and NPY1R expression, which was also confirmed by qRT-PCR and western blot analysis in PCa LNCaP cells. Moreover, western blot analysis revealed that NPY1R inhibited activation of the MAPK signaling pathway, which was reflected by the decreased protein expression of the MAPK pathway-related genes (p38, ERK, and JNK). In fact, NPY was reported to inhibit the p38 MAPK pathway in the N9 murine microglial cell line and to suppress the phosphorylation of the ERK1/2 protein in 3T3-L1 preadipocytes., Therefore, it was demonstrated that MCM3AP-AS1 inhibits NPY1R expression to activate the MAPK pathway, thereby affecting the cellular activities of PCa cells. Another important discovery of this study was that lentivirus-mediated overexpression of MCM3AP-AS1 promoted proliferation, invasion, and migration while suppressing apoptosis of PCa cells, whereas inhibition of the MAPK pathway could counteract these effects. Moreover, the in vivo assay in nude mice showed that overexpressed MCM3AP-AS1 could promote PCa progression, whereas this effect could be reversed by overexpression of NPY1R. In line with our finding, downregulated MCM3AP-AS1 could contribute to suppression in the cell viability, migration, and tube formation of glioma-associated endothelial cells through inhibiting PI3K/AKT and ERK1/2 signaling pathways. In addition, knockdown of MCM3AP-AS1 was detected to suppress hepatocellular carcinoma cell proliferation, colony formation, and cell-cycle progression while promoting apoptosis in vitro, and MCM3AP-AS1 plays a tumor-promoting role in hepatocellular carcinoma through targeting miR-194-5p and then increases FOXA1 expression. Besides, the activated MAPK pathway, in concert with the NF-κB signaling pathway, can promote the invasion and metastasis in PCa cells, which can also support our finding. Furthermore, overexpression of NPY1R could inhibit hepatocellular carcinoma cell proliferation via the inactivation of the MAPK pathway, whereas downregulation of it could increase tumorigenicity and tumor growth in vivo. In addition, DNA methylation of NPY1R was found in the CpG islands of the NPY1R promoter, which was demonstrated by the elevated expression of NPY1R after treatment of the demethylation agent. Similarly, the NPY1R promoter was methylated in samples obtained from patients with head and neck squamous cell carcinoma, as well as in the gastrin or gastric acid of patients with gastric carcinogenesis., Furthermore, our results demonstrated that MCM3AP-AS1 could affect the methylation of NPY1R. In fact, lncRNAs are able to mediate the transcription, as well as CpG DNA methylation. DNA methylation is extensively studied to regulate gene expression via various mechanisms. DNMTs conclude a group of nuclear enzymes capable of catalyzing the methylation of CpG dinucleotides, which can lead to an epigenetic methylome distinguished between normal cells and cancer cells. Similarly, as previously reported, lncRNA PVT1 could induce the methylation of CpG Island in the miR-146a promoter in three PCa cell lines (LNCaP, PC-3, and DU145), thereby promoting the development of the PCa tumorigenesis. In this study, it was verified that MCM3AP-AS1 could mediate methylation of NPY1R promoter by means of recruiting DNMT1, DNMT3A, and DNMT3B, thereby inhibiting the expression of NPY1Y to inactivate the MAPK pathway. DNMTs have been proved to inhibit prostate cell migration ability by hypomethylating agent 5-azacytidine. Besides, a prior work addresses that DNMT1 and DNMT3 play roles in DNA methylation. In conclusion, we demonstrated that MCM3AP-AS1 promotes NPY1R methylation by recruiting DNMT1/DNMT3 (A/B) to the NPY1R promoter, thus downregulating NPY1R expression to activate the MAPK pathway, which promotes PCa progression (Figure 8). Our findings support that knockdown of MCM3AP-AS1 might serve as a novel target for the development of new treatment strategies for PCa. However, further research is warranted to explore the specific mechanism regarding the effect of NPY1R on the MAPK pathway.
Figure 8

Molecular Mechanism of MCM3AP-AS1 Involvement in PCa Development

MCM3AP-AS1 recruits DNMT1/DNMT3 (A/B) to the NPY1R promoter, which promotes NPY1R methylation to downregulate NPY1R expression and further activates the MAPK pathway, thereby promoting PCa progression.

Molecular Mechanism of MCM3AP-AS1 Involvement in PCa Development MCM3AP-AS1 recruits DNMT1/DNMT3 (A/B) to the NPY1R promoter, which promotes NPY1R methylation to downregulate NPY1R expression and further activates the MAPK pathway, thereby promoting PCa progression.

Materials and Methods

Ethics Statement

All protocols of the current study were performed with approval of the ethics committee of Shandong Provincial Hospital Affiliated to Shandong University. All animal experiments were conducted in strict accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All efforts were made to minimize the number and suffering of the included animals.

Human Subjects

A total of 46 PCa samples were collected from the radical prostatectomy conducted in Shandong Provincial Hospital Affiliated to Shandong University during January 2008 to January 2010. The patients (aged 55–76 years with a mean age of 65.07 ± 7.02 years) were pathologically diagnosed as PCa. The adjacent normal prostate tissues were set as control. All tissues were examined pathologically. The biochemical/clinical and pathological parameters included age, preoperative PSA serum level, Gleason score, pathological stage, and PSA recurrence. In addition, the expression of AR was divided into high expression and low expression based on its average value. PSA recurrence was defined as an increased serum PSA level >0.2 ng/mL over two subsequent measurements after surgery.

Bioinformatics Analysis

The PCa-related microarray GEO: GSE3868 and the annotated probe files were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). Analysis on differentially expressed genes (DEGs) was conducted by using Limma package of R language (http://master.bioconductor.org/packages/release/bioc/html/limma.html) with the threshold as |log FoldChange| > 1 and p < 0.05. The box diagram of DEGs was established. The expression of MCM3AP-AS1 and NPY1R was retrieved in PCa of TCGA database using GEPIA2 (http://gepia2.cancer-pku.cn/#index) and UALCAN (http://ualcan.path.uab.edu/cgi-bin/ualcan-res.pl) databases.

Cell Treatment

A human immortalized RWPE1 prostate epithelial cell line and three human PCa cell lines (22RV1, LNCaP, and DU145) (ATCC, Manassas, VA, USA) were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% fetal bovine serum (FBS) and then treated with penicillin-streptomycin solution mixed at a dilution rate of 1:1 (the final concentration was 100 U/mL) and cultured in an incubator at 37°C with 5% CO2. The cell line LNCaP with the highest expression of MCM3AP-AS1 was screened by qRT-PCR. First, the cell line LNCaP was seeded into a six-well cell culture plate (4 × 105 cells/well). After 24 h of culture, they were further cultured in DNMT inhibitor 5-aza-dc medium (the final concentration was 2 μmol/L), and the culture medium was changed every other day. The cells cultured in DMSO (the final concentration was 2 μmol/L) were used as control. Second, the cell line LNCaP was seeded in a six-well cell culture plate at a density of 4 × 105 cells/well. Lentiviral vectors pLV-EGFP-N containing wild-type (WT) MCM3AP-AS1 or NPY1R and lentiviral vectors pSIH1-H1-copGFP containing the shRNA sequences against MCM3AP-AS1 (GenePharma, Shanghai, China) were diluted into 100 pmol using 250 μL serum-free Opti-MEM. Subsequently, the two lentiviral vectors were added into the six-well plate in a separate manner (the final concentration was 50 nM). After delivery of the lentiviral vectors, the plate was further cultured in RPMI-1640 medium containing 10% FBS (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 24–48 h. Finally, cells treated with pLV-EGFP-N-MCM3AP-AS1 were seeded into a new six-well cell culture plate, followed by separate addition of 1 μmol/L SB203580 (P38 MAPK inhibitor), 1 μmol/L PD98059 (ERK MAPK inhibitor), and 1 μmol/L SP600125 (JNK MAPK inhibitor).

qRT-PCR

The cells were collected and lysed using TRIzol (Sigma-Aldrich, San Francisco, CA, USA) to extract the total RNA. A PrimeScript RT Reagent Kit (Takara Holdings, Kyoto, Japan) was adopted to reverse transcribe the extracted RNA. The target gene was quantitatively analyzed by fluorescence qPCR with reference to SYBR Premix Ex Taq II (Tli RNaseH Plus) kit (Takara Holdings, Kyoto, Japan). Real-time fluorescence qPCR was performed using a Thermal Cycler Dice Real Time System amplifier (TP800; Takara Holdings, Kyoto, Japan). Primer sequences (Table 2) were synthesized by Guangzhou RiboBio (Guangzhou, China), with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used as internal reference gene. The fold changes were calculated using the 2−ΔΔCt method.
Table 2

Primer Sequences for qRT-PCR

Target GenePrimer Sequence
MCM3AP-AS1F: 5′-GCTGCTAATGGCAACACTGA-3′
R: 5′-AGGTGCTGTCTGGTGGAGAT-3′
NPY1RF: 5′-CTGATGGACCACTGGGTCTT-3′
R: 5′-GAAGAAGCCACTGCAAGGAC-3′
ARF: 5′-CCAGGGACCATGTTTTGCC-3′
R: 5′-CGAAGACGACAAGATGGACAA-3′
GAPDHF: 5′-CAGGAGGCATTGCTGATGAT-3′
R: 5′-GAAGGCTGGGGCTCATTT-3′

AR, androgen receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; MCM3AP-AS1, MCM3AP antisense RNA 1; NPY1R, neuropeptide Y receptor Y1; qRT-PCR, quantitative reverse transcription polymerase chain reaction; R, reverse.

Primer Sequences for qRT-PCR AR, androgen receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; MCM3AP-AS1, MCM3AP antisense RNA 1; NPY1R, neuropeptide Y receptor Y1; qRT-PCR, quantitative reverse transcription polymerase chain reaction; R, reverse.

Western Blot Analysis

The total cell protein was isolated using the radioimmunoprecipitation assay (RIPA) lysate (R0010; Beijing Solarbio Science & Technology, Beijing, China). The protein was transferred onto a polyvinylidene fluoride (PVDF) membrane and then immunoblotted. The primary antibodies included rabbit antibodies against NPY1R (ab183108, 1:1,000), p38 (ab170099, 1:5,000), p-p38 (ab4822, 1:1,000), ERK (ab184699, 1:10,000), p-ERK (201015, 1:1,000), JNK (ab 179461, 1:1,000), p-JNK (ab124956, 1:1,000), DNMT1 (ab19905, 1:1,000), DNMT3A (ab4897, 1:1,000), and DNMT3B (79822, 1:2,000). The secondary antibody included horseradish peroxidase (HRP)-labeled goat anti-rabbit immunoglobulin G (IgG; ab205718, 1:2,000). The aforementioned antibodies were procured from Abcam (Cambridge, MA, USA). ImageJ 1.48u software (National Institutes of Health, Bethesda, MD, USA) was used for protein quantitative analysis, and the protein was quantitatively analyzed as the ratio of the gray value of each protein to that of the internal reference GAPDH.

Scratch Test

Dulbecco’s minimal essential medium (DMEM) was used to adjust the concentration of the cells to 1 × 106 cells/mL. Next, the cells were added to a 96-well plate coated with 10 μg/mL extracellular matrix molecule, followed by routine culture with DMEM containing 10% FBS until the cell monolayer was formed. Scratches were made along the bottom of the culture plate. The relative distance of the scratches was recorded. The cells were washed with serum-free medium and cultured for 48 h in a routine manner. Finally, the cells were observed under an inverted microscope (TE2000; Nikon, Tokyo, Japan) and photographed for measurement of the wound-healing distance.

Transwell Assay

The cells were prepared into a 1 × 106 cells/mL cell suspension in 100 μL of serum-free medium and then seeded in the Matrigel-coated apical chamber of a Transwell culture chamber (3413; Beijing Unique Biotechnology, Beijing, China). Next, 600 μL DMEM containing 20% FBS was added into the basolateral chamber, with three duplicated wells set for each group. After 24 h of incubation at 37°C with 5% CO2, the Transwell chamber was taken out, followed by addition of 0.1% crystal violet to stain the cells for 5 min. The cells were observed under an inverted fluorescence microscope (TE2000; Nikon, Tokyo, Japan), with four to five visual fields counted.

EdU Incorporation Assay

Cells were seeded into a 24-well plate and incubated using the EdU solution (10 μmol/L) for 2 h, followed by incubation with 100 μL Apollo 567 (Guangzhou RiboBio, Guangzhou, China) for 30 min. Next, 4′,6-diamidino-2-phenylindole (DAPI) was used to stain the nuclei for 5 min. Three duplicated wells were set for each group. The number of positive cells in each visual field was observed and recorded under a fluorescence microscope (FM-600; Shanghai Puda Optical Instrument, Shanghai, China). The total cells are blue and the positive cells are red under the microscope.

Flow Cytometry

Cell apoptosis was detected according to the instructions of Annexin V/fluorescein isothiocyanate (FITC) cell apoptosis detection kit (K201-100; BioVision, CA, USA). A total of 100 μL staining solution was applied to re-suspend 1 × 106 cells, followed by incubation for 15 min. Next, 1 mL N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid (HEPES) buffer (PB180325; Procell, Wuhan, China) was added to the cells. FITC and propidium iodide (PI) fluorescence were detected using 525- and 620-nm bandpass filters, respectively, at the excitation wavelength of 488 nm.

FISH

FISH was used to detect the localization of MCM3AP-AS1 in PCa cells. MCM3AP-AS1 probes were prepared using RiboTM lncRNA FISH Probe Mix (Red) (Guangzhou RiboBio, Guangzhou, China). In brief, PCa cells were inoculated into a six-well culture plate, fixed with 4% polyformaldehyde, and treated with protease K (2 μg/mL), glycine, and ethylphthalate reagent. After pre-hybridization, 250 μL hybridization solution containing probes (300 ng/mL) was added to the plate, followed by overnight incubation at 42°C. DAPI diluted by Tween 20 (PBST) solution (1:800) was added for the purpose of staining the nuclei. Five different visual fields were randomly selected under an inverted fluorescence microscope (Olympus, Tokyo, Japan), observed, and photographed.

MSP

A DNA Methylation-Gold kit (D5005; Zymo Research, Irvine, CA, USA) was used to detect the methylation level of the NPY1R promoter region. The genomic DNA extraction kit (Tiangen Biochemical Technology, Beijing, China) was used to extract genomic DNA. Next, 1 μg DNA was modified with bisulfite, purified, and subjected to PCR. The primers for methylation and unmethylation of NPY1R gene are listed in Table 3. The PCR products were analyzed by agarose gel electrophoresis, and the obtained images were processed using a gel imaging system.
Table 3

Primer Sequences for MSP

Primer Sequences (5′–3′)
NPY1R (M)F: GATGGGTTTGGTCGTTTTTAAC
R: CATTAAATCAAATTTATTCCCAACG
NPY1R (U)F: GATGGGTTTGGTTGTTTTTAATG
R: TTAAATCAAATTTATTCCCAACACT

F, forward; M, methylation; MSP, methylation-specific PCR; NPY1R, neuropeptide Y receptor Y1; R, reverse; U, unmethylation.

Primer Sequences for MSP F, forward; M, methylation; MSP, methylation-specific PCR; NPY1R, neuropeptide Y receptor Y1; R, reverse; U, unmethylation.

ChIP

PCa cells were fixed using 1% formaldehyde for 10 min, allowing a crosslinking process between the DNA and protein inside the cells. After crosslinking, the DNA-protein complexes were randomly fragmented by ultrasound treatment, followed by centrifugation at 4°C at 13,000 rpm. Next, the obtained supernatant was separately placed into three tubes. Positive control antibody against RNA polymerase II, NC antibody against normal mouse IgG (1:100; ab109489), and target protein-specific mouse antibodies against DNMT1 (1:100, ab13537), DNMT3A (1:100, ab2850), and DNMT3B (1:100, ab2851) were added to the three tubes, respectively, and incubated overnight at 4°C. Subsequently, endogenous DNA-protein complexes were precipitated using Protein Agarose/Sepharose, followed by de-crosslinking overnight at 65°C. The following day, DNA fragments were purified and retrieved using phenol/chloroform. NPY1R promoter fragment-specific primers were used to detect the enrichment of NPY1R promoter fragments binding to DNMT1, DNMT3A, and DNMT3B.

RIP

The binding of MCM3AP-AS1 to DNMT1, DNMT3A, and DNMT3B was detected using a RIP kit (Millipore, Billerica, MA, USA). RIPA lysate (P0013B; Beyotime, Shanghai, China) was applied to lyse cells, followed by centrifugation at 14,000 rpm at 4°C for 10 min. Cell lysates were incubated along with magnetic beads labeled with antibodies for co-precipitation purposes. The antibodies included mouse antibody against DNMT1 (1:100, ab13537), rabbit antibody against DNMT3A (1:100, ab2850), and DNMT3B (1:100, ab2851; Abcam, Cambridge, MA, USA). IgG (1:100, ab109489; Abcam, Cambridge, MA, USA) served as the NC. The magnetic bead-protein complex was treated with protease K, with the RNA subsequently extracted for PCR detection.

RNA Pull-Down

Cell lysates were centrifuged at 12,000 × g at 4°C for 10 min, and the supernatant was collected and transferred to an RNase-free centrifugal tube. Next, 400 ng biotin-labeled MCM3AP-AS1 was added to 500 μL RIP buffer and mixed with cell lysates for 1 h. Afterward, the streptavidin beads were added to each binding reaction and incubated for 1 h. Finally, the DNMT1, DNMT3A, and DNMT3B proteins in the eluted complex were detected using western blot analysis.

Xenograft in Nude Mice

Thirty-six BALB/c female nude mice aged 4–6 weeks and weighing about 18–22 g (purchased from Shanghai SLAC Laboratory Animal, China) were selected for this study. The aforementioned nude mice were randomly injected with pLV-EGFP-N-NC lentivirus vector, pLV-EGFP-N-MCM3AP-AS1, and pLV-EGFP-N-NC lentivirus vector, or pLV-EGFP-N-MCM3AP-AS1 and pLYFP-NP-RV lentiviral vector. In brief, lentiviral vectors with a titer of 2 × 108 plaque-forming units (PFUs)/mL were used to infect the PCa cells. After stable-transfected cell lines were obtained, cell suspension (5 × 107 cells/mL) was made, 0.2 mL of which was inoculated into the left axillary subcutaneous of the BALB/c nude mice using a 1-mL syringe. The tumor growth was observed on the 7th, 14th, 21st, 28th, and 35th days after inoculation. The mice were euthanized by cervical dislocation on the 36th day of culture.

Statistical Analysis

Statistical analyses were performed using the SPSS 21.0 software (IBM, Armonk, NY, USA). Each experiment was independently repeated three times. Measurement data are expressed as mean ± standard deviation. Unpaired t test was used to compare the data obeying normal distribution and homogeneous variance between two groups. The Kolmogorov-Smirnov method was applied for testing normal distribution. Data among multiple groups were compared by one-way analysis of variance (ANOVA), and those obeying normal distribution were further analyzed with Tukey’s post hoc test. Data at different time points were analyzed using repeated-measures ANOVA followed by Bonferroni’s post hoc test. The PSA recurrence-free curve was drawn using the Kaplan-Meier method with difference in PSA recurrence-free survival shown in the log rank test. A p value <0.05 indicated statistical significance.

Author Contributions

X.L., J.L., and S.L. designed the study. J.L. and S.L. collated the data, carried out data analyses, and produced the initial draft of the manuscript. X.L. and S.L. contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.

Conflicts of Interest

The authors declare no competing interests.
  33 in total

Review 1.  The Epidemiology of Prostate Cancer.

Authors:  Claire H Pernar; Ericka M Ebot; Kathryn M Wilson; Lorelei A Mucci
Journal:  Cold Spring Harb Perspect Med       Date:  2018-12-03       Impact factor: 6.915

2.  The influence of CpG (5'-d(CpG)-3' dinucleotides) methylation on ultrasonic DNA fragmentation.

Authors:  Ravil R Garafutdinov; Aizilya A Galimova; Assol R Sakhabutdinova
Journal:  J Biomol Struct Dyn       Date:  2018-11-25

3.  Risk factors for prostate cancer: A multifactorial case-control study.

Authors:  Saima Shakil Malik; Rakshanda Batool; Nosheen Masood; Azra Yasmin
Journal:  Curr Probl Cancer       Date:  2018-02-09       Impact factor: 3.187

4.  Activator of G protein signaling 3 modulates prostate tumor development and progression.

Authors:  Timothy O Adekoya; Nikia Smith; Temilade Aladeniyi; Joe B Blumer; Xiaoxin L Chen; Ricardo M Richardson
Journal:  Carcinogenesis       Date:  2019-12-31       Impact factor: 4.944

5.  Neuropeptide Y1 receptor inhibits cell growth through inactivating mitogen-activated protein kinase signal pathway in human hepatocellular carcinoma.

Authors:  Xiufang Lv; Fengbo Zhao; Xisong Huo; Weidong Tang; Baoying Hu; Xiu Gong; Juan Yang; Qiujin Shen; Wenxin Qin
Journal:  Med Oncol       Date:  2016-06-04       Impact factor: 3.064

6.  Evf2 (Dlx6as) lncRNA regulates ultraconserved enhancer methylation and the differential transcriptional control of adjacent genes.

Authors:  Emily G Berghoff; Mary F Clark; Sean Chen; Ivelisse Cajigas; David E Leib; Jhumku D Kohtz
Journal:  Development       Date:  2013-10-02       Impact factor: 6.868

7.  Expression profile analysis of long non-coding RNA in acute myeloid leukemia by microarray and bioinformatics.

Authors:  Yuandong Feng; Ying Shen; Hongli Chen; Xiaman Wang; Ru Zhang; Yue Peng; Xiaoru Lei; Tian Liu; Jing Liu; Liufang Gu; Fangxia Wang; Yun Yang; Ju Bai; Jianli Wang; Wanhong Zhao; Aili He
Journal:  Cancer Sci       Date:  2018-01-27       Impact factor: 6.716

8.  Identification of androgen-responsive lncRNAs as diagnostic and prognostic markers for prostate cancer.

Authors:  Xuechao Wan; Wenhua Huang; Shu Yang; Yalong Zhang; Honglei Pu; Fangqiu Fu; Yan Huang; Hai Wu; Tao Li; Yao Li
Journal:  Oncotarget       Date:  2016-09-13

9.  A novel lncRNA MCM3AP-AS1 promotes the growth of hepatocellular carcinoma by targeting miR-194-5p/FOXA1 axis.

Authors:  Yufeng Wang; Liu Yang; Tianxiang Chen; Xin Liu; Yang Guo; Qiaojuan Zhu; Xiangmin Tong; Wei Yang; Qiuran Xu; Dongsheng Huang; Kangsheng Tu
Journal:  Mol Cancer       Date:  2019-02-19       Impact factor: 27.401

10.  LncRNA FOXP4-AS1 is activated by PAX5 and promotes the growth of prostate cancer by sequestering miR-3184-5p to upregulate FOXP4.

Authors:  Xingcheng Wu; Yu Xiao; Yi Zhou; Zhien Zhou; Weigang Yan
Journal:  Cell Death Dis       Date:  2019-06-17       Impact factor: 8.469

View more
  11 in total

Review 1.  A putative role for lncRNAs in epigenetic regulation of memory.

Authors:  Ashleigh B Irwin; Rudhab Bahabry; Farah D Lubin
Journal:  Neurochem Int       Date:  2021-09-14       Impact factor: 3.921

Review 2.  The role of LncRNA MCM3AP-AS1 in human cancer.

Authors:  Shirin Azizidoost; Farhoodeh Ghaedrahmati; Mohadeseh Sheykhi-Sabzehpoush; Shahab Uddin; Mehri Ghafourian; Abdolah Mousavi Salehi; Mona Keivan; Maryam Cheraghzadeh; Zahra Nazeri; Maryam Farzaneh; Seyed Esmaeil Khoshnam
Journal:  Clin Transl Oncol       Date:  2022-08-24       Impact factor: 3.340

Review 3.  A review on the role of MCM3AP-AS1 in the carcinogenesis and tumor progression.

Authors:  Soudeh Ghafouri-Fard; Tayyebeh Khoshbakht; Bashdar Mahmud Hussen; Mohammad Taheri; Mohammad Samadian
Journal:  Cancer Cell Int       Date:  2022-07-05       Impact factor: 6.429

4.  MCM3AP-AS1/miR-876-5p/WNT5A axis regulates the proliferation of prostate cancer cells.

Authors:  Jie Wu; Yalin Lv; Yujun Li; Yanxia Jiang; Lili Wang; Xiangyan Zhang; Mengqi Sun; Yuwei Zou; Jin Xu; Li Zhang
Journal:  Cancer Cell Int       Date:  2020-07-13       Impact factor: 5.722

5.  LncRNA MCM3AP-AS1 Promotes Cell Proliferation and Invasion Through Regulating miR-543-3p/SLC39A10/PTEN Axis in Prostate Cancer.

Authors:  Zhaohui Jia; Wensheng Li; Pan Bian; Hui Liu; Dong Pan; Zhongling Dou
Journal:  Onco Targets Ther       Date:  2020-09-22       Impact factor: 4.345

6.  The Novel Methylation Biomarker NPY5R Sensitizes Breast Cancer Cells to Chemotherapy.

Authors:  Jiazhou Liu; Xiaoyu Wang; Jiazheng Sun; Yuru Chen; Jie Li; Jing Huang; Huimin Du; Lu Gan; Zhu Qiu; Hongzhong Li; Guosheng Ren; Yuxian Wei
Journal:  Front Cell Dev Biol       Date:  2022-01-11

7.  Modification Patterns of DNA Methylation-Related lncRNAs Regulating Genomic Instability for Improving the Clinical Outcomes and Tumour Microenvironment Characterisation of Lower-Grade Gliomas.

Authors:  Aierpati Maimaiti; Yirizhati Aili; Mirzat Turhon; Kaheerman Kadeer; Paziliya Aikelamu; Zhitao Wang; Weiwei Niu; Maimaitili Aisha; Maimaitijiang Kasimu; Yongxin Wang; Zengliang Wang
Journal:  Front Mol Biosci       Date:  2022-03-10

Review 8.  Long Non-Coding RNA MCM3AP-AS1: A Crucial Role in Human Malignancies.

Authors:  Tao Ma; Fa-Hong Wu; Hong-Xia Wu; Qiong Fa; Yan Chen
Journal:  Pathol Oncol Res       Date:  2022-06-16       Impact factor: 2.874

9.  Long non-coding RNA MCM3AP antisense RNA 1 silencing upregulates microRNA-24-3p to accelerate proliferation and migration of vascular endothelial cells in myocardial infarction rats by reducing EIF4G2.

Authors:  Ke Chen; Min Xi; Qihong Huang; Hao Wu; Guirong Lu; Shaohui Song; Wei Shi
Journal:  Cell Cycle       Date:  2022-02-03       Impact factor: 5.173

10.  Long non-coding RNA MCM3AP antisense RNA 1 promotes non-small cell lung cancer progression through targeting microRNA-195-5p.

Authors:  Dijian Shen; Jianqiang Li; Kaiyi Tao; Youhua Jiang
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.