| Literature DB >> 32184910 |
M C Ugwu1,2, M Shariff2, C M Nnajide1, K Beri2, U M Okezie1, I R Iroha1,3, C O Esimone1.
Abstract
Little is known about the molecular basis of antibiotic resistance among uropathogens in Southeast Nigeria. The aim of the study was to characterize enterobacterial uropathogens with respect to drug resistance. One hundred (100) enterobacterial uropathogens were studied. Their antibiotic susceptibility patterns were evaluated using disk diffusion, screened, and confirmed phenotypically for the presence of β-lactamases: ESBL, AmpC, carbapenemase, and MBLs. Screen positives were further tested for various β-lactamase genes by PCR. Our isolates showed variable resistance to most drugs tested. Out of the 58 ESBL screen positive E. coli, 35 were confirmed positive with PCR. The predominant ESBL gene was blaTEM while blaSPM was the most prevalent among MBL genes. Forty-six percentage of the screen positive Salmonella isolates coharbored blaTEM + SHV genes. Nine of the 10 ESBL screen positive K. pneumoniae were phenotypically and PCR positive. Three isolates of K. pneumoniae were positive for MBL genes. All the 10 C. freundii were positive for ESBL genes. The study showed high prevalence of drug-resistant genes among the enterobacterial uropathogens. Majority of the uropathogens harbored >1 antibiotic-resistant gene, and the most predominant gene was ESBL (blaTEM) followed by the MBL (SPM) gene.Entities:
Year: 2020 PMID: 32184910 PMCID: PMC7060859 DOI: 10.1155/2020/5843904
Source DB: PubMed Journal: Can J Infect Dis Med Microbiol ISSN: 1712-9532 Impact factor: 2.585
Primer sequence/PCR conditions for the ESBL resistance genotyping [12, 40].
| Genes | Primer sequences (5′-3′) | Annealing temp. (°C) | No. of cycles (2–4) | Amplicon size (bp) |
|---|---|---|---|---|
| TEM | F: CATTTCCGTGTCGCCCTTATTC | 60 | 30 | 800 |
| SHV | F: AGCCGCTTGAGCAAATTAAAC | 60 | 30 | 713 |
| OXA-1-like | F: GGCACCAGATTCAACTTTCAAG | 60 | 30 | 564 |
| CTX-M-1 | F: TTAGGAAATGTGCCGCTGTA | 60 | 30 | 688 |
| CTX-M-2 | F: CGTTAACGGCACGATGAC | 60 | 30 | 404 |
| CTX-M-9 | F: TCAAGCCTGCCGATCTGGT | 60 | 30 | 561 |
| GES 1–9, 11 | F: AGTCGGCTAGACCGGAAAG | 60 | 30 | 399 |
| PER 1,3 | F: GCTCCGATAATGAAAGCGT | 60 | 30 | 520 |
| VEB 1–6 | F: CATTTCCCGATGCAAAGCGT | 60 | 30 | 648 |
Primer sequence/PCR conditions for the MBL, AmpC, KPC, and NDM resistance genotyping [41–42].
| Genes | Primer sequences (5′-3′) | Annealing temperature (°C) | No. of cycles (2–4) | Amplicon size (bp) |
|---|---|---|---|---|
| VIM | F: GAT GGT GTT TGG TCG CAT | 52 | 36 | 390 |
| IMP | F: GGA ATA GAG TGG CTT AAT CTC | 52 | 36 | 180 |
| GIM | F: TCG ACA CAC CTT GGT CTG AA | 52 | 36 | 477 |
| SPM | F: AAA ATC TGG GTA CGC AAA CG | 52 | 36 | 271 |
| SIM | F: TAC AAG GGA TTC GGC ATC G | 52 | 36 | 570 |
| MOXM | F: GCT GCT CAA GGA GCA CAG GAT | 64 | 25 | 520 |
| CITM | F: TGG CCA GAA CTG ACA GGC AAA | 64 | 25 | 462 |
| DHAM | F : AAC TTT CAC AGG TGT GCT GGG T | 64 | 25 | 405 |
| ACCM | F: AAC AGC CTC AGC AGC CGG TTA | 64 | 25 | 346 |
| EBCM | F: TCG GTA AAG CCG ATG TTG CGG | 64 | 25 | 302 |
| FOXM | F: AAC ATG GGG TAT CAG GGA GAT G | 64 | 25 | 190 |
| NDM-1 | F: ACC GCC TGG ACC GAT GAC CA | 58 | 35 | 264 |
| KPC | F: CATTCAAGGGCTTTCTTGCTGC | 55 | 30 | 538 |
Antibiotic susceptibility pattern of E. coli (n = 58).
| S/no | Antibiotics | No. of isolates (%) | ||
|---|---|---|---|---|
| Resistant | Intermediate | Susceptible | ||
| 1 | Cefpodoxime (CPD) | 35 (60.34) | 19 (32.76) | 4 (6.90) |
| 2 | Ceftriaxone (CTR) | 0 (0) | 10 (17.24) | 48 (82.76) |
| 3 | Aztreonam (AT) | 1 (1.72) | 36 (62.07) | 21 (36.21) |
| 4 | Cefotaxime (CTX) | 8 (13.79) | 33 (56.90) | 17 (29.31) |
| 5 | Ceftazidime (CAZ) | 1 (1.72) | 34 (58.62) | 23 (39.66) |
| 6 | Meropenem (MRP) | 9 (15.52) | 7 (12.06) | 42 (72.41) |
| 7 | Cefoxitin (CX) | 3 (5.17) | 11 (18.97) | 44 (75.86) |
| 8 | Ofloxacin (OF) | 4 (6.90) | 4 (6.90) | 50 (86.21) |
| 9 | Ciprofloxacin (CIP) | 4 (6.90) | 10 (17.24) | 44 (75.86) |
| 10 | Norfloxacin (NX) | 5 (8.62) | 1 (1.72) | 51 (87.93) |
| 11 | Levofloxacin (LE) | 4 (6.90) | 0 (0) | 54 (93.10) |
| 12 | Cotrimoxazole (COT) | 29 (50) | 1 (1.72) | 26 (44.83) |
| 13 | Gentamicin (GEN) | 6 (10.34) | 6 (10.34) | 45 (77.59) |
| 14 | Amoxicillin (AMX) | 16 (27.59) | 3 (5.17) | 20 (34.48) |
Antibiotic susceptibility pattern of Salmonella spp. (n = 15).
| S/no | Antibiotics | No. of isolates (%) | ||
|---|---|---|---|---|
| Resistant | Intermediate | Susceptible | ||
| 1 | Cefpodoxime (CPD) | 0 (0) | 0 (0) | 15 (100) |
| 2 | Ceftriaxione (CTR) | 2 (13.33) | 0 (0) | 13 (86.67) |
| 3 | Aztreonam (AT) | 0 (0) | 2 (13.33) | 13 (86.67) |
| 4 | Cefotaxime (CTX) | 2 (13.33) | 0 (0) | 13 (86.67) |
| 5 | Ceftazidime (CAZ) | 1 (6.67) | 4 (26.67) | 10 (66.67) |
| 6 | Meropenem (MRP) | 8 (53.33) | 1 (6.67) | 6 (40) |
| 7 | Cefoxitin (CX) | 0 (0) | 14 (93.33) | 1 (6.67) |
| 8 | Ofloxacin (OF) | 11 (73.33) | 4(26.67) | 0 (0) |
| 9 | Ciprofloxacin (CIP) | 8 (53.33) | 6 (40) | 1 (6.67) |
| 10 | Norfloxacin (NX) | 8 (53.33) | 3 (20) | 4 (26.67) |
| 11 | Levofloxacin (LE) | 9 (60) | 2 (13.33) | 4 (26.67) |
| 12 | Cotrimoxazole (COT) | 10 (66.67) | 0 (0) | 4 (26.67) |
| 13 | Gentamicin (GEN) | 7 (46.67) | 0 (0) | 8 (53.33) |
Antibiotic susceptibility pattern of K. pneumoniae (n = 14).
| S/no | Antibiotics | No. of isolates (%) | ||
|---|---|---|---|---|
| Resistant | Intermediate | Susceptible | ||
| 1 | Cefpodoxime (CPD) | 10 (71.43) | 0 (0) | 0 (0) |
| 2 | Ceftriaxione (CTR) | 4 (28.57) | 4 (28.57) | 2 (14.29) |
| 3 | Aztreonam (AT) | 7 (50) | 2 (14.29) | 1 (7.14) |
| 4 | Cefotaxime (CTX) | 9 (64.29) | 0 (0) | 1 (7.14) |
| 5 | Ceftazidime (CAZ) | 6 (42.86) | 3 (21.43) | 1 (7.14) |
| 6 | Meropenem (MRP) | 4 (28.57) | 3 (21.43) | 3 (21.43) |
| 7 | Cefoxitin (CX) | 7 (50) | 3 (21.43) | 0 (0) |
| 8 | Ofloxacin (OF) | 5 (35.71) | 0 (0) | 9 (64.29) |
| 9 | Ciprofloxacin (CIP) | 5 (35.71) | 2 (14.29) | 7 (50) |
| 10 | Norfloxacin (NX) | 5 (35.71) | 0 (0) | 9 (64.29) |
| 11 | Levofloxacin (LE) | 5 (35.71) | 0 (0) | 9 (64.29) |
| 12 | Cotrimoxazole (COT) | 8 (57.14) | 0 (0) | 6 (42.86) |
| 13 | Gentamicin (GEN) | 4 (28.57) | 4 (28.57) | 5 (35.71) |
| 14 | Amoxicillin (AMX) | 10 (71.43) | 0 (0) | 0 (0) |
Summary of multiple antibiotic-resistant indices (MARIs) of uropathogens.
| Isolates | Number of isolates (%) | |
|---|---|---|
| MARI > 0.2 | MARI ≤ 0.2 | |
|
| 14 (100) | 0 (0) |
|
| 33 (57) | 25 (43) |
|
| 13 (87) | 2 (13) |
|
| 7 (70) | 3 (30) |
|
| 2 (67) | 1 (33) |
| Total | 69 (69) | 31 (31) |
Total number of antibiotics tested = 14.
Summary of bla-PCR-positive isolates.
| Organisms | TEM | SHV | OXA-1-like | TEM + SHV | TEM + OXA-I-LIKE | TEM + SHV + OXA-1-LIKE | MBL | AmpC |
|---|---|---|---|---|---|---|---|---|
|
| 31 | 1 | 0 | 3 | 0 | 0 | 10 | 1 |
|
| 10 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
|
| 2 | 2 | 0 | 0 | 2 | 3 | 3 | 0 |
|
| 0 | 0 | 0 | 7 | 0 | 0 | 2 | 0 |
| Total | 43 | 3 | 0 | 10 | 2 | 3 | 15 | 2 |
Antibiotic susceptibility pattern of Citrobacter freundii (n = 10).
| S/no | Antibiotics | No. of isolates (%) | ||
|---|---|---|---|---|
| Resistant | Intermediate | Susceptible | ||
| 1 | Cefpodoxime (CPD) | 8 (80) | 2 (20) | 0 (0) |
| 2 | Ceftriaxione (CTR) | 4 (40) | 4(40) | 2 (20) |
| 3 | Aztreonam (AT) | 3 (30) | 6 (60) | 1 (10) |
| 4 | Cefotaxime (CTX) | 6 (60) | 2 (20) | 2 (20) |
| 5 | Ceftazidime (CAZ) | 2 (20) | 6 (60) | 2 (20) |
| 6 | Meropenem (MRP) | 1 (10) | 3 (30) | 6 (60) |
| 7 | Cefoxitin (CX) | 5 (50) | 0 (0) | 5 (50) |
| 8 | Ofloxacin (OF) | 0 (0) | 3 (30) | 6 (60) |
| 9 | Ciprofloxacin (CIP) | 0 (0) | 5 (50) | 5 (50) |
| 10 | Norfloxacin (NX) | 1 (10) | 2 (20) | 8 (80) |
| 11 | Levofloxacin (LE) | 0 (0) | 1 (10) | 9 (90) |
| 12 | Cotrimoxazole (COT) | 7 (70) | 0 (0) | 3 (30) |
| 13 | Gentamicin (GEN) | 1 (10) | 0 (0) | 9 (90) |
| 14 | Amoxicillin (AMX) | 8 (80) | 0 (0) | 2 (20) |
Differences between bla-phenotypic and bla-PCR positives.
| Organisms | ESBL | MBL | AmpC | |||
|---|---|---|---|---|---|---|
| Phenotypic positive | PCR-positive | Phenotypic positive | PCR-positive | Phenotypic positive | PCR-positive | |
|
| 16 | 35 | 3 | 10 | 2 | 1 |
|
| 5 | 10 | 0 | 0 | 0 | 1 |
|
| 9 | 9 | 0 | 3 | 0 | 0 |
|
| 1 | 7 | 0 | 2 | 2 | 0 |
| Total | 31 | 61 | 3 | 15 | 4 | 2 |