| Literature DB >> 32190671 |
Qiwei Liu1, Liang Kong1, Junhui Zhang2, Qian Xu1, Jingxue Wang1, Zhigang Xue3, Jinjuan Wang1.
Abstract
Polycystic ovary syndrome (PCOS) is a common female endocrine system disease that affects 17.8% of women of reproductive age and leads to infertility, obesity, glucose metabolic disorders, cardiovascular disease, and body-mind problems. However, the etiology of PCOS remains unclear. Follicular growth is disrupted as a result of ovarian hyperandrogenism and distorted intraovarian paracrine signaling in women with PCOS. Microcommunication between oocytes and cumulus cells plays a critical role in folliculogenesis. Gap junction alpha 1 (GJA1) plays a crucial role in the developing follicles by forming communication channels between cumulus cells and oocytes, but this has not yet been reported in women with PCOS. Therefore, we aimed to study the role of GJA1 in the microcommunication between oocytes and cumulus cells in women with PCOS. In our study, cumulus cell-oocyte complexes (COCs) from women were isolated via ultrasound-guided vaginal puncture, and oocytes were selected from COCs and categorized based on 3 oocyte maturation stages. Then, RT-qPCR and immunofluorescence analysis were performed to detect both the gene expression and protein of GJA1 in oocytes from women with and without PCOS. There was no statistically significant difference in age and BMI (body mass index), but patients with PCOS had a higher ratio of basic LH/FSH (luteinizing hormone/follicle-stimulating hormone), androstenedione, and total ovarian volume. The qRT-PCR results showed higher gene expression of GJA1 in oocytes without PCOS at the germinal vesicle (GV) stage compared with that of oocytes from women with PCOS. Immunofluorescence analysis showed that the expression level of GJA1 in oocytes from women with PCOS was very weak compared with that of oocytes from women without PCOS. In conclusion, GJA1 may play a critical role in the development of oogenesis arrest in women with PCOS throughout the oogenesis processes, including oogenesis and oocyte maturation.Entities:
Mesh:
Substances:
Year: 2020 PMID: 32190671 PMCID: PMC7066426 DOI: 10.1155/2020/5403904
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
Clinical characteristics and outcome of patients with and without PCOS.
| Non-PCOS ( | PCOS ( |
| |
|---|---|---|---|
| Age (year) | 26.4 ± 1.1 | 25.9 ± 0.8 | 0.7035 |
| BMI (kg/m2) | 23.6 ± 0.1 | 23.1 ± 1.7 | 0.7804 |
| AFC | 7.8 ± 0.5 | >24.000 | <0.001 (0.000) |
| FSH (mIU/mL) | 7.4 ± 0.7 | 7.6 ± 0.3 | 0.7820 |
| LH (mIU/mL) | 5.9 ± 0.8 | 13.4 ± 1.3 | <0.001 (0.000) |
| LH/FSH | 3.5 ± 0.5 | 6.8 ± 0.6 | <0.001 (0.000) |
| Insulin (IU) | 12.4 ± 1.7 | 15.4 ± 4.4 | 0.8541 |
| Testosterone (nmol/L) | 0.9 ± 0.1 | 1.9 ± 0.2 | <0.001 (0.000) |
| Androstenedione (nmol/L) | 1.8 ± 0.1 | 2.3 ± 0.3 | 0.1611 |
| SHBG (nmol/L) | 54.2 ± 7.0 | 40.0 ± 4.8 | 0.1177 |
BMI: body mass index; FSH: follicle-stimulating hormone; LH: luteinizing hormone, AFC: antral follicle; SHBG: sex hormone-binding globulin.
Primers used for qRT-PCR.
| cDNA | Sense primer (5′-3′) | Antisense primer (5′-3′) |
|---|---|---|
| GJA1 | CAATCTCTCATGTGCGCTTCT | GGCAACCTTGAGTTCTTCCTCT |
| GAPDH | ACCCGCCCTATCTCAACTACC | AGGACACCATAATGACAGCCT |
GJA1: Gap junction alpha 1 protein; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Numbers of oocyte at different stages analyzed by qRT-RNA and immunofluorescence.
| GV | MI | MII | Immunofluorescence | |
|---|---|---|---|---|
| Normal | 6 | 6 | 4 | 5 |
| PCOS | 6 | 7 | 4 | 5 |
GV: germinal vesicle, oocyte maturation arrested in the prophase of meiosis; MI: metaphase I, first meiotic metaphase; MII: metaphase II, second meiotic metaphase.
Figure 1Differentially expressed genes in oocytes from PCOS compared with oocyte from non-PCOS by RT-PCR. N-GV: gene expression levels in oocyte at GV stage from normal women; P-GV: gene expression levels in oocyte at GV stage from PCOS women; N-MI: gene expression levels in oocyte at MI stage from normal women; P-MI: gene expression levels in oocyte at MI stage from PCOS women; N-MII: gene expression levels in oocyte at MII stage from normal women; P-MII: gene expression levels in oocyte at MII stage from PCOS women. ∗P value < 0.05.
Figure 2Immunofluorescence staining for detecting the expression pattern of GJA1 in human oocyte with and without PCOS at GV stage. (a–c) Oocyte from women without PCOS. (d–f) Oocyte from PCOS women. Oocytes were counterstained with the cytoskeleton (green) and nuclei (DAPI, blue). Bar = 50 μm.