Literature DB >> 32163505

High expression of Helicobacter pylori VapD in both the intracellular environment and biopsies from gastric patients with severity.

Rosario Morales-Espinosa1, Gabriela Delgado1, Luis-Roberto Serrano1, Elizabeth Castillo1, Carlos A Santiago1, Rigoberto Hernández-Castro2, Alberto Gonzalez-Pedraza1, Jose L Mendez1, Luis F Mundo-Gallardo3, Joaquín Manzo-Merino4, Sergio Ayala4, Alejandro Cravioto1.   

Abstract

Helicobacter pylori is a Gram-negative bacterium that causes chronic atrophic gastritis and peptic ulcers and it has been associated with the development of gastric adenocarcinoma and mucosa-associated lymphoid tissue (MALT). One of the more remarkable characteristics of H. pylori is its ability to survive in the hostile environment of the stomach. H. pylori regulates the expression of specific sets of genes allowing it to survive high acidity levels and nutrient scarcity. In the present study, we determined the expression of virulence associated protein D (VapD) of H. pylori inside adenocarcinoma gastric (AGS) cells and in gastric biopsies. Using qRT-PCR, VapD expression was quantified in intracellular H. pylori-AGS cell cultures at different time points and in gastric mucosa biopsies from patients suffering from chronic atrophic gastritis, follicular gastritis, peptic ulcers, gastritis precancerous intestinal metaplasia and adenocarcinoma. Our results show that vapD of H. pylori presented high transcription levels inside AGS cells, which increased up to two-fold above basal values across all assays over time. Inside AGS cells, H. pylori acquired a coccoid form that is metabolically active in expressing VapD as a protection mechanism, thereby maintaining its permanence in a viable non-cultivable state. VapD of H. pylori was expressed in all gastric biopsies, however, higher expression levels (p = 0.029) were observed in gastric antrum biopsies from patients with follicular gastritis. The highest VapD expression levels were found in both antrum and corpus gastric biopsies from older patients (>57 years old). We observed that VapD in H. pylori is a protein that is only produced in response to interactions with eukaryotic cells. Our results suggest that VapD contributes to the persistence of H. pylori inside the gastric epithelial cells, protecting the microorganism from the intracellular environment, reducing its growth rate, enabling long-term infection and treatment resistance.

Entities:  

Year:  2020        PMID: 32163505      PMCID: PMC7067408          DOI: 10.1371/journal.pone.0230220

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Helicobacter pylori infection is the most common chronic infection around the world, since different epidemiological studies have shown that approximately 50% of the human population is infected with the bacterium [1]. However, the development of gastric disease is the result of many years of persistent H. pylori infection (colonization) in the gastric mucosa, where it alters the production of gastric hormones, affecting the gastric physiology and producing structural damage of the gastric cells. H. pylori has been associated with different gastric pathologies, such as chronic gastritis, gastric atrophy, follicular gastritis, duodenal ulcers, gastric ulcers, intestinal metaplasia, dysplasia, gastric adenocarcinoma (GAC) and gastric lymphoma MALT [2]. H. pylori colonization induces an inflammatory response; however, the microorganism uses mechanisms to protect itself from the immune response and from being eliminated from the gastric mucosa, thereby allowing long-time persistence. Various virulence factors are associated with gastric pathologies, such as a vacuolizing cytotoxin (VacA), the cytotoxin-associated gene A (CagA), the cag pathogenicity island and outer-membrane proteins (OMPLA, BabA, OipA) [3]. However, the prevalence of these virulence factors is diverse among H. pylori strains and between isolates from different geographic areas and ethnic groups [4]. This variability is due to the fact that H. pylori is a microorganism with high genetic diversity at both the gene and chromosomal levels. For example, although the vacA gene, is a structural gene that is present in all H. pylori strains, there is only a 65% nucleotide sequence identity between the vacA gene of cytotoxin-negative and cytotoxin-positive strains, and approximately 50% of strains contain an active toxin for inducing vacuolation of epithelial cells [5]. The cag pathogenicity island (cag-PAI) also has a variable structure and a different chromosomal arrangement; in some strains it presents as a single uninterrupted unit, or can be divided into two regions by IS605 (cagI and cagII), be split into cagI and cagII by a large segment of chromosome, or it can consist of partially deleted segments of cagI, cagII or both [6]. Another distinctive hallmark is the presence of strain-specific genes [7,8], which are found within plasticity zones where the highest diversity among H. pylori strains can be seen. In addition to vacA and cag-PAI, there is a specific genetic locus, which is only carried by a proportion (from 36% to 61%) of strains. This genetic locus is an ORF related to virulence-associated protein D (vapD) and located 3.5 kb downstream from the vacA gene in H. pylori strain 60190 [9]. However, this ORF is located in a different place in the strain 26695 (HP0315), while it is truncated in the strain J99 [10]. vapD has been found in other microorganisms of different phyla and although its function is unknown, it has been attributed to the survival of Rhodococcus equi, and Haemophilus influenzae into macrophages and epithelial cells [11-16]. One strategy of some microorganisms to persist in an intracellular niche is to avoid the phagolysosome fusion. It is well documented that some strains of H. pylori invade the gastric mucosa cells and can persist for an undetermined time. This phenomenon has clinical implications, which can lead to chronic and/or recurring infection, as well as to treatment resistance. The molecular mechanisms for which H. pylori can invade, replicate and persist in epithelial cells are not well known. However, these processes include at least four steps: a) the quick mobility of H. pylori from the lumen to the gastric mucosa; b) the adherence of H. pylori to the surface of gastric mucosa epithelial cells via outer membrane proteins; c) cellular invasion of H. pylori and finally, d) envelopment of H. pylori by double-layer membrane vesicles following invasion. However, whether H. pylori persists inside the cells for a long time or is killed outside the cells by lysosomal killing mechanisms 24 hours after invasion remains a controversial topic [4,17]. Studies have reported that H. pylori can survive inside phagocytic cells, inhibiting phagosome maturation by urease-derived ammonia pathways and thereafter, enhancing the activity of VacA secreted by intraphagosomal bacteria [18]. Results of a recent study suggest that H. pylori uses a similar strategy to survive inside gastric epithelial cells. Nevertheless, only a small portion of H. pylori strains are intracellular. Type I H. pylori strains use their virulence factors to induce a chronic neutrophil-rich inflammatory response, in which factors, such as CagA and VacA, participate in the adhesion and internalization of the bacteria within phagocytic and epithelial cells [18]. Meanwhile, type II strains induce much less inflammation and in turn, a markedly reduced phagocytic influx, hence intracellular survival is not essential for type II H. pylori [18]. Rhodococcus equi is a Gram-positive bacterium and a facultative intracellular pathogen, which causes pneumonia in young foals. R. equi has a virulence plasmid, where a cassette of genes (vapA-vapH) are present, when the microorganism is subjected to oxidative or acidic stress, vapA, vapD and vapG genes are highly expressed. R. equi is highly resistant to hydrogen peroxide, which may affect the maturation process of the phagosome within macrophages, and in contrast to VapA and VapG, the VapD expression may be highly induced inside the macrophage [13,14]. Non-typeable Haemophilus influenzae (NTHi) is a common commensal of the upper respiratory tract. As well as being a significant cause of respiratory tract infections in humans, it also penetrates human respiratory cells (epithelial cells and macrophages). During infections of otitis media caused by NTHi, various stress stimuli, such as nutrient deprivation, antibiotics, and reactive-oxygen species encountered by the bacteria, may result in the activation of vapD, which forms part of the toxin-antitoxin module (vapXD), leading to the arrested growth of the bacteria in epithelial cells. vapD mutations have shown reduced NTHi persistence in a chinchilla model for otitis media [16]. Although, the vapD gene has been described in many other microorganisms of different gender and phyla, its specific role remains unclear. Kwon et al., [19] determined the structural and biochemical characteristics of H. pylori VapD and found that this protein displayed a purine-specific endoribonuclease activity, which later showed to be structurally related to the Cas2 proteins, but unlike H. influenzae vapD gene, in H. pylori the vapD gene, did not belong to a TA system [19]. Studies have shown the expression of virulence factors, transcriptional regulators and different proteins of Helicobacter pylori under different developmental conditions [20,21]. However, there are no previous studies documenting the expression of VapD in H. pylori at the intracellular environmental level nor in gastric biopsies from patients with different gastric pathologies. In the present work, we revealed that vapD is expressed in the intracellular environment and in gastric mucosa cells (in vivo); vapD presents high expression levels in severe gastric pathologies, which varied between patients of different ages, suggesting that vapD is participating in the chronicity of gastric infection.

Materials and methods

H. pylori-AGS cells co-culture

Human gastric adenocarcinoma cell lines (AGS [ATCC® CRL-1739]) were grown in Dulbecco´s Modified Eagle Medium (DMEM, Life Technologies®), supplemented with 5% fetal bovine serum (FBS, Corning Costar) and antibiotics. The AGS cells were incubated in 5% CO2 atmosphere until 80% confluency was reached and then were distributed in 12 well plates. H. pylori strain 26695 (ATCC 700392) was grown in blood agar plates (BAP) supplemented with 5% fetal bovine serum in microaerobic conditions for 48 hours. AGS cells (3.2X105) with fresh DMEM were inoculated with H. pylori strain 26695 (vapD +) to a 3.2X107concentration of H. pylori. All of the resulting co-cultures were incubated in a CO2 atmosphere for 6 hours (t0). Following incubation, each co-culture was inoculated with 200 μg/ml of gentamycin and incubated for an additional time of 6 hours (t1). After the second incubation, DMEM was removed from intracellular H. pylori-AGS cells (cellular package), thereby discarding any microorganism that did not enter the AGS cells. The cellular packages were supplemented with fresh DMEM and maintained for 108 hours, with the medium being changed every 48 hours with fresh DMEM until the total number of hours established for the assay was reached. Each cellular package was treated separately at different time points [6-h (t0), 12-h (t1), 24-h (t2), 36-h (t3), 48-h (t4), 60-h (t5), 72-h (t6), 84-h (t-7), 96-h (t8) and 108-h (t9)]. At each time point, the cellular package (intracellular H. pyloriAGS cells) was separated from the DMEM. The cellular package was treated with 0.1% saponin in 1 ml PBS for 15 min. Saponin was used to permeabilize AGS cell membranes by penetrating the cholesterol monolayer and forming holes or pits allowing H. pylori to exit from the AGS cell. 50 μl of each sample (cellular package and DMEM) were plated on BAP supplemented with 5% fetal bovine serum and incubated in microaerobic conditions for 48 hours to determine the colonies forming unit (CFU) count. The results obtained from DMEM and the cellular package at time t1 (12 hours post-infection and treated with gentamycin) were taken as negative and positive controls for H. pylori growth and invasion, respectively. In addition, H. pylori invasion was confirmed by Immunofluorescence and Western blot assays. The vapD transcription levels were obtained by qRT-PCR, confirming that H. pylori maintained its metabolic activity into intracellular niche. All assays were performed in triplicate at each time point.

Immunofluorescence assay

Each cellular package was immunostained. The AGS cells were fixed in 3.7% formaldehyde and PBS at room temperature for 30 min, and later washed three times with PBS. The cells were permeabilized by incubating in 0.25% (vol/vol) Triton X-100 in PBS for 20 min and then blocked for 30 min with 5% milk in PBS (vol/vol), at room temperature. Following washing three more times, an antibody mixture: containing mouse anti-H. pylori antibodies (Biocare Medical®) at 1:500 dilution and rabbit anti-β-tubulin antibody (Biocare Medical®) at 1:500 dilution was added. The AGS cells with antibody mixture were incubated at 4°C overnight. Following extensive washing, the mixture was incubated with Alexa 568 marked anti-mouse secondary antibody (Invitrogen®) and Alexa 488 marked anti-rabbit secondary antibody (Invitrogen®) at 1:1000 dilution at 4°C for a further 2 hours. Finally, we used DAPI (4´, 6-diamino-2-phenilindol) stain to visualize the AGS cell nucleus. The samples were observed using confocal microscopy.

Western blot

Total protein extraction was made from the cellular package and its DMEM (negative control of H. pylori presence) taken at different time points (6, 12, 24, 36, 48, 60, 72, 84, 96 and 108 hours). Intracellular H. pylori-AGS cell monolayers were washed three times with PBS and lysed by adding RIPA buffer 1X (Radio Immuno Precipitation Assay. BIOMAN Scientific CO., LTD) with a protease inhibitor (Complete, Rocher®) according to the manufacturer’s instructions. Protein concentration was determined by DC Protein Assay (BIO RAD) following the manufacturer’s instructions. Samples were loaded onto 10% SDS-PAGE gel and transferred to a 0.45μm PVDF immobilion Millipore® membrane. Western blotting was performed using mouse anti-H. pylori antibody (Biocare Medical®) at 1:500 dilution and anti-mouse secondary antibody (Jackson Immuno Research). The membrane was revealed using an EZ ECL kit (Biological industries®). Finally, the membrane was exposed on radiographic plates and revealed (Kodak®).

Total RNA extraction and detection of vapD and GAPDH genes’ transcription levels by qRT-PCR from intracellular H. pylori-AGS cells

Total RNA was isolated from the cellular package (intracellular H. pylori-AGS cells) at different time points using Hybrid-R™ (GeneAll Biotechnology Co., Ltd) according to the manufacturer´s instructions. The cellular package was harvested in 500 μl RiboEx™. The sample was homogenized using a 0.9 mm needle (20 gauge) and incubated at room temperature for 5 min. Following incubation 200 μl of chloroform were added and the sample was vigorously shaken for 15 sec and incubated at room temperature for 2 min. The sample was then centrifuged at 12,000 x g at 4°C for 15 min and the aqueous phase was transferred to a fresh tube. Equal volumes of RBI buffer were added to the sample and thoroughly mixed by inversion. The mixture was transferred to a mini column and centrifuged at 10,000 x g for 30 sec. The mini column was then washed twice, firstly with 500 μl SWI buffer and then with 500 μl RNW buffer. RNA was eluted from the column by adding 40 μl nuclease-free water followed by centrifugation at 10,000 x g for 1 min. Spectrophotometrical analysis was used to determine total RNA concentration using NanoDrop 2000 (Thermo Scientific®). Total RNA (1 μg) was reverse transcribed using a QuantiTect® Reverse Transcription Kit (QIAGEN®) according to the manufacturer´s instructions. The resulting cDNA was stored at -80°C. vapD and GAPDH mRNA levels were determined using real-time PCR a Step one plus Real-Time PCR System (Applies Biosystems®). cDNA was denatured at 94°C for 2 min and then subjected to 30 cycles of annealing at 94°C for 15 s and extension at 60°C for 1 min. The vapD gene was amplified using specific primers, previously documented by Cao and Cover [9]. A (TaqMan) FAM-AGAGCGTTTAAGGTAGAGGACTTTAGCGA probe, which was designed in our laboratory, was also used to detect vapD. For GAPDH detection, we used a Real-Time PCR TaqMan® by Life Technologies GAPDH control. The RT-PCR mix had a total volume of 25 μl using iQ™ Multiplex Powermix (BIO-RAD). Transcription levels of GAPDH were used as normalization values and as endogenous controls. The vapD transcription level at t1 (12 hours post-infection) was used as our calibrator and reference for 100% expression of the H. pylori vapD gene in the intracellular environment. Relative vapD gene expression was calculated using the 2-ΔΔCt method [22]. Each assay was performed in triplicate.

Clinical sample

A total of 82 gastric biopsy samples (41 antrum and 41 corpus) were taken from 41 patients: 23 women and 18 men whose ages ranged from 18 to 92 years with a median of 74 years. The patients were being treated in three different hospitals, namely, the gastroscopy service at the Manuel Gea González General Hospital and the Hospital Angeles del Pedregal both of which are located in Mexico City, and the gastro-endoscopy service at a private clinic located in Puerto Escondido, Oaxaca, Mexico. The criteria used to select patients were a previous clinical diagnosis of functional dyspepsia and gastric morphological alteration, at the time of endoscopy. All patients had received previous diagnosis of a gastric pathology associated with H. pylori: cancer (four), peptic ulcer (nine), follicular gastritis (six), chronic atrophic gastritis (nineteen); and three patients with gastric pathology, which was not determined. Written, informed consent was obtained from all patients. Additionally, RNA from H. pylori 8822 (ATCC 51932; this strain is vapD negative) was used as a negative control for transcription. The endoscopies involved two biopsy samples being taken from adjacent areas of the gastric antrum and gastric corpus; the samples were immediately stored in RNA-later medium (Ambion) and kept at 4°C until RNA extraction.

Ethics statement

The protocol was approved by the ethics commission from each hospital and the Faculty of Medicine with the 055/2014 number at the Universidad Nacional Autónoma de México (UNAM).

RNA extraction from gastric biopsy

Tissue samples were transferred from RNA-later medium to new tubes and lysed in tissue grinder with 500 μl of RiboEx™, using Hybrid-R™ (GeneAll Biotechnology Co., Ltd) according to the manufacturer´s instructions. The RNA extraction protocol is described in the section above.

Detection of vapD, vacA and GAPDH genes’ transcription levels by RT-PCR from gastric biopsy

Detection of transcription levels of the vapD and GAPDH genes were performed as described above. The vacA gene was used as an internal control of H. pylori gene transcription since vacA is a constitutive gene of H. pylori which is always transcribed, independent of the allele presented. Specific primers for qRT-PCR amplification and detection of the vacA gene were designed in our lab: vacA forward: ATGGAAATACAACAAACACACC; vacA reverse: CCAACAATGGCTGGAATGA and probe VIC-ACTTTGTTGCGGTGTGATGCTGAC. All samples were produced in triplicate.

Statistical analysis

Comparisons were performed using one-way analysis of variance (ANOVA) and subsequent t-tests. Additionally, we applied U of Mann Whitney and Kruskall Wallis tests were applied.

Results

We performed co-cultures of H. pylori-AGS cells and incubated over different time points (6-h (t0) 12-h (t1), 24-h (t2), 36-h (t3), 48-h (t4), 60-h (t5), 72-h (t6), 84-h (t-7), 96-h (t8) and 108-h (t9)]. After the first 6 hours of incubation, gentamycin was added, leaving the antibiotic to work for an additional time of 6 hours (t1, 12 hours post-infection). After each time point, the cellular package (intracellular-H. pylori- AGS cells) was separated from the DMEM and both were analyzed independently to determine the CFU count on blood agar plates. In addition, Western blot was performed to detect a specific heat shock protein of H. pylori with a molecular size of 70 kDa. The cellular package was treated with saponin to allow releasing of H. pylori from AGS cells. At each 12 hours interval, intracellular viability and persistence of H. pylori inside AGS cells were determined. In addition, the vapD transcription levels of H. pylori in the intracellular environment were measured using qRT-PCR. All assays were performed in triplicate. To determine the viability of H. pylori inside AGS cells, the CFU counts from all samples at different time points were obtained. 50 μl of DMEM (negative control) and cellular package (pre-treatment and post-treatment with gentamycin) treated with saponin were plated on BAP supplemented with 5% fetal bovine serum and incubated in microaerobic conditions for 48 hours. At time t0 (co-culture pre-gentamycin treatment) were recuperated a 1.09X106 concentration of intracellular H. pylori and a 1.36 x 106 concentration of extracellular H. pylori (from DMEM). From the co-cultures at t1 to t9 (post-gentamycin treatment), H. pylori was obtained from the cellular package only (treated with saponin) but none was retrieved from DMEM, which confirms that H. pylori invaded the AGS cells and were eliminated from DMEM. From the co-cultures at t1 to t4 (approximately 48 hours post-infection), the number of CFUs counted was constant with approximately 485 CFUs at t1, 433 CFUs at t2, 596 CFUs at t3 and 537 CFUs at t4. At time t5 (60 hours), there was an increase in the CFU count (1300), suggesting that H. pylori had been replicated within the AGS cells. At t6 there was a decrease in the CFU count (482 CFUs), and at t7, the count decreased notably and continued to decrease up to only obtained 12 CFUs at t9. Despite the significant reduction in CFU counts from t5 to t9, the immunofluorescence assay confirmed that H. pylori remained viable within AGS cells, and vapD transcription levels were detected by qRT-PCR. To confirm that H. pylori was present only in the intracellular environment, we extracted total protein from both the cellular package and DMEM at the different time points. We performed a Western blot using mouse anti-H. pylori antibody, which detected a 70 kDa heat shock specific protein of H. pylori. In addition, we detected GAPDH using rabbit anti-GAPDH antibody as load control. Both the cellular package and DMEM samples at t0 (pre-gentamycin treatment) gave a positive signal with the mouse anti-H. pylori antibody, confirming the presence of H. pylori in both the intracellular (within AGS cells) and extracellular environments (DMEM). Nevertheless, from t1 to t9 time points (post-gentamycin and saponin treatment), detection of the heat shock protein using mouse anti-H. pylori antibody proved positive in samples from the cellular package but not from DMEM, indicating the exclusive presence of H. pylori in the intracellular environment (Fig 1).
Fig 1

Detection of a H pylori protein in the intracellular and extracellular environment.

A 70 kDa. specific heat shock protein was detected by Western blot using mouse anti-H. pylori antibody. Total protein extraction was made from the cellular package and its DMEM (negative control of H. pylori presence) taken at different time points: t0 (6 h of incubation, without gentamycin treatment), t1 (12-hours post-infection and treated with gentamycin), t2 (24-h), t3 (36-h), t4 (48-h), t5 (60-h), t6 (72-h), t7 (84-h) and t8 (96-h). D: Dulbecco´s Modified Eagle Medium; C: cellular package.

Detection of a H pylori protein in the intracellular and extracellular environment.

A 70 kDa. specific heat shock protein was detected by Western blot using mouse anti-H. pylori antibody. Total protein extraction was made from the cellular package and its DMEM (negative control of H. pylori presence) taken at different time points: t0 (6 h of incubation, without gentamycin treatment), t1 (12-hours post-infection and treated with gentamycin), t2 (24-h), t3 (36-h), t4 (48-h), t5 (60-h), t6 (72-h), t7 (84-h) and t8 (96-h). D: Dulbecco´s Modified Eagle Medium; C: cellular package. In order to identify the location of H. pylori within the AGS cells, we performed immunofluorescence assays in all cell packages that had been infected with H. pylori and monitored them by confocal microscopy at different time points (from 6 hours up to 108 hours post-infection). Each cellular package was immunostained using an antibody mixture: mouse anti-H. pylori antibody (red), which was visualized using the 561 nm laser line of the Leica TCS SP5 confocal microscope at full power; rabbit anti-β tubulin antibody (green), which was visualized using the 488 nm laser line of the Leica TCS SP5 confocal microscope at full power; and DAPI (blue) to visualize the AGS cell’s nucleus using the UV351-364 nm laser line of the Leica TCS SP5 confocal microscope at full power. Fluorescence and differential interference contrast images were obtained (Fig 2a). A three-dimensional image was created using the LAS AF software. The extracellular and intracellular H. pylori locations were visible in the first 6 hours post-infection (t0, without gentamycin). After 12 hours (t1, post-gentamycin treatment), we observed that H. pylori began to acquire different morphological forms such as bacillary, spiral and coccoid shapes within the AGS cells. The majority of the bacteria were localized near the nucleus, and a large reduction in the AGS cell cytoplasm was observed (Fig 2b). At 24 hours (t2), the formation of vacuoles in the cytoplasmic space of the AGS cells began to be observed (Fig 2c), although H. pylori could not be seen inside the large vacuoles. Throughout the assay, the bacillary form persisted although in lesser number, while the coccoid form of H. pylori increased in number (Fig 2a), as seen in the low CFU count. We now know that the conversion of H. pylori from bacillary to coccoid form can be induced when the bacterium is subjected to stress and this change in form coincides with it acquiring a viable non-cultivable state.
Fig 2

Observation of the location of H. pylori within the AGS cells for immunofluorescence assays and confocal microscopy.

2a. Images of noninfected AGS control cells are shown in the first two columns. The first row shows the different locations of H. pylori within AGS cells at different time points: t0 (6 hours post-infection and pre-gentamycin treatment); t1 (12-h [hours]); t2 (24-h); t3 (36-h); t4 (48-h); t5 (60-h); t6 (72-h); t7 (84-h); t8 (96-h) and t9 (108-h) post-infection and post-gentamycin treatment using a Leica TCS SP5 confocal microscope. In the second row, Helicobacter pylori is visualized using mouse anti-H. pylori antibody (red), which was visualized using the 561nm laser line. In third row, β-tubulin is visualized using rabbit anti-β tubulin antibody (green), which is observed using the 488 nm laser line. In the fourth row, the nucleus of AGS cells is visualized using DAPI (blue) and a UV351-364 nm laser line. b and c. Amplified images of AGS cells infected with intracellular H. pylori. In 2b, the coccoid form and bacillary form of H. pylori can be observed inside the AGS cells and a large reduction in the AGS cell cytoplasm is seen. In 2c, the formation of vacuoles in the cytoplasmic space of the AGS cells are observed but we could not visualize H. pylori inside the vacuoles.

Observation of the location of H. pylori within the AGS cells for immunofluorescence assays and confocal microscopy.

2a. Images of noninfected AGS control cells are shown in the first two columns. The first row shows the different locations of H. pylori within AGS cells at different time points: t0 (6 hours post-infection and pre-gentamycin treatment); t1 (12-h [hours]); t2 (24-h); t3 (36-h); t4 (48-h); t5 (60-h); t6 (72-h); t7 (84-h); t8 (96-h) and t9 (108-h) post-infection and post-gentamycin treatment using a Leica TCS SP5 confocal microscope. In the second row, Helicobacter pylori is visualized using mouse anti-H. pylori antibody (red), which was visualized using the 561nm laser line. In third row, β-tubulin is visualized using rabbit anti-β tubulin antibody (green), which is observed using the 488 nm laser line. In the fourth row, the nucleus of AGS cells is visualized using DAPI (blue) and a UV351-364 nm laser line. b and c. Amplified images of AGS cells infected with intracellular H. pylori. In 2b, the coccoid form and bacillary form of H. pylori can be observed inside the AGS cells and a large reduction in the AGS cell cytoplasm is seen. In 2c, the formation of vacuoles in the cytoplasmic space of the AGS cells are observed but we could not visualize H. pylori inside the vacuoles. In order to determine if the vapD gene is transcribed inside gastric cells, and to corroborate viability of H. pylori within AGS cells, we used qRT-PCR to measure the vapD gene transcription levels of H. pylori strain 26695 in the intracellular environment at different time points. In addition, we measured the vapD gene transcription level of H. pylori strain 26695 grown in LB medium. The vapD transcription level of H. pylori at 6 hours (t0) (post-infection without gentamycin) showed a -ΔΔCt 1.8966 value. This value corresponded to VapD expression of H. pylori present in both the extracellular and intracellular environments. The transcription level obtained at 12 hours (t1) post-infection, was taken as our reference value, which was assigned a value of 1.0. All the values obtained at the different time points were normalized against this reference value. We also took this value (1.0) as our reference value for 100% H. pylori VapD expression in the intracellular environment. Fig 3 details the vapD transcription levels at different time points (from t0 to t9) and shows that the VapD expression increased two-fold (from 1.460585 to 2.012828) in the first 36 (t3) hours of intracellular H. pylori infection; at 48 hours (t4), VapD expression decreased by 17% (0.832345) for below the basal value (t1). From 60 hours (t5) to 96 hours (t8) of intracellular H. pylori infection, VapD expression gradually increased from 1.2388716 to 2.262038 (by 126% higher than the reference value) (Fig 3). It is interesting to note that H. pylori VapD expression was increasing while it remained longer in the intracellular niche. A possible explanation for this is that H. pylori uses an increase in VapD expression as a protective mechanism against stress exerted by eukaryote cells, which also became under stress due to the depletion of nutrients from the cell culture medium. All values of vapD transcription levels of H. pylori were inversely proportional to the transcription levels values of GADPH, the latter was decreasing proportionally to the aging of the culture cells. The GADPH transcription levels increased only when the cell culture medium was changed by fresh medium (after of 36 hours). This observation suggests that when the AGS cells had consumed the nutrients from the culture medium, they became under stress and in turn exerted a greater stress on intracellular H. pylori, forcing to microorganism to increase the VapD expression levels to compensate the adverse events exerted by the intracellular niche. We also wanted to know if H. pylori VapD is expressed when the bacterium is grown in synthetic medium (extracellular niche). H. pylori strain 26695 was grown in LB medium and RNA was extracted. The results showed that no VapD expression levels were detected by qRT-PCT. These results support the idea that vapD is a gene that can be induced and is expressed when H. pylori comes into close contact with eukaryotic cells.
Fig 3

VapD expression levels of H. pylori strain 26695 inside AGS cells.

RNA was extracted from co-culture (intracellular H. pylori- AGS cells) at different times: t0 (6 hours post-infection and pre-gentamycin treatment); t1 (12-h [hours]); t2 (24-h); t3 (36-h); t4 (48-h); t5 (60-h); t6 (72-h); t7 (84-h); t8 (96-h) and t9 (108-h) post-infection and post-gentamycin treatment. VapD expression values were determined using qRT-PCR. At each time point, the CFU (Colonies Forming Unit) count is also given.

VapD expression levels of H. pylori strain 26695 inside AGS cells.

RNA was extracted from co-culture (intracellular H. pylori- AGS cells) at different times: t0 (6 hours post-infection and pre-gentamycin treatment); t1 (12-h [hours]); t2 (24-h); t3 (36-h); t4 (48-h); t5 (60-h); t6 (72-h); t7 (84-h); t8 (96-h) and t9 (108-h) post-infection and post-gentamycin treatment. VapD expression values were determined using qRT-PCR. At each time point, the CFU (Colonies Forming Unit) count is also given. Given that several reports [20,21,23-27] have previously described transcription levels of different proteins or virulence factors in response to H. pylori infection in vivo, and based on our results, we wanted to investigate if VapD expression occurs in gastric biopsies (in vivo) taken from patients with different severe gastric pathologies. We examined a total of 82 gastric biopsies: 41 from the gastric antrum and 41 from the gastric corpus from 41 patients with different diagnoses of cancer, peptic ulcer, follicular gastritis and chronic atrophic gastritis. We detected VapD expression levels from the gastric antrum and corpus in all patients, indicating that vapD-positive H. pylori strains were colonizing both anatomic sites and that VapD is expressed in vivo. The VapD expression levels detected from the antrum and from the corpus were very similar, with no significant difference between the two regions of stomach (S1 Table). However, when VapD expression levels were compared between the different pathologies, we found significant VapD expression in biopsies from the gastric antrum of patients with follicular gastritis (p = 0.029). In addition, our results showed that the over 57 years age group presented the highest VapD expression levels (p = 0.018) in both gastric antrum and corpus biopsies. It is likely that infection in these older patients had been acquired at an early age, persisting for many years following the initial infection. The significant VapD expression in these older subjects suggests that VapD is necessary to support the persistence of H. pylori in gastric cells for a long period of time and to maintain the chronicity of infection.

Discussion

In the present study, we found that H. pylori persisted in AGS cells maintaining an active metabolism for a long period of time, up to 108 hours. Although we observed vacuole formation after 24 hours post-infection in the AGS cell cytoplasm, H. pylori was not observed in the vacuoles, with the majority of the microorganisms being localized around the nucleus. Over time, coccoid forms became more evident, although the bacillary form persisted inside AGS cells, a phenomenon that was reflected in low CFU counts. However, the VapD expression did not change. H. pylori was mainly present in the gastric mucosa in a spiral-shaped form, but on aging the microorganism loses its typical spiral-shape and converts to a coccoid shape. Previous authors have referred to these forms as the C-shaped and U-shaped forms and they are the precursors to the coccoid form. These C-shaped and U-shaped forms of H. pylori are considered to be bacterial intermediates that favor survival transforming them into an inactive phase (dormancy) [28,29], due to adverse condition, as temperature or pH changes, use of antimicrobial drugs, prolonged fasting when cultivated, deficiency of nutrients, effects of antisecretory drugs, etc. [30]. In the dormant state, the bacteria lower their own metabolic activity, maintaining them for a long period of time without replicating. This phenomenon was first described in the 1940s, when Staphylococcal infections were seen to recur, even after extensive treatment with high doses of penicillin [31]. These types of bacteria are termed “persisters” and they have clinical implications on a number of infectious diseases, such as tuberculosis, syphilis, and typhoid fever, where the immune system proves ineffective, and a single surviving bacterium is capable of restarting an infection [32]. In some microorganisms, a molecular mechanism that has been implicated in this type of persistence is the toxin-antitoxin (TA) module, which consists of pairs of genes usually located in the same operon, in which one gene acts as a toxin and the other cancels out the toxin effect. The result of toxin activation is the arrest of cell growth, and the fluctuation in toxin levels above and below the threshold, which results in the coexistence of dormant and growing cells [33,34]. Many pathogenic bacteria known to enter dormant states have a plethora of TA genes. Under stressful environmental conditions, such as nutrient limitation or oxidative stress, TA modules are activated. At present, six types of TA modules have been described, of which, type II is prevalent in the bacteria [33,34]. In nontypeable Haemophilus influenzae (NTHi), a common commensal of the upper respiratory tract and a significant cause of respiratory tract infection in humans, the presence of two TA modules vapXD and vapBC has been described. Double deletion mutants in both TA modules showed attenuation of NTHi persistence in a chinchilla model of otitis media and in primary human respiratory epithelial tissue. NTHi vapD has been shown to display ribonuclease activity in vitro and both the vapBC-1 and vapXD TA loci were shown to maintain NTHi survival and virulence [16]. On the other hand, Rhodococcus equi vapD was shown to be involved in protecting the microorganism against the respiratory burst inside the macrophage, and VapD was overexpressed when R. equi was grown in acid conditions. It is known that R. equi plasmid-cured mutant for vapD loses the ability to survive in macrophages and fails to induce pneumonia in foals [13,14]. However, several studies emphasize the importance of VapD type proteins in bacteria pathogenesis. In H. pylori, there are few studies relating to vapD (HP0315) and the virulence of this microorganism. Kwon et. al. [19] made the structural and biochemical characterization of VapD (HP0315) in H. pylori strain 26695 and reported that it has purine-specific endoribonuclease activity. Although vapD (HP0315) is arranged as an operon with HP0316, which was found to be an antitoxin-related protein, HP0315 is not a component of the TA system. The authors concluded that HP0315 might be an evolutionary intermediate, which does not belong to a TA system. Three TA modules have been identified in H. pylori: HP0892-HP0893; HP0894-HP0895 and Hp0968-HP0967 [35-37]. Some authors have considered HP0315-HP0316 to be a TA module [37] but more research is needed to clarify if HP0316 is the antitoxin that inhibited the action of HP0315, in order to determine if the vapD (HP0315) gene participates in the persistence of H. pylori in gastric cells, and to identify the role of vapD in the pathogenesis of severe gastric disease and/or in chronic infection. In a previous study carried out by our group, in which we determined the phylogenic relationship of vapD (HP0315) of H. pylori with other vapD genes present in microorganisms of different phyla, we found that H. pylori vapD is closely related to the vapD of Rhodococcus equi (manuscript sent for publication). The results of the latter study led us to believe that vapD of H. pylori could have a similar role to vapD of Rhodococcus equi, which protects microorganisms inside the eukaryotic cells [13,14]. Our results in vivo showed that vapD expression in H. pylori (strain 26695) within AGS cells was maintained throughout the time of the study, with levels of VapD expression increasing up to two-fold at 36 (t3) and 96 (t8) hours, in relation to our reference value at 12 (t1) hours, maintaining its persistence inside the AGS cells. We believe that this large increment of VapD expression was an induced protection response against hostile conditions inside the gastric cell, which was necessary for the bacterium survives. We wanted to know if vapD of H. pylori strain 26695 grown in BAP (in vitro) was transcribed. Our results suggested that vapD is a gene capable of being induced and transcribed only when H. pylori comes into contact with gastric cells (human gastric mucosa and AGS cells) but it is not expressed when H. pylori is grown in culture medium, because it could not be necessary for its survival outside eukaryotic cell. These results agree with those previously reported by Graham et. al., [25], in which they showed that vapD was expressed by H. pylori in response to interactions with mammalian gastric mucosa but was not expressed when the bacterium was grown in vitro [25]. The vapD gene is a strain-specific gene contributing to higher genetic diversity of H. pylori. Its frequency is variable from 38% to 61% among strains depending on the study population; for example, Cao and Cover [9] reported a frequency of 61.3% between the H. pylori strains isolated from an American population. We previously reported that vapD gene had a frequency of approximately 38% among H. pylori strains isolated from Mexican patients, however, this frequency was higher (52%) when the results were obtained from patients colonized with vapD-positive strains since the majority of them presented a mixed infection with vapD-positive and vapD-negative strains [38]. Contrary to those previously results reported, in the present study we found that all patients expressed VapD in their gastric biopsies (in vivo). These results could be explained by the type of patients studied in the present study, who had severe gastric pathologies associated with H. pylori, although, there was significance in the VapD expression levels in gastric antrum from patients with follicular gastritis. Our results suggest that VapD could be considered a virulence factor, which favors H. pylori permanence for a long-time, thereby contributing to the development of severe lesions. One hypothesis would be that VapD favors the survival of H. pylori within the gastric cell, so that the infection becomes chronic for months or years until it progresses in a severe gastric disease, probably triggering a carcinogenesis process in the gastric epithelial cell. Furthermore, we found that the highest VapD expression levels were in patients above 57 years of age, it is probable that these patients have carried the H. pylori infection for many years. We know, that in countries like ours, the H. pylori infection is frequently acquired in childhood and most of the time the disease will develop in adulthood. Early childhood infection typically results in an extended length of infection and likely affords more opportunities for oncogenic mutations [39,40]. Therefore, we believe that vapD presence in H. pylori strains could be a genetic marker for chronicity. It is important to note, that in Mexico, mixed infection by different H. pylori genotypes is a common phenomenon, where different H. pylori strains colonize a single stomach [41-43]. Unfortunately, in the present work, we did not isolate individual colonies of H. pylori from gastric antrum neither from corpus, so that, we could not make a genotypic characterization of individual colonies. The frequency of vapD-positive and vapD-negative strains that colonized our patients in this study was unknown. However, the VapD expression levels detected in all the biopsies were high enough to believe that an important number of vapD-positive H. pylori strains were colonizing both gastric antrum and corpus in all patients. The impact of H. pylori virulence factors on the development of gastroduodenal diseases [3,23,24] is well documented. CagA is an oncoprotein, which is injected into host cells via a pilus structure called type IV secretion system (T4SS) encoded for cag-PAI [3,23,24]. VacA is a cytotoxin that induces vacuole formation in eukaryotic cells. Its activity is variable and is determined by changes in three regions of the vacA gene, leading to multiple alleles. Interestingly, the s1/i1/m1 type of vacA is often linked to cagA-positive strains [3,4,23,24], which are associated with a 4.8-fold risk of progression for precancerous lesions compared to those infected with cagA-negative/vacA s2/m2 strains. Therefore, none of the virulence markers can be considered an independent factor for disease outcome. In fact, when multiple virulence factors are present, the risk of severe clinical outcome is greater. However, the wide distribution of H. pylori strains of different genotypes, in different regions of the world and in different ethnic groups, leads to different gastric disease outcome. It supports the need for new virulence markers to identify type I H. pylori strains, which have been associated more frequently with severe gastric pathologies. An intracellular phenotype confers advantage to the microorganism by protecting against host defense mechanisms and against antimicrobial intervention, thereby favoring bacterial persistence and the chronicity of the infection. Preliminary mutational studies of the vapD gene in different microorganisms have shown that VapD participates in the persistence of microorganisms inside epithelial or phagocytic cells [13,14,16].

Conclusion

H. pylori vapD presented high transcription levels inside AGS cells increasing these levels up to two-fold above the reference value. Transcription of vapD did not occur when H. pylori was grown in synthetic (in vitro) conditions, confirming that VapD was produced in response to interactions with eukaryotic cells. H. pylori acquired a coccoid form inside AGS cells, but maintained high VapD expression levels, indicating an active metabolism. We suggested that VapD provides a protective mechanism for the bacterium inside gastric cells, allowing it to remain in a viable non-cultivable state. H. pylori VapD was expressed in gastric biopsies from patients with severe gastric pathologies, such as chronic atrophic gastritis, follicular gastritis, peptic ulcers and gastric cancer. However, higher VapD expression levels were found in gastric antrum from patients with follicular gastritis and in older patients for above 57 years of age. VapD contributes to the persistence of H. pylori inside the gastric epithelial cell, protecting the microorganism against hostile intracellular environment, and favoring the chronicity of infection over a long period of time. We believe that the vapD presence in H. pylori strains could be a genetic marker of chronicity. Further studies are required to determine the molecular mechanism of action of VapD protein and its interaction with other proteins. To elucidate if vapD is part of a toxin-antitoxin module and which is its antitoxin.

VapD expression of H. pylori from antrum and corpus biopsies of patients with severe gastric pathologies.

(XLSX) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. 10 Dec 2019 PONE-D-19-29061 High expression of Helicobacter pylori VapD in both the intracellular environment and human gastric biopsies from patients with severe gastric pathologies PLOS ONE Dear Dr Morales-Espinosa, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== The study is novel and of interest but must be reviewed for the english before being published ============================== We would appreciate receiving your revised manuscript by Jan 24 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Valli De Re, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 1. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript, the authors observed the cytological features of H. pylori infection on AGS cells. This paper also showed the expression pattern of a small virulence-associated protein VapD of H. pylori in AGS cells and in the biopsies of patients with different gastric diseases by qRT-PCR, and found that the VapD is only expressed in the interaction of H.pyori with eukaryotic cells, further, expressed much higher in the older patients. The results are very interesting, which should be helpful to understand the long persistence of H. pylori in human stomach. However, the unique issue before acceptation is the English editing. Here, I show some places that are necessary to improve their expression. 1. Title. “High expression of Helicobacter pylori VapD in both the intracellular environment and human gastric biopsies from patients with severe gastric pathologies”, suggested to be “High expression of Helicobacter pylori VapD in both intracellular environment and biopsies from gastric patients with severity”. 2. L30, “…intracellular H. pylori-AGS cells cultures at different time points and…”, suggested to be “…intracellular H. pylori-AGS cell cultures at different time points and…” 3. L33, “Our results show which vapD of H. pylori presented high transcription levels inside AGS cells that increased up to twofold…”, suggested to be “Our results show that vapD of H. pylori presented high transcription levels inside AGS cells, which increased up to twofold…” 4. L71, “…genetic diversity at both the gene and chromosomal level.” Changed to be “…genetic diversity at both the gene and chromosomal levels.” 5. L90, “fusion phagolysosome”, changed to “phagolysosome fusion”. 6. L92, “…clinical implications, in that it can lead to chronic…”, changed to “…clinical implications, which can lead to chronic…” Here, I just show the first section of the manuscript. I suggest the authors to check carefully the manuscript again. Some places contain grammatical errors. On the other hand, some expressions are better not to use assertive sentences because it is just a possibility. For example, L450, “…because it is not necessary for its survival outside eukaryotic cell”, better improving to be “…because it could not be necessary for its survival outside eukaryotic cell”. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 30 Jan 2020 1. We have eliminated from manuscript the phrase “data not shown” (line 309). It was substituted for the Figure 1, which show the results cited in the former paragraph. Response to Reviewers 1. With respect to the article title We are agree with the Review #1 about the article title, it is more convenient a title as: “ High expression of Helicobacter pylori VapD in both intracellular environment and biopsies from gastric patient with severity ” 2-6. We have reviewed the English grammar throughout the manuscript and the appropriate corrections have been made, which are indicated in red. Among them are those indicated by the reviewer on lines 30, 33, 71, 90, 92; which now correspond to lines 30, 32, 72, 91, 93 respectively. On the other hand, we also change all assertive expressions used in the manuscript, instead of it, we "suggest" or "propose" Submitted filename: Response to Reviewers.doc Click here for additional data file. 25 Feb 2020 High expression of Helicobacter pylori VapD in both the intracellular environment and biopsies from gastric patients with severity PONE-D-19-29061R1 Dear Dr. Morales-Espinosa, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Valli De Re, Ph.D. Academic Editor PLOS ONE 28 Feb 2020 PONE-D-19-29061R1 High expression of Helicobacter pylori VapD in both the intracellular environment and biopsies from gastric patients with severity Dear Dr. Morales-Espinosa: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Valli De Re Academic Editor PLOS ONE
  38 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Helicobacter pylori infection.

Authors:  Sebastian Suerbaum; Pierre Michetti
Journal:  N Engl J Med       Date:  2002-10-10       Impact factor: 91.245

3.  Host cell contact induces fur-dependent expression of virulence factors CagA and VacA in Helicobacter pylori.

Authors:  Rukhsana Chowdhury
Journal:  Helicobacter       Date:  2013-09-11       Impact factor: 5.753

4.  Bridging the gap between viable but non-culturable and antibiotic persistent bacteria.

Authors:  Mesrop Ayrapetyan; Tiffany C Williams; James D Oliver
Journal:  Trends Microbiol       Date:  2014-10-16       Impact factor: 17.079

5.  Strain-specific genes of Helicobacter pylori: distribution, function and dynamics.

Authors:  P J Janssen; B Audit; C A Ouzounis
Journal:  Nucleic Acids Res       Date:  2001-11-01       Impact factor: 16.971

6.  Identification of a virulence-associated protein homolog gene and ISRa1 in a plasmid of Riemerella anatipestifer.

Authors:  S Weng; W Lin; Y Chang; C Chang
Journal:  FEMS Microbiol Lett       Date:  1999-10-01       Impact factor: 2.742

Review 7.  Toxin-antitoxin systems in bacterial growth arrest and persistence.

Authors:  Rebecca Page; Wolfgang Peti
Journal:  Nat Chem Biol       Date:  2016-04       Impact factor: 15.040

8.  Diversity in protein synthesis and viability of Helicobacter pylori coccoid forms in response to various stimuli.

Authors:  H Mizoguchi; T Fujioka; K Kishi; A Nishizono; R Kodama; M Nasu
Journal:  Infect Immun       Date:  1998-11       Impact factor: 3.441

Review 9.  Tuberculosis: a problem with persistence.

Authors:  Graham R Stewart; Brian D Robertson; Douglas B Young
Journal:  Nat Rev Microbiol       Date:  2003-11       Impact factor: 60.633

10.  H(2)O(2), which causes macrophage-related stress, triggers induction of expression of virulence-associated plasmid determinants in Rhodococcus equi.

Authors:  Stephanie Benoit; Abdellah Benachour; Said Taouji; Yanick Auffray; Axel Hartke
Journal:  Infect Immun       Date:  2002-07       Impact factor: 3.441

View more
  2 in total

1.  Toxin-Antitoxin Systems - A New Player in Morphological Transformation of Antibiotic-Exposed Helicobacter pylori?

Authors:  Paweł Krzyżek
Journal:  Front Cell Infect Microbiol       Date:  2021-04-26       Impact factor: 5.293

2.  Comparative genomics analysis of statistically significant genomic islands of Helicobacter pylori strains for better understanding the disease prognosis.

Authors:  Joyeeta Chakraborty; Raghunath Chatterjee
Journal:  Biosci Rep       Date:  2022-03-31       Impact factor: 3.840

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.