Literature DB >> 32167558

A missense variant in specificity protein 6 (SP6) is associated with amelogenesis imperfecta.

Claire E L Smith1, Laura L E Whitehouse2, James A Poulter1, Laura Wilkinson Hewitt3, Fatima Nadat3, Brian R Jackson3, Iain W Manfield4, Thomas A Edwards5, Helen D Rodd6, Chris F Inglehearn1, Alan J Mighell2.   

Abstract

Amelogenesis is the process of enamel formation. For amelogenesis to proceed, the cells of the inner enamel epithelium (IEE) must first proliferate and then differentiate into the enamel-producing ameloblasts. Amelogenesis imperfecta (AI) is a heterogeneous group of genetic conditions that result in defective or absent tooth enamel. We identified a 2 bp variant c.817_818GC>AA in SP6, the gene encoding the SP6 transcription factor, in a Caucasian family with autosomal dominant hypoplastic AI. The resulting missense protein change, p.(Ala273Lys), is predicted to alter a DNA-binding residue in the first of three zinc fingers. SP6 has been shown to be crucial to both proliferation of the IEE and to its differentiation into ameloblasts. SP6 has also been implicated as an AI candidate gene through its study in rodent models. We investigated the effect of the missense variant in SP6 (p.(Ala273Lys)) using surface plasmon resonance protein-DNA binding studies. We identified a potential SP6 binding motif in the AMBN proximal promoter sequence and showed that wild-type (WT) SP6 binds more strongly to it than the mutant protein. We hypothesize that SP6 variants may be a very rare cause of AI due to the critical roles of SP6 in development and that the relatively mild effect of the missense variant identified in this study is sufficient to affect amelogenesis causing AI, but not so severe as to be incompatible with life. We suggest that current AI cohorts, both with autosomal recessive and dominant disease, be screened for SP6 variants.
© The Author(s) 2020. Published by Oxford University Press.

Entities:  

Year:  2020        PMID: 32167558      PMCID: PMC7268548          DOI: 10.1093/hmg/ddaa041

Source DB:  PubMed          Journal:  Hum Mol Genet        ISSN: 0964-6906            Impact factor:   6.150


Introduction

Enamel is nature’s most extreme example of biomineralization in humans. It results in a substance that is over 95% mineral by weight (1), a much greater content than for other examples of biomineralization, such as dentine (70%) or bone (65%) (2). Amelogenesis is the process of enamel formation. It begins with secretion by ameloblasts, the cells that form enamel, of a proteinaceous enamel matrix, created to the full thickness of the future enamel. This is then progressively mineralized through a series of repeated, cyclical processes. These involve the breakdown and removal of the enamel matrix proteins and the growth of calcium hydroxyapatite crystals to form the prisms that give enamel its hardness. However, for amelogenesis to begin, reciprocal signaling, both to and from the future enamel-producing dental epithelium and the future dentine-producing mesenchyme, is required to initiate the final stages of pre-ameloblast differentiation into ameloblasts (3,4). This means that the formation of dentine and the initiation of amelogenesis are intrinsically linked. Pre-odontoblasts polarize, undergo internal reorganization and exit the cell cycle to become odontoblasts in response to signaling from the epithelium (5). Odontoblasts secrete an initial pre-dentine collagen matrix that, when it begins to mineralize, prompts the pre-ameloblasts to elongate and to change their polarity, so that their apical face is adjacent to the dental papilla (5). Concomitantly, the pre-ameloblasts become post-mitotic ameloblasts and secrete greater amounts of enamel matrix proteins including ameloblastin, which is thought to act as an adhesion molecule and anchor for ameloblast attachment to the secreted enamel matrix (6). The factors implicated to date in the control of the proliferation of the dental epithelium and the differentiation of ameloblasts are numerous and include both the RUNX2NFICOSX (also known as SP7) transcription factor pathway (7), the Sp6 transcription factor (8) and many other transcription factors and signaling molecules. SP6 is also known as specificity protein 6 or epiprofin and was previously called Krüppel-like factor 14 (KLF14). Amelogenesis imperfecta (AI) is a heterogeneous group of genetic conditions characterized by defective enamel. AI can be broadly classified based on the enamel phenotype, although mixed phenotypes do occur. Defects at the start of or during enamel matrix secretion tend to cause hypoplastic AI, where the enamel is absent or thin and variably mineralized. Defects during the maturation stage generally result in hypomineralized AI, where the enamel is of full thickness but is weak and inevitably fails prematurely. Hypomineralized AI has been further subdivided into hypomaturation and hypocalcified AI that produce brittle and soft enamel, respectively. AI may present as an isolated phenotype or may be associated with other oral or extra-oral features as part of a syndrome. The prevalence of AI has been reported to be 1 in 700 in an isolated Swedish population (9) and around 1 in 14 000 in the US population (10). Mutations in many genes are known to cause AI, and these can be inherited in an autosomal recessive, dominant or X-linked manner (11). Mutations in the genes encoding the enamel matrix proteins (AMELX, AMBN and ENAM) and the enamel proteinases (MMP20 and KLK4) were the first to be reported to cause AI. Variants in other genes encoding proteins that mediate or affect cell adhesion (LAMA3, LAMB3, COL17A1, FAM83H and ITGB6) or are thought to be involved in endocytosis, calcium transport and pH sensing (WDR72, SLC24A4 and GPR68, respectively) have also been implicated. Mutations in the gene encoding transcription factor DLX3 and in genes encoding proteins for which their function in amelogenesis is less clear (e.g. ODAPH, AMTN, ACP4, RELT and FAM20A) are also known to cause AI. Despite this, between 51 and 72% of AI cases are reported to be genetically undiagnosed (12–14). However, mutations in many more genes have been identified as a cause of AI since some of these studies were published and massively parallel sequencing is in now routine use, so the detection rate at present is likely to be higher than in those reports. Here we report a family with dominantly inherited, hypoplastic AI carrying a variant in the Sp6 transcription factor gene (SP6). SP6 has been shown to be involved in ameloblast differentiation (15) and regulation of tooth-related genes (16). It has also been shown to be expressed during the secretory stage of amelogenesis (17) and in the pre-ameloblast inner enamel epithelium (IEE) (18). We model the effect of the variant on protein function and analyze its impact on SP6 binding to target gene promoters.

Results

Patient phenotype

We identified a White British family segregating autosomal dominant hypoplastic AI in the absence of any clinically obvious co-segregating health problems (Figure 1A).
Figure 1

Family pedigree, dental phenotype, genotyping and conservation. (A) Pedigree of the British family investigated. Affected family members are shaded. WES was carried out on the individuals marked with asterisk. Segregation analysis of the SP6 c.817_818GC>AA for all available family members is also shown. (B) The permanent dentition of the index case, IV:2 (arrow on pedigree) was characterized by generalized hypoplastic AI with an irregular surface involving all teeth. Note: the small soft tissue lesion involving the hard palate (marked with asterisk) is a reactive lesion unrelated to the dentition. (C) Sanger sequencing electropherograms to show the WT SP6 and the SP6 c.817_818GC>AA (NM_199262) variant sequence. (D) Conservation analysis of the p.Ala273 residue in orthologous and paralogous proteins.

Family pedigree, dental phenotype, genotyping and conservation. (A) Pedigree of the British family investigated. Affected family members are shaded. WES was carried out on the individuals marked with asterisk. Segregation analysis of the SP6 c.817_818GC>AA for all available family members is also shown. (B) The permanent dentition of the index case, IV:2 (arrow on pedigree) was characterized by generalized hypoplastic AI with an irregular surface involving all teeth. Note: the small soft tissue lesion involving the hard palate (marked with asterisk) is a reactive lesion unrelated to the dentition. (C) Sanger sequencing electropherograms to show the WT SP6 and the SP6 c.817_818GC>AA (NM_199262) variant sequence. (D) Conservation analysis of the p.Ala273 residue in orthologous and paralogous proteins.

Whole-exome sequencing, PCR and Sanger sequencing

To identify the cause of AI in this family, we performed whole exome sequencing (WES) on DNA from individuals II:3, III:3 and IV:2 (Figure 1A). Following alignment, processing and duplicate removal, a mean depth of 56.71, 64.12 and 87.62 reads per base was observed, respectively, for individuals II:3, III:3 and IV:1 with 98.3, 98.5 and 99.0% of bases covered by at least 5 reads, respectively, (further alignment statistics are available in Supplementary Material, Table S1). Indel and single nucleotide variants were called in variant call format (VCF) using the Haplotype Caller function of Genome Analysis Toolkit (GATK) (19). Variants were selected based on the autosomal dominant inheritance evident in the family (confirmed by male-to-male transmission). The resulting variants were then filtered to select those present in all three affected individuals (II:3, III:3 and IV:2) and to exclude all changes other than missense, frameshift or stop mutations, exonic insertions/deletions or variants located at splice consensus sites. In addition, variants present in gnomAD (v2.1.1) (20) were excluded if present at a frequency higher than that determined using the allele frequency app (http://cardiodb.org/allelefrequencyapp/) (21). A filter frequency cutoff of 4.51 × 10−5 was obtained using the following input values (data accessed May 1, 2017): monoallelic disease, 1 in 700 prevalence (the highest prevalence reported for AI (9)), an allelic heterogeneity value of 0.06 based on 132 reported autosomal dominant families, and the most frequently reported variant, ENAM c.1259_1260insAG, having been reported in 7 families to date (11). Genetic heterogeneity was arbitrarily set to 1 as per app instructions. This left 12 variants, of which only 8 segregated with the disease phenotype after PCR and Sanger sequencing of DNA from all available family members and segregation analysis (Supplementary Material, Table S2). One further variant (chr17:43553034G>A) in PLEKHM1 could not be confirmed nor checked for segregation with disease due the presence of a near identical pseudogene, PLEKHM1P. It is noteworthy that a rare SNP (rs768117863) is present at the homologous position for the variant in PLEKHM1P (chr17:62818453G>A). The sequences of the two homologous exons are 98.8% identical, suggesting that alignment quality might be compromised for these positions. Alongside variant calling, copy number variant (CNV) analysis was also performed, using ExomeDepth software (22). This compares read depths across all captured exons of samples from affected individuals (II:3, III:3 and IV:2) against the read depths of 10 samples from unrelated individuals whose DNA had been processed within the same WES batches, using identical conditions, as the affected samples from the family. After filtering to select only CNVs that occur in all three affected family members and that were not also called in three unrelated individuals, one rare CNV (not in the Database of Genomic Variants (23)) in SIGLEC11 remained (Supplementary Material, Table S3). Variant filtration in this family therefore appeared to exclude the involvement of all AI genes known to date, suggesting the involvement of a variant in a gene not previously implicated in AI. Supplementary Material, Table S4 reviews the available literature on the potential for involvement in AI of each of the 10 remaining candidate genes and variants. CALHM3, PCK2, KRT76, NME8, RAB26 and SIGLEC11 are relatively tolerant of variation (gene missense Z score ≤ 0.35) making it unlikely that heterozygous variants in these genes could cause Mendelian disease. For five of these six candidates, there is no known involvement in inherited disease of any sort, but polymorphisms in CALHM3 have been associated with susceptibility to Alzheimer disease (24) and Creutzfeld-Jakob disease (25) and are known to be involved in taste perception (26). Of the four remaining genes, human disease is already associated with variants in PLEKHM1 (OMIM #611497 osteopetrosis) and EPOR (OMIM #133100 erythrocytosis), but the family presented here does not exhibit either of these phenotypes. Very little is known about EFCC1, but again there is no known link with tooth development or function or involvement in any form of disease phenotype, either in humans or in animal models. Variants in the tenth candidate gene, SP6, have also not been associated with disease in humans to date. However, SP6 is known to have an essential role in ameloblast differentiation and to regulate the expression of many tooth-related genes. Furthermore, SP6 is already implicated in AI in a rat model carrying an Sp6 2 bp insertion (27,28) and in two murine Sp6−/− models (15,29). It has also previously been proposed as a candidate gene for AI (Supplementary Material, Table S4) (28). Therefore, of the variants that remained after segregation, the two base pair missense variant in SP6, c.817_818GC>AA, p.(Ala273Lys) (NM_199262.2, NP_954871.1) was prioritized for further investigation. This variant was absent in dbSNP150 and Genome Aggregation Database v.2.1.1 (gnomAD; accessed 08/02/2019). The variant is predicted to affect a residue that lies within the first of three C2H2 zinc finger domains and is highly conserved in SP6 orthologues in all species analysed and in all other SP family paralogues (Figure 1B). The p.(Ala273Lys) substitution is predicted to be deleterious or damaging by Provean, SIFT and Polyphen-2 with a combined annotation-dependent depletion (CADD) (v1.3) score of 33, suggesting that protein structure and/or function may be affected. Based on this result, we screened all known exons and flanking intronic sequence of SP6 (based on NM_001258248 and NM_199262) in a further 35 dominant AI samples, but no single nucleotide variants nor small indels in SP6 were identified (Supplementary Material, Table S5).

Protein structural analysis

Literature searching and database interrogation showed that SP6 consists of 376 amino acids and contains three ZnF domains (His254 to His278 [25aa], Phe284 to His308 [25aa] and Phe314 to His336 [23aa]) responsible for DNA binding (30). Within these three ZnF domains, three particular residues per ZnF contact the DNA. The variant identified here (p.(Ala273Lys)) alters a residue in the first ZnF domain that is predicted to form a direct contact with target DNA sequences (31). Therefore, p.(Ala273Lys) is likely to cause disease by affecting the binding of mutant SP6 to DNA. We searched the Protein Data Bank (PDB) for high-resolution structures for SP6. Although SP6 does not currently have a structure file in PDB, there are NMR structures of the three ZnFs of the highly homologous SP1 protein (Figure 1D). These structures (PDB codes 1VA1, 1VA2 and 1VA3) show the position corresponding to p.Ala273 on the solvent-exposed face of the ZnF α-helix. Substitution with a large, polar side chain in this location is unlikely to perturb protein folding as packing of the hydrophobic core or zinc ion binding is unaffected. Crystal structures of other Cys2His2 ZnF-DNA complexes, for example, for GLI and ZIF268 (PDB codes 2GLI and 1ZAA, respectively) allowed us to assess likely effects of the p.(Ala273Lys) variant. These show the α-helix docking into the major groove with contacts from various positions along the helix. Some fingers show contact to DNA from the amino acid immediately N-terminal to the His2 motif, including His, Val, Thr, Arg and indeed Lys (Supplementary Material, Figure S1). With the C-terminus of the α-helix (and the His2 motif) being relatively solvent-exposed and with the flexibility of the lysine side chain, it is not clear whether the increased volume of the p.(Ala273Lys) change would strongly inhibit docking of the SP6 mutant protein with DNA.

Identification of candidate SP6 promoter motifs and binding assays

Since SP6 is a transcription factor, we tested the effect of the c.817_818GC>AA, p.(Ala273Lys) variant on target sequence specificity and DNA binding through Biacore surface plasmon resonance (SPR) binding assays. Searching JASPAR (32) showed that the binding motif for SP6 is not known, but binding motifs for SP1, 2, 3, 4 and 8 are reported (Supplementary Material, Table S6). SP proteins are known to bind CG-rich promoter elements in promoter proximal regions (33) and the motifs identified in our search included GC boxes (GGGCGG), although these were generally identified on the non-coding strand. We then searched the proximal promoter sequences of known rodent SP6 target genes Amtn, Rock1, Car3, Fst, Osr2 and Pcm1 (Utami et al (16)), for sequences similar to the DNA motifs recognized by other SP proteins. We identified a 9 bp CCCCGCCCC motif, which contains the GC box sequence in antisense, within 101 bp or fewer upstream of the transcriptional start sites of the human genes ROCK1, CA3, FST and PCM1. Alternative shorter anti-sense GC box-containing sequences and other CG rich regions were identified upstream of the transcriptional start site of OSR2 (e.g. CCCGCCC). No motif was identified within the proximal promoter region of AMTN. The CCCCGCCCC motif has been reported previously to be bound by SP1 (34) and has been associated with nucleosome remodeling (35). This 9 bp motif should have a 50% chance of occurring randomly once every 181 Kbp. Another report presents evidence that SP6 may regulate AMBN expression in mice, although direct binding of SP6 to the Ambn promoter region was not assessed (15). We searched the proximal promoter region of AMBN and identified an 8 bp motif CCCGCCCC, similar to the 9 bp motif identified in the other genes, at 97 bp upstream from the transcriptional start site. Interestingly, this motif is within 4 bp of a second distal GC-rich motif CCCCCCCGCCAC. Affinity and kinetic values describing SP6-DNA binding to the AMBN oligonucleotide by Biacore SPR Values were determined by data fitting for all concentrations tested over 3-min injections and 5 min of dissociation (n = 3) Comparison of DNA-binding activity of WT and mutant SP6 proteins using Biacore SPR. Biotinylated oligonucleotides were captured on a streptavidin–derivatized sensor chip surface. WT and mutant SP6 proteins were washed over these surfaces across a range of concentrations. Each 3-min injection was followed by buffer washes to follow dissociation rates of the SP6-DNA complex. Sensorgram results are shown for the AMBN oligonucleotide (sequence in Supplementary Material, Table S8) (A) WT SP6; (B) mutant SP6. DNA-binding by the mutant SP6 protein demonstrates that this variant does not abolish binding, consistent with the mutation affecting only one of the three zinc finger motifs. However, the mutant does show reduced binding compared to the WT, with the dissociation rate for the mutant SP6 protein being faster than for the WT. This is clear on the AMBN promoter sequence surface with the signal dropping to lower values than for the WT protein. In addition, we searched the proximal promoter regions of other known and candidate AI genes, as well as SP6 itself, for potential SP6 binding sites. GC-rich motifs were identified in the proximal promoter regions of FAM83H and SP6. No likely motifs were identified in the promoters of known and candidate AI genes ACP4, AMELX, COL17A1, DLX3, ENAM, FAM20A, GPR68, ITGB6, KLK4, LAMA3, LAMB3, MMP20, ODAM, ODAPH, RELT, SLC10A7, SLC24A4, WDR72 and TUFT1. All motifs identified are detailed in Supplementary Material, Table S7. Four biotinylated complementary probes were designed for Biacore SPR studies of protein-DNA interactions (Supplementary Material, Table S8). The first three contain a putative SP6 binding motif from known SP6 bound target gene promoters; ROCK1 (chr18:18691847–18691886 negative stand) (16,36), AMBN (chr4:71457862–71457901 positive strand) (15) and CA3 (chr8: 86350989–86351028 positive strand) (16). The fourth contains a region, GCCTCCGGGAGGC, known to bind SP3 within the NKX2-1 promoter (chr14:36989530–36989569) (37) and was included to test SP6 specificity. To study the effect of the p.(Ala273Lys) variant in vitro, we cloned and expressed WT and mutant SP6 proteins. SPR was carried out using the four probes and a control underivatized surface as a reference flow cell. SP6 WT and SP6 p.(Ala273Lys) mutant proteins were injected over derivatized surfaces followed by buffer to observe the binding and dissociation rates of the DNA-protein complexes. Neither WT nor mutant SP6 protein bound the NKX2-1 promoter sequence (data not shown), supporting specificity for an exclusively-GC SP6 binding motif. Both proteins bound the ROCK1 and CA3 promoter sequences but gave low signals: 16 response units (RU) and 29 RU at maximum, respectively, for the 400 nM WT protein condition (Supplementary Material, Figure S2). In contrast, strong binding was evident for WT and mutant SP6 with the AMBN promoter sequence (228 RU and 154 RU, respectively, at maximum for the 400 nM protein concentration), as shown by the increasing signal with increasing concentration (Figure 2, Additional File 1). This shows that this oligonucleotide contains a relevant binding sequence for WT SP6. DNA-binding by the mutant protein demonstrates that this allele does not abolish this binding, consistent with the mutation affecting only one of the three zinc finger motifs. However, the mutant does show reduced maximal binding compared to the WT, a reduction of around 32%. The difference in binding is largely due to a significantly faster dissociation rate for the mutant protein-DNA complex than the WT (Table 1). This is clear for the AMBN promoter sequence surface, since the signal dropped at a faster rate and to lower values than for the WT protein.
Figure 2

Comparison of DNA-binding activity of WT and mutant SP6 proteins using Biacore SPR. Biotinylated oligonucleotides were captured on a streptavidin–derivatized sensor chip surface. WT and mutant SP6 proteins were washed over these surfaces across a range of concentrations. Each 3-min injection was followed by buffer washes to follow dissociation rates of the SP6-DNA complex. Sensorgram results are shown for the AMBN oligonucleotide (sequence in Supplementary Material, Table S8) (A) WT SP6; (B) mutant SP6. DNA-binding by the mutant SP6 protein demonstrates that this variant does not abolish binding, consistent with the mutation affecting only one of the three zinc finger motifs. However, the mutant does show reduced binding compared to the WT, with the dissociation rate for the mutant SP6 protein being faster than for the WT. This is clear on the AMBN promoter sequence surface with the signal dropping to lower values than for the WT protein.

Table 1

Affinity and kinetic values describing SP6-DNA binding to the AMBN oligonucleotide by Biacore SPR

KD (nM) ka (M−1 s−1) kd (s−1)
WT SP6226 (±12)2.18 × 104 (±0.005 × 104)4.91 × 10−3 (±0.18 × 10−3)
Mutant SP6295 (±77)2.07 × 104 (±0.053 × 104)5.68 × 10−3 (±0.18 × 10−3)

Values were determined by data fitting for all concentrations tested over 3-min injections and 5 min of dissociation (n = 3)

Discussion

We identified a family with autosomal dominant hypoplastic AI in whom WES revealed a 2 bp variant, c.817_818GC>AA in SP6, resulting in the missense change p.(Ala273Lys). PCR analysis confirmed that the SP6 variant segregates with the disease phenotype along with eight other variants. A screen of 35 additional dominant AI families revealed no further variants in SP6. SP6 belongs to the SP transcription factor family and consists of a proline rich N-terminal domain and a C terminal domain containing three C2H2 zinc finger domains (31). The zinc finger domains are believed to contact DNA via specific residues (38). For the first of the three zinc fingers in SP6, these residues are predicted by homology to be Lys267, His270 and Ala273 (31). The variant identified in the family reported here changes the small hydrophobic Ala273 residue to a large, hydrophilic residue, potentially altering the structure of the first zinc finger domain and also its function. Mutations in other SP family proteins have not been reported except for SP7. A frameshift mutation in SP7 was reported in a single case with autosomal recessive osteogenesis imperfecta type XII (MIM #613849) (39). Similarly, three siblings with the same disease were reported with a homozygous c.946C>T variant (40). This results in missense change p.(Arg316Cys) within the first zinc finger of SP7, similar to the position of the missense variant in SP6 identified in this study (for reference, the equivalent SP6 residue is p.Arg276). It is notable that one of the heterozygous carrier parents also met the criteria for adult osteoporosis, suggesting that missense variants affecting this part of the protein may be sufficient to cause mild disease even when one WT copy is present. Rodent models of SP6 function include two murine SP6 null (Sp6−/−) lines (15,29) and a rat (Ami/Ami) with a frameshift mutation in the third zinc finger domain (NM_001108833.1: c.965_966insGT, NP_001102303: p.F323Sfs*12). The Sp6−/− mice show either total absence of enamel or secretion of a thin irregular enamel layer (29). The Ami/Ami rats have hypoplastic AI (28), a similar phenotype to that of the family presented here. The Sp6−/− mice also display a range of other phenotypes including delayed tooth eruption, supernumerary teeth, fused teeth, defective cusp formation, malformed roots and enlarged dentine tubules as well as retarded growth, failure to develop fur and abnormalities in limb development and lung alveolarization (15,29). The phenotype of the Ami/Ami rat model appears to be more restricted to enamel formation, although at birth, whiskers are curly and are weak throughout adulthood (28). Heterozygous Sp6+/− or Wt/Ami animal models do not display an AI phenotype, but Sp6+/− mice have been reported to have a wider enamel layer with an irregular and less compact structure than WT (15). SP6 has previously been highlighted as a candidate gene for human AI, although autosomal recessive inheritance was predicted based on the animal models (28). Based on the information from animal models, the mutation itself appears critical to the range of phenotypes seen and their severity. The missense variant reported here may not be accurately modelled by the Sp6−/− mouse or the Ami/Ami rat. It is also possible that a gain of function may occur if DNA binding specificity or ability is altered by the p.Ala273Lys substitution, as it does appear to be from SPR studies. Studies of Sp6−/− mice suggest that the function of SP6 in amelogenesis is dependent upon the developmental stage. Firstly, SP6 promotes proliferation of the IEE, and secondly, it stimulates the differentiation of these cells to form ameloblasts (15). One murine Sp6 transcript (NM_031183) has been detected in the posterior neuropore, the apical epidermal ridge of limb buds and in teeth and hair follicles of murine embryos but not in adult tissues (41), suggesting that the function of this SP6 transcript may be entirely developmental. The expression of the other murine transcript, NM_001363230, which codes for an identical protein, has been described as ubiquitous (31) although an antisense transcript has also been detected, which may serve to regulate expression levels, so that embryonic expression of the protein is significantly higher than in the adult. Unfortunately, no relative quantification of the three transcripts’ expression levels in embryonic dental tissues has been demonstrated to date, meaning that it is unclear whether SP6 is expressed in adult tissues. Our attempts to examine the effect of the mutation on the binding of SP6 to its target sequences have been hampered by lack of knowledge of the sequences SP6 binds within its target proximal promoter regions. Literature searching showed that SP6 probably binds GC rich motifs such as GC boxes, and SPR studies supported this. Of the motifs tested, the AMBN proximal promoter sequence was most strongly bound. The binding for the ROCK1 and CA3 promoter sequences was much lower in comparison, perhaps suggesting that the proximity of other GC rich sequences or the surrounding sequence context affects binding efficiency. In addition, the lack of GC-rich sequence in the AMTN proximal promoter region suggests that there might be additional sequence motifs to which SP6 binds or that it might influence expression through other intermediates. The AMBN promoter sequence was most strongly bound by WT SP6. In comparison, mutant SP6 protein also bound the oligonucleotide sequence but less strongly and it dissociated faster than the WT protein. This indicates that while binding was affected by the variant, its negative effect may be relatively mild. Given the likely pleiotropic effect of a more damaging variant on the action of a transcription factor involved in development of multiple tissues and organs such as SP6, this may explain why further variants in SP6 causing AI or other human phenotypes have not been reported to date. A more damaging variant may not be compatible with life. Interrogation of gnomAD identified only 9 high quality loss of function variants in 10 individuals, with the highest reported allele frequency being 1.549 × 10−5. Only three missense variants, (p.Thr77Asn, p.His159Tyr and p.Glu337Gln) were reported to have been identified as homozygous, each in only one individual. None of these variants are within the three zinc fingers domains, again highlighting the importance of these domains to SP6 function. Results from the SPR study suggest a mechanism by which the c.817_818GC>AA SP6 variant may cause AI. Reduced binding of mutant SP6 to the AMBN proximal promoter sequence in vivo could reduce the transcription of AMBN during amelogenesis, resulting in less AMBN protein present in the enamel matrix. Perturbation of AMBN levels has been shown to affect the levels of other proteins important in amelogenesis, for example, MSX and AMELX (42) and to affect ameloblast adhesion to the extracellular matrix (43). These alterations are known to result in hypoplastic AI. Other SP6 transcriptional targets, in addition to AMBN, may also be affected. Investigation of the effects, of either the rat or murine Sp6 variants, on AMBN expression in developing tooth buds from these models could be useful in determining whether the location, timing or level of AMBN expression is altered. In conclusion, a missense variant in SP6 has been found to segregate with AI in a family with autosomal dominant inheritance. Given the prior evidence for the role of SP6 in amelogenesis, the phenotype observed in three rodent models and our data on the impact of this variant on binding to a likely target DNA sequence of a known AI disease gene encoding a protein critical for correct enamel formation, we suggest that this missense variant is almost certainly the causative variant in the family described here. Nevertheless, this finding would benefit from replication in other cohorts, making SP6 a strong candidate gene for further screening in AI. However, we further hypothesize that the relatively mild effect of the missense variant shown in this study is sufficient to cause AI but not so severe as to be incompatible with life, which may explain why SP6 variants are rare as a cause of AI.

Materials and Methods

Patients

Affected individuals and family members were recruited following informed consent in accordance with the principles outlined by the declaration of Helsinki, with local ethical approval. Genomic DNA samples were obtained using Oragene® DNA sample collection kits (DNA Genotek, ONT, Canada) according to the manufacturer’s instructions.

WES and analysis

Three micrograms of genomic DNA were processed according to the Agilent SureSelect XT Library Prep protocol (Agilent Technologies, CA, USA). Sure Select Human All Exon V5 or V6 (Agilent Technologies) was used as the capture reagent. Sequencing was performed using a 150 bp paired-end protocol on an Illumina HiSeq 3000 sequencer (4981 and 4982) (Illumina, CA, USA). The resulting fastq files were aligned to the human reference genome (GRCh37) using BWA (44). The alignment was processed according to GATK best practice. Exome depth was used for CNV analysis according to the developers’ guidelines (22). All genomic coordinates are based on the GRCh37 human reference genome. The reference gene sequence upon which SP6 mutation nomenclature is based is RefSeq transcript NM_199262. The variant identified in this study has been submitted to the Leiden Open Variant Database at http://dna2.leeds.ac.uk/LOVD/ variant ID: 0000000305.

Protein synthesis

The SP6 wild type and mutant (p.A273K) coding sequences were synthesized (GeneWiz, South Plainfield, NJ, USA) in pUC57 with codon optimization for E. coli expression and then PCR-amplified using Q5 DNA polymerase (NEB, Evry, France; 5′ primer: AAGTTCTGTTTCAGGGTACCATGCTGACCGCCGTTTGTGGC, 3′ primer: CTGGTCTAGAAAGCTTTTAATTGCTCGGGGCAACGC). Both were cloned into pOPINJ using the NEBulider HiFi assembly to produce constructs pOPINJ_SP6 and pOPINJ_SP6mut, each containing an N-terminal His-GST tag. pOPINJ_SP6 was transformed into BL21 (DE3) pLysS (Agilent Technologies, Santa Clara, CA, USA), grown in terrific broth (TB with 100 μg/ml ampicillin and 34 μg/ml chloramphenicol) to an OD600 of 0.6, induced with 0.4 mm IPTG and 10 μM ZnCl2 and incubated for 18 h at 27°C. Bacteria were harvested through centrifugation at 4000g for 40 min, the pellet resuspended into PBS + 1% Triton X-100 and the bacteria lysed using sonication (10 s on, 30 s off, for 10 bursts at amplitude 60%). The soluble lysate was purified on an AKTA Pure (GE Healthcare, Little Chalfont, UK) using nickel affinity chromatography with a HisTrap HP 5 ml column into His elution buffer (20 mm Tris, 150 mm NaCl, 5% glycerol and 400 mm imidazole, pH 7.6) using a gradient elution. His-GST-SP6 was further purified through ion exchange on a HiTrapQ HP 1 ml column and eluted with a gradient elution in 10 mm HEPES, 1 M NaCl, pH 7.5. Resulting elutions were concentrated in a Pierce protein concentrator (10 K MWCO), and the concentrated protein was aliquoted, frozen in liquid nitrogen and stored at −80°C. pOPINJ_SP6mut was transformed into ArcticExpress (DE3) cells (Agilent Technologies) and grown in TB (with 100 μg/ml ampicillin and 50 μg/ml gentamicin) for 3 h at 30°C. Cultures were then equilibrated for 10 min at 12°C prior to induction with 0.4 mm IPTG and 10 μM ZnCl2 and incubated for 24 h at 12°C. Bacteria were harvested through centrifugation at 4000g for 40 min, and then the pellet was resuspended into lysis/wash buffer (50 mm Tris, 300 mm NaCl, 20 mm imidazole, 5% glycerol, pH 7.6). The bacteria were lysed using sonication as before. The soluble lysate was purified using Ni2+ NTA agarose beads into His elution buffers with varying imidazole concentration using a step elution. Soluble His-GST-SP6mut protein was identified at 80 and 160 mm imidazole and pooled. His-GST-SP6mut was further purified through ion exchange on a HiTrapQ HP 1 ml column and eluted with a gradient elution in 10 mm HEPES, 1 M NaCl, pH 7.5. Resulting elutions were concentrated in a Pierce protein concentrator (10 K MWCO), and the concentrated protein was aliquoted, frozen in liquid nitrogen and stored at −80°C.

DNA probe preparation

Four probes were designed for protein-DNA interaction studies using SPR. Single forward strand DNA molecules were synthesized and biotinylated (Sigma–Aldrich) on the 5′-end (Supplementary Table S8). Reverse complementary strands were synthesized without biotinylation. DNA oligos were dissolved at 100 μM in TE buffer. Single-strand biotin-labelled and non-biotin-labelled DNA oligos were diluted in TM buffer [10 mm Tris (pH 7.5) and 10 mm MgCl2] to a final concentration of 10 μM, annealed at 95°C for 1 min and cooled slowly to room temperature. Annealed DNA probes were kept at −20°C before use.

Surface plasmon resonance

SPR experiments were performed on a Biacore 3000 instrument (GE Healthcare). Biotinylated DNA probes at 10 nM were immobilized on streptavidin (SA) sensor chips (GE Healthcare) at a flow rate of 5 μL/min, to give ∼500 response units (RU) of immobilized DNA. The reference flow cell was underivatized. All ligand immobilization was done in HEPES-buffered saline consisting of 10 mm HEPES (pH 7.5), 200 mm NaCl and 0.01% (v/v) surfactant P-20. Analyte measurements were carried out at 25°C and a flow rate of 40 μL/min, using the same buffer. For SP6–DNA-binding assays, 120 μL of IEX-purified SP6 (WT or p.A273K) was injected across flow-cell surfaces in a two-fold ascending concentration series, from 6.25 to 400 nM for 3 min. Subsequently, buffer was washed over the surfaces to observe the dissociation rates of the DNA-protein complexes. The chip surface was regenerated between protein injections with a 40 μL 0.05% (w/v) SDS injection. Binding data were processed using double-referencing by subtraction of signals from a reference flow cell and by subtraction of a buffer injection over each derivatized flow cell. Binding data were analyzed using BIAevaluation 3.1 software (GE Healthcare). Click here for additional data file.
  41 in total

1.  A novel DNA element mediates transcription of Nkx2.1 by Sp1 and Sp3 in pulmonary epithelial cells.

Authors:  C Li; X Ling; B Yuan; P Minoo
Journal:  Biochim Biophys Acta       Date:  2000-02-29

2.  Recognition of DNA by Cys2,His2 zinc fingers.

Authors:  R E Klevit
Journal:  Science       Date:  1991-09-20       Impact factor: 47.728

3.  Genetic variability of the gene cluster CALHM 1-3 in sporadic Creutzfeldt-Jakob disease.

Authors:  Olga Calero; María J Bullido; Jordi Clarimón; Rafael Hortigüela; Ana Frank-García; Pablo Martínez-Martín; Alberto Lleó; María Jesús Rey; Isabel Sastre; Alberto Rábano; Jesús de Pedro-Cuesta; Isidro Ferrer; Miguel Calero
Journal:  Prion       Date:  2012-08-09       Impact factor: 3.931

4.  Epiprofin orchestrates epidermal keratinocyte proliferation and differentiation.

Authors:  Takashi Nakamura; Yasuo Yoshitomi; Kiyoshi Sakai; Vyomesh Patel; Satoshi Fukumoto; Yoshihiko Yamada
Journal:  J Cell Sci       Date:  2014-10-24       Impact factor: 5.285

5.  The Krüppel-like factor epiprofin is expressed by epithelium of developing teeth, hair follicles, and limb buds and promotes cell proliferation.

Authors:  Takashi Nakamura; Fernando Unda; Susana de-Vega; Arnaldo Vilaxa; Satoshi Fukumoto; Kenneth M Yamada; Yoshihiko Yamada
Journal:  J Biol Chem       Date:  2003-10-08       Impact factor: 5.157

6.  Amelogenesis imperfecta: prevalence and incidence in a northern Swedish county.

Authors:  B Bäckman; A K Holm
Journal:  Community Dent Oral Epidemiol       Date:  1986-02       Impact factor: 3.383

7.  Genetic association between CALHM1, 2, and 3 polymorphisms and Alzheimer's disease in a Japanese population.

Authors:  Nobuto Shibata; Bolati Kuerban; Miwa Komatsu; Tohru Ohnuma; Hajime Baba; Heii Arai
Journal:  J Alzheimers Dis       Date:  2010       Impact factor: 4.472

8.  CALHM3 Is Essential for Rapid Ion Channel-Mediated Purinergic Neurotransmission of GPCR-Mediated Tastes.

Authors:  Zhongming Ma; Akiyuki Taruno; Makoto Ohmoto; Masafumi Jyotaki; Jason C Lim; Hiroaki Miyazaki; Naomi Niisato; Yoshinori Marunaka; Robert J Lee; Henry Hoff; Riley Payne; Angelo Demuro; Ian Parker; Claire H Mitchell; Jorge Henao-Mejia; Jessica E Tanis; Ichiro Matsumoto; Michael G Tordoff; J Kevin Foskett
Journal:  Neuron       Date:  2018-04-19       Impact factor: 17.173

9.  JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework.

Authors:  Aziz Khan; Oriol Fornes; Arnaud Stigliani; Marius Gheorghe; Jaime A Castro-Mondragon; Robin van der Lee; Adrien Bessy; Jeanne Chèneby; Shubhada R Kulkarni; Ge Tan; Damir Baranasic; David J Arenillas; Albin Sandelin; Klaas Vandepoele; Boris Lenhard; Benoît Ballester; Wyeth W Wasserman; François Parcy; Anthony Mathelier
Journal:  Nucleic Acids Res       Date:  2018-01-04       Impact factor: 16.971

10.  A robust model for read count data in exome sequencing experiments and implications for copy number variant calling.

Authors:  Vincent Plagnol; James Curtis; Michael Epstein; Kin Y Mok; Emma Stebbings; Sofia Grigoriadou; Nicholas W Wood; Sophie Hambleton; Siobhan O Burns; Adrian J Thrasher; Dinakantha Kumararatne; Rainer Doffinger; Sergey Nejentsev
Journal:  Bioinformatics       Date:  2012-08-31       Impact factor: 6.937

View more
  5 in total

Review 1.  Bcl11b/Ctip2 in Skin, Tooth, and Craniofacial System.

Authors:  Marie-Thérèse Daher; Pedro Bausero; Onnik Agbulut; Zhenlin Li; Ara Parlakian
Journal:  Front Cell Dev Biol       Date:  2020-12-10

2.  A Novel De Novo SP6 Mutation Causes Severe Hypoplastic Amelogenesis Imperfecta

Authors:  Youn Jung Kim; Yejin Lee; Hong Zhang; Ji-Soo Song; Jan C-C Hu; James P Simmer; Jung-Wook Kim
Journal:  Genes (Basel)       Date:  2021-02-26       Impact factor: 4.096

Review 3.  Transcriptional Regulation of Dental Epithelial Cell Fate.

Authors:  Keigo Yoshizaki; Satoshi Fukumoto; Daniel D Bikle; Yuko Oda
Journal:  Int J Mol Sci       Date:  2020-11-25       Impact factor: 5.923

4.  An Msx2-Sp6-Follistatin Pathway Operates During Late Stages of Tooth Development to Control Amelogenesis.

Authors:  Intan Ruspita; Pragnya Das; Yan Xia; Sarah Kelangi; Keiko Miyoshi; Takafumi Noma; Malcolm L Snead; Rena N D'Souza; Marianna Bei
Journal:  Front Physiol       Date:  2020-10-26       Impact factor: 4.566

5.  Gingival inflammation, enamel defects, and tooth sensitivity in children with amelogenesis imperfecta: a case-control study.

Authors:  Camille Quandalle; Adrien Boillot; Benjamin Fournier; Pascal Garrec; Muriel DE LA Dure-Molla; Stephane Kerner
Journal:  J Appl Oral Sci       Date:  2020-09-28       Impact factor: 2.698

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.