Literature DB >> 32156284

Overproduction of the Flv3B flavodiiron, enhances the photobiological hydrogen production by the nitrogen-fixing cyanobacterium Nostoc PCC 7120.

Baptiste Roumezi1, Luisana Avilan2, Véronique Risoul1, Myriam Brugna2, Sophie Rabouille3,4, Amel Latifi5.   

Abstract

BACKGROUND: The ability of some photosynthetic microorganisms, particularly cyanobacteria and microalgae, to produce hydrogen (H2) is a promising alternative for renewable, clean-energy production. However, the most recent, related studies point out that much improvement is needed for sustainable cyanobacterial-based H2 production to become economically viable. In this study, we investigated the impact of induced O2-consumption on H2 photoproduction yields in the heterocyte-forming, N2-fixing cyanobacterium Nostoc PCC7120.
RESULTS: The flv3B gene, encoding a flavodiiron protein naturally expressed in Nostoc heterocytes, was overexpressed. Under aerobic and phototrophic growth conditions, the recombinant strain displayed a significantly higher H2 production than the wild type. Nitrogenase activity assays indicated that flv3B overexpression did not enhance the nitrogen fixation rates. Interestingly, the transcription of the hox genes, encoding the NiFe Hox hydrogenase, was significantly elevated, as shown by the quantitative RT-PCR analyses.
CONCLUSION: We conclude that the overproduced Flv3B protein might have enhanced O2-consumption, thus creating conditions inducing hox genes and facilitating H2 production. The present study clearly demonstrates the potential to use metabolic engineered cyanobacteria for photosynthesis driven H2 production.

Entities:  

Keywords:  Cyanobacteria; Flavodiiron; Heterocyte; Hydrogen; Hydrogenase

Year:  2020        PMID: 32156284      PMCID: PMC7063810          DOI: 10.1186/s12934-020-01320-5

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   5.328


Background

Development of renewable fuel as a clean alternative to fossil fuels is nowadays strongly needed. Besides solar energy, which represents the most abundant renewable energy, hydrogen (H2) is regarded as an attractive option for its high energy content and null ecological impact: its combustion only releases water as a byproduct. In this regard, growing autotrophic, photosynthetic organisms (cyanobacteria and algae) to yield H2 with minimized energy supply is a very promising alternative to fossil fuels. In cyanobacteria, H2 is produced by two different enzymes: hydrogenase and nitrogenase. In diazotrophic strains, H2 is formed as a by-product of N2 fixation activity performed by the nitrogenase. However, the nitrogenase is often associated to an uptake hydrogenase, encoded by the hup genes that catalyze the oxidation of H2 into protons; the amount of H2 produced during nitrogen fixation is thus rather limited [1]. The second type of enzymes producing H2 are hydrogenases (H2ases). Bidirectional NiFe H2ases (called Hox), which catalyze both H2 oxidation and proton reduction, are largely distributed across the cyanobacterial phylum [2, 3]. They form a heteropentamer with a H2ase part (HoxYH) and a diaphorase part (HoxEFU). The physiological function of Hox hydrogenases in cyanobacteria is not well understood but they may serve as electron valve during photosynthesis in the unicellular cyanobacterium Synechocystis sp. PCC 6803 [4]. The expression of hox genes is induced in dark and/or anaerobic conditions [5] and is under the control of the regulators LexA and two members of the AbrB family (antibiotic resistance protein B) [6-8]. The sensitivity of cyanobacterial bidirectional H2ases to oxygen (O2) and the fact that their activity occurs in the dark or under anaerobic conditions are the major obstacles to obtaining efficient solar driven production of H2 in cyanobacteria. Several strategies have so far been adopted to overcome the limits of the natural H2-evolving mechanisms in cyanobacteria (for a review see [9]). During photosynthesis, O2 can be reduced to water through an enzymatic process involving flavodiiron proteins (Flvs) [10]. In cyanobacteria, Flvs catalyze the reduction of O2 into water using NADPH as an electron donor [11] and play a critical role during growth under fluctuating light regimes [12]. The filamentous heterocyte-forming cyanobacterium Anabaena/Nostoc PCC7120 (hereafter Nostoc) produces four Flvs proteins in the vegetative cells (Flv1A, Flv2, Flv3A, and Flv4) and two Flvs (Flv1B and Flv3B) specific to the heterocyte [13]. The Flv3B protein mediates light-induced O2-uptake in the heterocyte, which benefits nitrogenase activity by providing a protection mechanism against oxidation [14]. In addition, the ∆flv3B mutant displayed a broad effect on gene expression, which indicates that a regulation process links gene transcription to O2 level in the heterocyte [14]. We recently reported that decreasing the O2 level inside the heterocyte by producing the cyanoglobin GlbN allowed it to host an active FeFe H2ase from Clostridium acetobutylicum. The recombinant strain displayed a significant H2-production yield under phototrophic conditions [15]. These data suggest that engineering approaches increasing the anaerobiosis inside the heterocyte can be highly profitable for the activity of O2-sensitive enzymes. To go further, we investigate here the impact of an overproduction of the flavodiiron Flv3B protein on the production of H2 in Nostoc. We demonstrate that the recombinant strain produces on average tenfold more H2 than the parental strain and that the expression of the hox genes is induced in this genetic background.

Results

Construction and characterization of a Nostoc recombinant strain overexpressing the flv3B gene

In a transcriptomic study using an RNAseq approach, the transcription of flv3B (all0178) gene was induced 12 h after nitrogen starvation [16]. In order to specifically overexpress the flv3B gene in the heterocytes without competing with the natural promoter of this gene, we decided to place it under the control of a heterocyte-specific promoter whose transcription is induced at the same time than flv3B. For this, we analyzed the transcription of flv3B throughout the differentiation process by quantitative RT-PCR. We also concomitantly monitored the transcription of the patB gene, known to be expressed after the initiation of heterocytes development [17]. flv3B and patB genes showed very similar transcription profile (Fig. 1). Both genes were induced 18 h after nitrogen stepdown and their transcription increased through the development program (compare Fig. 1a, b). The patB promoter was therefore chosen to drive flv3B overexpression in Nostoc, and the resultant recombinant strain was named WT/patB-flv3B. As a first step in the characterization of this strain, we checked the overexpression of flv3B in response to nitrogen starvation. We first carried out quantitative RT-PCR analyses and expressed the amount of flv3B transcripts in the recombinant strain relatively to their amount in the wild type. Results reveal a more than tenfold increase in flv3B gene expression in the recombinant strain, also starting much sooner after nitrate depletion, indicating that flv3B gene was strongly overexpressed (Fig. 1c). Because Flv3B from Nostoc and FlvB from Chlamydomonas reinhardtii amino acid sequences present 51% identity (Additional file 1: Figure S1), we hypothesized that antibodies produced against FlvB from C. reinhardtii [18] could cross-react with Flv3B and hence could be used to analyze the amount of Flv3B protein in Nostoc. Since Flv1B from Nostoc displays 30% identity with FlvB from C. reinhardtii, the anti-FlvB antibodies could also cross-react with this protein. However, as only the flv3B gene was overexpressed, we assumed that FlvB antibodies could help assessing Flv3B overproduction. In the western blot analyses, the amount of RbcL protein served to check that equal amounts of proteins were loaded in each condition [19]. Data on Fig. 1d show that a protein of the expected size of Flv3B (64 kDa) was detected only in BG110 medium (without nitrate), which is in agreement with flv3B gene being specific to the heterocyte [13]. Moreover, this protein accumulated at a higher level in the WT/patB-flv3B strain. Altogether, these results indicate that the flv3B gene was overexpressed in the recombinant strain. The WT/patB-flv3B strain showed similar growth efficiency than the wild type under both nitrogen replete and deplete conditions (Fig. 2a, Table 1), and both strains differentiated heterocytes equally well (Fig. 2b). The frequency of heterocytes along the filament was similar between the two strains, with 12 vegetative cells on average in between two heterocytes (Fig. 2c). Given that the overexpression of flv3B did not impair the growth ability of the strain, we proceeded with an analysis of its impact on H2-production.
Fig. 1

Flv3B overproduction analysis. a–c Quantitative RT-PCR analysis of flv3B (a, c) and patB (b, d) gene transcription. RNA were collected from the wild type (a, b) or the WT/patB-flv3B (c) strain at four different times (7, 18, 24 and 48 h) after the onset of nitrogen depletion. Each sample was measured in triplicate and the standard deviation is indicated by error bars. Values were normalized to the rnpB transcript, relatively to the value obtained for the wild type strain, which was set to 1. d Immunoblot analysis of the amount of Flv3B protein (upper panel) in the wild type and WT/patB-flv3B strains, carried out using antibodies produced against FlvB from Chlamydomonas reinhardtii [18]. Immunoanalysis of RbcL protein amount was carried out as a loading control (lower panel). The condition (+ Nitrate) stands for cultures performed in nitrate-containing medium, and the condition (− Nitrate) indicates cultures grown in nitrate-free medium

Fig. 2

Characterization of Nostoc strain overexpressing the flv3B gene. a Growth curve of Nostoc strains grown in either nitrate-containing medium or nitrate free medium. For each curve, three independent cultures were performed. The growth was assessed during 12 days by measuring the optical density at 750 nm. The standard deviation is indicated by error bars. b Light microscope images of Nostoc strains grown in nitrate-containing medium or nitrate- free medium. For the last conditions, images were acquired 24 h after nitrogen starvation. Heterocytes are indicated by black arrows. c Heterocyte pattern formation in the wild type and the WT/patB-flv3B strain. Strains were grown in BG11 (nitrate-containing medium) to an OD750 of 0.4 and induced to form heterocytes by transfer to BG-110 medium (nitrate-free medium). Vegetative cells and heterocytes were scored microscopically 24 h after nitrogen starvation. The data shown are representative of three independent experiments

Table 1

Nitrogenase activity of the cyanobacterial strains studied

Strain measureWild typeWT/patB-flv3B
Exponential growth rate per day (BG110)0.1550.155
Chla content (mg Chla/mL)4.498.9
Nitrogenase activity (nmol N2/mg Chla/h)17.311.2
sd on nitrogenase activity0.0010.00,025

Two independent cultures of each strain were grown as explained in the Materials and methods section. For each strain, the nitrogenase activity values presented in this table were registered at T = 4 h of the light phase

Chla chlorophyll a, sd standard deviation

Flv3B overproduction analysis. a–c Quantitative RT-PCR analysis of flv3B (a, c) and patB (b, d) gene transcription. RNA were collected from the wild type (a, b) or the WT/patB-flv3B (c) strain at four different times (7, 18, 24 and 48 h) after the onset of nitrogen depletion. Each sample was measured in triplicate and the standard deviation is indicated by error bars. Values were normalized to the rnpB transcript, relatively to the value obtained for the wild type strain, which was set to 1. d Immunoblot analysis of the amount of Flv3B protein (upper panel) in the wild type and WT/patB-flv3B strains, carried out using antibodies produced against FlvB from Chlamydomonas reinhardtii [18]. Immunoanalysis of RbcL protein amount was carried out as a loading control (lower panel). The condition (+ Nitrate) stands for cultures performed in nitrate-containing medium, and the condition (− Nitrate) indicates cultures grown in nitrate-free medium Characterization of Nostoc strain overexpressing the flv3B gene. a Growth curve of Nostoc strains grown in either nitrate-containing medium or nitrate free medium. For each curve, three independent cultures were performed. The growth was assessed during 12 days by measuring the optical density at 750 nm. The standard deviation is indicated by error bars. b Light microscope images of Nostoc strains grown in nitrate-containing medium or nitrate- free medium. For the last conditions, images were acquired 24 h after nitrogen starvation. Heterocytes are indicated by black arrows. c Heterocyte pattern formation in the wild type and the WT/patB-flv3B strain. Strains were grown in BG11 (nitrate-containing medium) to an OD750 of 0.4 and induced to form heterocytes by transfer to BG-110 medium (nitrate-free medium). Vegetative cells and heterocytes were scored microscopically 24 h after nitrogen starvation. The data shown are representative of three independent experiments Nitrogenase activity of the cyanobacterial strains studied Two independent cultures of each strain were grown as explained in the Materials and methods section. For each strain, the nitrogenase activity values presented in this table were registered at T = 4 h of the light phase Chla chlorophyll a, sd standard deviation

flv3B overexpression in the heterocyte powers H2-production

The sensitivity of H2ases and nitrogenase to O2 is an important limitation to H2-photoproduction. By promoting O2 consumption in the heterocyte, the Flv3B protein is ought to protect enzymes evolving H2. To test this hypothesis, the wild type and the WT/patB-flv3B strains were first grown exponentially under aerobic conditions in nitrate replete medium. H2-production yield was then measured and compared after cells were transferred to nitrate-depleted medium. The recombinant strain produced 10 to 30-fold more H2 than the wild type under the same conditions (Fig. 3a). H2 production increased with the experienced light irradiance, with the highest yield obtained under 60 µE m−2. Flv3B overproduction is thus an efficient way to enhance H2 photoproduction in Nostoc.
Fig. 3

H2 production kinetics. a Wild type or WT/patB-fvl3B were grown in nitrate-containing medium until OD 750 nmm = 0.8. Heterocyte formation was induced by transferring the strains to a nitrate-free medium during 24 h. The strains were then incubated under light intensities of either 20 µE/m2 or 60 µE/m2, and H2 production was assessed by chromatography as explained in the methods section during 4 days. The values represent Mean ± SEM (n = 8). b Wild type, WT/patB-fvl3B, ∆hupL or ∆hupL/patB-fvl3B strains were grown under light intensities of 60 µE/m2. Hetrocyte formation and H2-production were respectively induced and performed as described above. The values represent Mean ± SEM (n = 8)

H2 production kinetics. a Wild type or WT/patB-fvl3B were grown in nitrate-containing medium until OD 750 nmm = 0.8. Heterocyte formation was induced by transferring the strains to a nitrate-free medium during 24 h. The strains were then incubated under light intensities of either 20 µE/m2 or 60 µE/m2, and H2 production was assessed by chromatography as explained in the methods section during 4 days. The values represent Mean ± SEM (n = 8). b Wild type, WT/patB-fvl3B, ∆hupL or ∆hupL/patB-fvl3B strains were grown under light intensities of 60 µE/m2. Hetrocyte formation and H2-production were respectively induced and performed as described above. The values represent Mean ± SEM (n = 8)

The presence of the uptake H2ase is required for a maximal H2 production

Since the uptake H2ase consumes the H2 produced by the nitrogenase in the heterocyte and since its deletion enhanced H2 production [20], we investigated whether a deletion of hupL gene, encoding the large subunit of the uptake H2ase would show a cumulative effect with Flv3B overproduction. For this purpose, a deletion of hupL was constructed and the resultant strain transformed with the patB-flv3B containing plasmid. The deletion of hupL gene in an otherwise wild type background increased the H2 production level, which is in agreement with data published previously [20] (Fig. 3b). However, the absence of a further enhanced H2 production following the overproduction of Flv3B in the ∆hupL strain was unexpected. Intriguingly, the ∆hupL/patB-flv3B strain produced 3.5-fold less H2 than the WT/patB-flv3B strain (Fig. 3b).

Flv3B overproduction does not stimulate nitrogenase activity

The deletion of the flv3B gene was shown to result in a decrease in both the amount of nitrogenase subunits and nitrogenase activity [14]. Therefore, the increased H2 production in the flv3B overproducing strain could be a consequence of an increase in the activity of the nitrogenase. To test this hypothesis, we monitored nitrogenase activity in exponentially growing cultures after their transfer to a medium devoid of combined nitrogen. Results demonstrated that the overproduction of Flv3B protein did not enhance nitrogenase activity (Table 1). Therefore, the effect of Flv3B on H2 production is unlikely to result from nitrogenase activity.

Flv3B overproduction induces the expression of the bidirectional H2ase encoding genes

Since the only other enzyme able to produce H2 in cyanobacteria is the bidirectional Hox H2ase, we analyzed whether an induced expression of hox genes then results from the overproduction of Flv3B. The hoxH and hoxY genes encoding the H2ase subunits as well as the hoxE,F,U genes encoding the diaphorase subunits belong to two separate operons [21]. To evaluate the expression of these operons, the transcription of two genes from each operon (hoxH,Y and hoxE,F) was comparatively monitored in the wild type and the recombinant strains. Quantitative RT-PCR analysis was used to evaluate the transcription of these four genes after transfer of the strains into nitrogen deplete conditions to induce flv3B expression. The transcription of the four hox genes was weak in the wild type strain (Figs. 4a, b;  5a, b), which is in agreement with the fact that the hox genes are not expressed under aerobic conditions [21]. However, in the WT/patB-flv3B strain, 18 h after nitrogen step down, the hoxE,F, H and Y transcripts level were on average tenfold higher than in the wild type (Figs. 4c, d and 5c, d). The expression of the two hox operons encoding the H2ase and diaphorase proteins is therefore induced in the strain overexpressing the flv3B gene under the heterocyte specific promoter patB. Consequently, the effect of flv3B overexpression on H2 production may be mediated by the induction of hox genes.
Fig. 4

hoxY, H genes transcription analysis. Quantitative RT-PCR analysis of hoxY and hoxH gene transcription. RNA were collected form wild type (a, b) or WT/patB-fvl3B (c, d) at different times after the onset of the nitrogen depletion step. Each sample was measured in triplicate and the standard deviation is indicated by error bars. Values were normalized to the rnpB transcript

Fig. 5

hoxE, F genes transcription analysis. Quantitative RT-PCR analysis of hoxE and hoxF gene transcription. RNA were collected form wild type (a, b) or WT/patB-fvl3B (c, d) at different times after the onset of the nitrogen depletion step. Each sample was measured in triplicate and the standard deviation is indicated by error bars. Values were normalized to the rnpB transcript

hoxY, H genes transcription analysis. Quantitative RT-PCR analysis of hoxY and hoxH gene transcription. RNA were collected form wild type (a, b) or WT/patB-fvl3B (c, d) at different times after the onset of the nitrogen depletion step. Each sample was measured in triplicate and the standard deviation is indicated by error bars. Values were normalized to the rnpB transcript hoxE, F genes transcription analysis. Quantitative RT-PCR analysis of hoxE and hoxF gene transcription. RNA were collected form wild type (a, b) or WT/patB-fvl3B (c, d) at different times after the onset of the nitrogen depletion step. Each sample was measured in triplicate and the standard deviation is indicated by error bars. Values were normalized to the rnpB transcript

Discussion

In this work we show that overexpression of flv3B gene from a promoter specific to the heterocyte enhanced the production of H2 in aerobic cultures of Nostoc. So far, the only conditions in which H2-evolution had been recorded in aerobically grown Nostoc were the use of mutants lacking the HupL subunit of the uptake H2ase or the last step of the maturation system of this H2ase [20, 22]. H2 evolution mediated by Flv3B overproduction presents the advantage of sustaining the protective effect of the uptake H2ase on the nitrogenase. By studying the phenotype of a ∆flv3B mutant of Nostoc, Ermakova et al. [14] showed that Flv3B protected nitrogenase through light-induced O2 consumption inside the heterocytes. The effect of Flv3B overproduction evidenced in our work could therefore result from a stimulated nitrogenase activity. But the recombinant strain displayed similar nitrogenase activity as the wild type (Table 1), proof that another mechanism operates to enhance H2 production. In C. reinhardtii, the existence of intracellular microoxic niches in the chloroplast preserve FeFe-hydrogenase activity and support continuous H2 production during growth in aerobic cultures [23]. The same authors suggested that Flvs proteins were involved in this process [23]. A similar mechanism may be proposed to explain the effect of the Flv3B protein overproduction on H2 evolution, in which the decrease in O2 concentration in the heterocyte would reinforce the anaerobiosis in this cell type, thus promoting H2ase synthesis and/or activity. We studied the transcription of hox genes encoding the bidirectional H2ase as their induction is known to be concomitant to high H2ase activity [21]. Data in Figs. 4, 5 indicate that flv3B overproduction led to a substantial induction of hoxE,F,H,Y genes expression that can explain the H2 production measured in this strain. The LexA transcriptional factor was proposed to regulate hox genes transcription in Nostoc [21]. In the unicellular cyanobacterium Synechocystis PCC6803, LexA was suggested to act as a transducer of the intracellular redox state, rather than of the SOS response as in E. coli [24]. Based on this information, we suggest that an increased O2-uptake driven by Flv3B overproduction can modify the redox state in the heterocytes, resulting in the observed induction of hox genes transcription. Surprisingly, and contrary to what happens in the wild type background, the lack of the uptake H2ase in the WT/patB-flv3B strain led to a decrease in H2 production (Fig. 3b). As the H2ases are bidirectional enzymes, a possible interpretation of this result is that the Hup enzyme is responsible of the H2 production observed in this recombinant strain. However, this is rather unlikely since it was demonstrated that the Hup H2ase is not able to produce H2 at any significant rate, and is considered to react only in the uptake direction [1, 25]. Through the oxidation of H2, the Hup H2ase provides electrons to the photosynthesis and respiratory processes [1] (Fig. 6). Since the Hox H2ase was suggested to use ferredoxin as reducing partner rather than NAD(P)H as previously admitted (reviewed in [9]), this enzyme may benefit from the electrons generated by the Hup H2ase through regeneration of the reduced ferredoxin pool (Fig. 6). This could explain the negative impact of the hupL deletion on the H2-production yield in the WT/patB-flv3B strain (Fig. 6). Our data show that metabolic engineering approaches are particularly relevant in the use of photosynthetic bacteria for biofuel production.
Fig. 6

Hypothetical model of H2 production in Nostoc strain overproducing Flv3B. Nitrogen fixation occurring in the heterocyte produces H2 which is recycled by the Hup H2ase. Overexpression of the flv3B gene increases the uptake of O2 reinforcing the microoxie inside the heterocyte. The induction of hox genes transcription leads to H2 production. Fdred: reduced ferredoxin; Fdox: oxidized ferredoxin. Dashed lines stand for indirect effect

Hypothetical model of H2 production in Nostoc strain overproducing Flv3B. Nitrogen fixation occurring in the heterocyte produces H2 which is recycled by the Hup H2ase. Overexpression of the flv3B gene increases the uptake of O2 reinforcing the microoxie inside the heterocyte. The induction of hox genes transcription leads to H2 production. Fdred: reduced ferredoxin; Fdox: oxidized ferredoxin. Dashed lines stand for indirect effect

Conclusion

In the present study, the flv3B gene was specifically overexpressed in the heterocyte of Nostoc under the control of the patB promoter. The overproduction of the Flv3B flavodiiron enhanced the H2 production yield by a factor of ten on average, which is not to be attributed to the nitrogenase since no increase in the nitrogenase activity was observed. The transcription of the hox genes was induced in the recombinant strain expressing the flv3B gene, suggesting that the additional H2 produced relates to the activity of the bidirectional H2ase. Facilitating the consumption of O2 inside the heterocyte thus appears as a relevant step towards the design of an optimized Nostoc strain for H2 production. This paves the way to further improvement to achieve sustainable production of H2 by air-grown cyanobacteria.

Methods

Growth conditions and heterocytes induction

Cyanobacterial strains were grown in BG11 medium (nitrate replete) at 30 ℃ under continuous illumination (30 µE m−2 s−1). Cultures of recombinant strains were supplemented with neomycin (50 μg mL−1). Heterocyte formation was induced by transferring the exponentially growing cultures (OD 750 = 0.8) to BG110 (BG11 devoid of sodium nitrate) by filtration (0.2 µm pore size filters, Sigma) and resuspension of cells into the nitrate-free medium. The growth was maintained for 4 days. The presence of heterocytes was confirmed by light microscopy and their distribution within filaments was rated visually by counting the number of vegetative cells between two heterocytes. At least 400 total vegetative cells were counted for each strain. In the H2 production experiments, the strains were grown under continuous illumination of 20 µE m−2 s−1 or 60 µE m−2 s−1.

Construction of plasmids and strains

To construct the Flv3B overproducing strain, the promoter region of patB (all2512, 500 bp upstream the start codon) was amplified by PCR from Nostoc sp. PCC 7120 genomic DNA using the ppatB forward and ppatB reverse primers (Table 2). The ppatB reverse primer contained a multiple cloning site (ApaI, ClaI, BamHI, SalI, ScaI, EcoRI). The amplified promoter was cloned into BglII and EcoRI restriction sites of the pRL25T plasmid [26], yielding the pRL25T-patB plasmid. The open reading frame of flv3B gene was amplified using the flv3B forward and reverse primers (Table 2), and cloned into the ApaI and ScaI restriction sites of the pRLpatB. The recombinant plasmid (pRL25T-patB-flv3B) was analyzed by sequencing (Millegen). Conjugation of Nostoc was performed as described in Ref. [27]. Briefly, E. coli strains (bearing the replicative pRL25T-patB-flv3B and the RP-4 conjugative plasmid) grown to exponential growth phase, were mixed to an exponentially grown Nostoc culture. The mixture was plated on BG11 plates and Neomycin was added 24 h later for plasmid selection. Plasmid extraction was used to analyze the obtained recombinant clones.
Table 2

sequence of the primers used in this study

NameSequence (5′–3′)Experiment
rnpB forwardTCGTGAGGATAGTGCCACAGQuantitative RT-PCR analysis
rnpB reverseGGAAGTTTCTTCCCCAGTCC
flv3B RT forwardTTTGGTGGAAGATGTGCTGC
flv3B RT reverseGCCAATGTAAGTTAGGCGCA
patB forwardAGGGGCGATGTAAAGTGGAA
patB reverseTTGACTGCTCGACTGTAGCA
hoxE forwardGCGTCACCAGTATCAGCAAG
hoxE reverseTGGGGCGCTAGGGAAAATAA
hoxF forwardACCCGGCTGAATCTGGTTTA
hoxF reverseAAGCCTGTGTTGCGGATTTT
hoxH forwardCTGGACAGGTAAACGATGCG
hoxH reverseACAAATCCGCGCTGTAATCC
hoxY forwardTTTCCTTTGGTGACTGTGCG
hoxY reverseGGTTGATATCGGCTGCTTGG
ppatB forwardTATAAGATCTGTCTTTAAATATACATGGTTTGGGCloning of patB promoter
ppatB reverseTATAGAATTCGAGCTCGTCGACCCGGGATCCATCGATGGGCCCCATATAACTTTCTTCCCACCC
flv3B forwardTAT CCCGGG ATG GTA TCG ATG TCT ACG ACC
flv3B reverseTAT AGTACT TTA GTA ATA GTT GCC TAC TTT GCG
Strp forwardAATTCCCCTGCTCGCGCAGGConstruction of the hupL deleted mutant
Strp reverseAGCTTAGTAAAGCCCTCGCT
all0678 forwardTTCGATATCTAGATCTCGAGTCAATTAATGACTTTTGACTAATTA
all0678 reverseAGTAGACGGAGTATACTAGTGCAACTTTCGGAGCG
Strp-all0678 forwardCCTGCGCGAGCAGGGGAATTCATATAACTGCTGTGGCA
Strp-all0678 reverseAGCGAGGGCTTTACTAAGCTGTTTAAACGCAGAGGGG
sequence of the primers used in this study Deletion of the hupL gene, yielding the ∆hetL strain, was obtained by homologous recombination replacing the hupL3′ gene (all0687C) with the gene encoding the spectinomycin/streptomycin resistance (Sp/Sm cassette hereafter). For this purpose, the upstream and downstream 1500 bp flanking the hupL3′ gene were amplified form Nostoc genomic DNA using the all0678 forward/all0678 reverse and the Strp-all0678 forward/Strp-all0678 forward, respectively; The Sp/Sm cassette was amplified using the Strp forward/Strp reverse primers (Table 2), using the pBAD42 plasmid (Addgen) as template. Gibson’s assembly technique (New-England Biolabs) was applied to insert the three resulting fragments into the suicide pRL271 vector linearized by SpeI. The resulting recombinant plasmid was conjugated into Nostoc as described above. The initial conjugants were selected by screening for resistance to 5 μg/mL of Sm, and the resulting cells were then grown on BG11 plates containing 5% sucrose to select double recombinants. Genomic DNA of the recombinant cells were analyzed by PCR. The strains and plasmids used in this study are listed in Table 3.
Table 3

List of the bacterial strains and the plasmids used in this study

Strain nameDescription/antibiotic resistanceOrigin
Wild typeNostoc/Anabaena PCC 7120 wild type strainPasteur Cyanobacterial Collection
WT/patB-flv3BNostoc containing the pRL25T-patB-flv3B plasmid/(NeoR)This study
ΔhupLNostoc deletion mutant of the hupL gene (Sp/SmR)/This study
ΔhupL/patB-flv3BΔhupL mutant containing the pRL25T-patB-flv3B/(Sp/SmR and NeoR)This study
List of the bacterial strains and the plasmids used in this study

RNA preparation and reverse transcription

RNAs were prepared using the Qiagen RNA extraction kit (Qiagen) following the manufacturer instructions. An extra TURBO DNase (Invitrogen) digestion step was undergone to eliminate the contaminating DNA. The RNA quality was assessed by tape station system (Agilent). RNAs were quantified spectrophotometrically at 260 nm (NanoDrop 1000; Thermo Fisher Scientific). For cDNA synthesis, 1 µg total RNA and 0.5 μg random primers (Promega) were used with the GoScript™ Reverse transcriptase (Promega) according to the manufacturer instructions.

Quantitative real-time-PCR for transcriptional analyses

Quantitative real-time PCR (qPCR) analyses were performed on a CFX96 Real-Time System (Bio-Rad). The reaction volume was 15 μL and the final concentration of each primer was 0.5 μM. The qPCR cycling parameters were 95 ℃ for 2 min, followed by 45 cycles of 95 ℃ for 5 s, 55 ℃ for 60 s. A final melting curve from 65 ℃ to 95 ℃ was added to determine the specificity of the amplification. To determine the amplification kinetics of each product, the fluorescence derived from the incorporation of BRYT Green® Dye into the double-stranded PCR products was measured at the end of each cycle using the GoTaq® qPCR Master Mix 2X Kit (Promega). The results were analysed using Bio-Rad CFX Maestro software, version 1.1 (Bio-Rad, France). The rnpB gene was used as a reference for normalization. A technical duplicate was performed for each point. The amplification efficiencies of each primer pairs were 80 to 100%. All of the primer pairs used for qPCR are reported in Table 2.

Western blot analysis

Proteins (75 µg) extracted from cyanobacterial strains were fractionated by performing SDS-PAGE 12%, and transferred to nitrocellulose membranes before being revealed with specific polyclonal antibodies. Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega) and enhanced chemoluminescence reagents (Pierce). Anti-FlvB antibodies, developed against the FlvB protein of C. reinhardtii [18], were used at a 1: 1000 dilution. Anti-Rbcl antibodies (Agrisera) were used a 1: 5000 dilution.

H2 production assays

Nostoc wild type strain and its derivatives were grown as described above for heterocyte induction. Chlorophyll a concentration was quantified according to the following method: 1 mL of culture was centrifuged (5 min, 6700 g, 4 ℃), the pellet was resuspended in 1 mL of cold methanol and incubated at 4 ℃ for 30 min under shaking. Cells were then harvested (5 min, 6700 g, 4 ℃) and absorbance of the supernatant was measured at 665 nm and 720 nm. The chlorophyll a concentration was calculated according to the formula: [Chl a] = 12,9447 (A665–A720) and expressed in µg of Chla/mL of culture [28]. A 40-mL volume of cell culture was then harvested (5 min, 6700 g, 4 ℃) and cells were resuspended in sterile nitrate-depleted medium yielding a concentration of 10 μg Chla mL−1. 12 mL of this cell suspension were transferred to Hungate tubes (leaving a 4.4-mL head space volume). The vials were sparged with Argon (Ar), and the samples were maintained under illumination (20 or 60 μmol photons m−2 s−1) for 96 h. 100 μL of headspace gas was removed every 12 h using a gastight syringe and injected into a gas chromatography system (Agilent 7820) equipped with a thermal conductivity detector and a HP-plot Molesieve capillary column (30 m, 0.53 mm, 25 µm), using argon as the carrier gas, at a flow rate of 4.2 mL/min, an oven temperature of 30 ℃ and a detector temperature of 150 ℃. H2 was quantified according to a standard calibration curve. H2 production rate was expressed as mol of H2 produced per mg of Chlorophyll.

Nitrogenase activity

An on-line acetylene reduction assay [29] was used to measure nitrogenase activity. Briefly, cyanobacterial strains were grown in batch cultures under light/dark cycles of 12 h/12 h. Nitrogenase activity was monitored for 20 h. Before the onset of nitrogenase activity, Nostoc cultures were transferred to a GF/F filter (Whatman, 47 mm) and placed in a custom-made, light and temperature-controlled gas flow-through incubator connected to the gas chromatograph. Acetylene represented 10% of the gas mixture and the total gas flow rate was 1 l h−1. Ethylene production was measured every 10 min by gas chromatography using an Agilent 7890 equipped with an auto-injector and a photoionization detector. Additional file 1: Figure S1. Alignment of the amino acid sequence of the Flv3B protein of Nostoc (all0178) and FlvB of Chlamydomonas reinhardtii (Cre16.g691800.t1.1).
  30 in total

1.  Flavodiiron Proteins Promote Fast and Transient O2 Photoreduction in Chlamydomonas.

Authors:  Frédéric Chaux; Adrien Burlacot; Malika Mekhalfi; Pascaline Auroy; Stéphanie Blangy; Pierre Richaud; Gilles Peltier
Journal:  Plant Physiol       Date:  2017-05-09       Impact factor: 8.340

2.  Disruption of the uptake hydrogenase gene, but not of the bidirectional hydrogenase gene, leads to enhanced photobiological hydrogen production by the nitrogen-fixing cyanobacterium Anabaena sp. PCC 7120.

Authors:  H Masukawa; M Mochimaru; H Sakurai
Journal:  Appl Microbiol Biotechnol       Date:  2002-02-14       Impact factor: 4.813

3.  Use of a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion sequences.

Authors:  Y P Cai; C P Wolk
Journal:  J Bacteriol       Date:  1990-06       Impact factor: 3.490

4.  Genes encoding A-type flavoproteins are essential for photoreduction of O2 in cyanobacteria.

Authors:  Yael Helman; Dan Tchernov; Leonora Reinhold; Mari Shibata; Teruo Ogawa; Rakefet Schwarz; Itzhak Ohad; Aaron Kaplan
Journal:  Curr Biol       Date:  2003-02-04       Impact factor: 10.834

5.  Hydrogen production by the engineered cyanobacterial strain Nostoc PCC 7120 ΔhupW examined in a flat panel photobioreactor system.

Authors:  Marcus Nyberg; Thorsten Heidorn; Peter Lindblad
Journal:  J Biotechnol       Date:  2015-08-29       Impact factor: 3.307

6.  Cotranscription of genes encoding the small and large subunits of ribulose-1,5-bisphosphate carboxylase in the cyanobacterium Anabaena 7120.

Authors:  S A Nierzwicki-Bauer; S E Curtis; R Haselkorn
Journal:  Proc Natl Acad Sci U S A       Date:  1984-10       Impact factor: 11.205

7.  Sustained photoevolution of molecular hydrogen in a mutant of Synechocystis sp. strain PCC 6803 deficient in the type I NADPH-dehydrogenase complex.

Authors:  Laurent Cournac; Geneviève Guedeney; Gilles Peltier; Paulette M Vignais
Journal:  J Bacteriol       Date:  2004-03       Impact factor: 3.490

8.  The AbrB2 autorepressor, expressed from an atypical promoter, represses the hydrogenase operon to regulate hydrogen production in Synechocystis strain PCC6803.

Authors:  Jérémy Dutheil; Panatda Saenkham; Samer Sakr; Christophe Leplat; Marcia Ortega-Ramos; Hervé Bottin; Laurent Cournac; Corinne Cassier-Chauvat; Franck Chauvat
Journal:  J Bacteriol       Date:  2012-08-03       Impact factor: 3.490

9.  Comparative characterization of two distinct hydrogenases from Anabaena sp. strain 7120.

Authors:  J P Houchins; R H Burris
Journal:  J Bacteriol       Date:  1981-04       Impact factor: 3.490

10.  A LexA-related protein regulates redox-sensitive expression of the cyanobacterial RNA helicase, crhR.

Authors:  Laura M Patterson-Fortin; Kimberley R Colvin; George W Owttrim
Journal:  Nucleic Acids Res       Date:  2006-07-13       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.