Literature DB >> 32143212

Transcriptomic analysis to elucidate the response of honeybees (Hymenoptera: Apidae) to amitraz treatment.

Liang Ye1, Peng Liu1, Tengfei Shi1, Anran Wang1, Yujie Zhu1, Lai Li1, Linsheng Yu1.   

Abstract

Amitraz is an acaricide that is widely used in apiculture. Several studies have reported that in honeybees (Apis mellifera Linnaeus; Hymenoptera: Apidae), amitraz affects learning, memory, behavior, immunity, and various other physiological processes. Despite this, few studies have explored the molecular mechanisms underlying the action of amitraz on honeybees. Here, we investigated the transcriptome of honeybees after exposure to 9.4 mg/L amitraz for 10 d, a subchronic dose. Overall, 279 differentially expressed genes (DEGs) were identified (237 upregulated, 42 downregulated). Several, including Pla2, LOC725381, LOC413324, LOC724386, LOC100577456, LOC551785, and P4504c3, were validated by quantitative PCR. According to gene ontology, DEGs were mainly involved in metabolism, biosynthesis, and translation. Kyoto Encyclopedia of Genes and Genomes pathway analyses revealed that amitraz treatment affected the relaxin signaling pathway, platelet activation, and protein digestion and absorption.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32143212      PMCID: PMC7060074          DOI: 10.1371/journal.pone.0228933

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Approximately 80% of flowering plants, including many crops, require insects to pollinate [1-3]. Honeybees (Apis mellifera Linnaeus; Hymenoptera: Apidae) are the most important pollinators worldwide [4]. One-third of global food is linked to the pollination activity of honeybees [4]. In recent years, the substantial decline in apiculture has garnered much attention [5-8]; however, the underlying reasons for this remain poorly understood. Many factors affect the wellbeing of honeybees, including pathogens, pesticides, malnutrition and changing apicultural practices [9-11]. Among these, pesticide exposure has been widely accepted to be the major contributor to a decline in the honeybee population [10]. Honeybees are continuously exposed to agricultural pesticides, which are transported to hives by foraging bees [10]. Direct application of acaricides within beehives to control Varroa mites and other pests creates an extra pesticide burden on the bees [10]. Acaricides and pesticides contaminate apicultural products such as honey, beeswax, and pollen [8, 12, 13]. The midgut of honeybee is an absorptive organ and involved in degraded chemical compounds[14]. The epithelium, in particular, is responsible for detoxification of ingested xenobiotics[15]. Meanwhile, honey bee larvae exposed to sublethal concentrations of a broad range of pesticides resulted in midgut cell apoptosis[16]. As the same time, the midgut is the principal barrier to invasion of the honey bee for many pathogens [17]. Amitraz [1,5-di-(2,4-dimethylphenyl)-3-methyl-1,3,5-triaza-penta-1,4-diene] is a formamidine pesticide used globally to control pests on animals and crops [18]. It is an acaricide and mainly acts on the central nervous system of ectoparasites by interacting with octopamine receptors, causing lethal and sublethal effects [19]. In the apiary, beekeepers can control Varroa mites by fumigation of beehives with amitraz, but it results in contamination of honey stored in combs[20]. Amitraz does not persist in the hive environment [21], but its metabolite N-(2,4-dimethylphenyl)-N′-methylformamidine can accumulate and has been found in wax, pollen, and inside the bees themselves [13]. Moreover, acute exposure to amitraz also can kill honeybee larval midgut epithelial cells [22]. Amitraz also affects learning, memory [23, 24], immunity [25] and sensory organs [26] in honeybees. In addition, a recent study reported that amitraz affected the immune system of the queen [27]. Amitraz stress leads to increase glutathione S-transferases activity in the larval instars, pupae, newly emerged bees and nurse bees[28]. Despite the adverse effects of amitraz on honeybees, the relevant molecular mechanisms remain poorly explored. In this study, we conducted high-throughput RNA sequencing (RNA-Seq) analyses to investigate honeybee transcriptomes after exposure to 9.4 mg/L amitraz for 10 d, a subchronic level. Differentially expressed genes (DEGs) were identified and analyzed. Our aim was to help understand the molecular mechanisms underlying the action of amitraz to elucidate reasons for the decline in honeybee populations.

Materials and methods

Honeybee rearing

The honeybees were obtained as previously described [29, 30]. Two frames with sealed broods nearing adult emergence were collected from an apparently healthy colony at the Institute of Apiculture Research, Anhui Agriculture University, Hefei, China. The population had not been exposed to pesticides. The frames were held in darkness at 35 ± 1°C with relative humidity (RH) 50% ± 10%. Newly emerged honeybees were then placed into wooden cages (11 × 10 × 8 cm) in darkness for 2 d (28 ± 1°C, RH 60% ± 10%). Throughout the experimental period, bees were fed sufficient fresh pollen and 50% (w/v) sucrose-water solution. Dead bees were removed daily.

Amitraz treatment

We followed previously reported methods by Shi et al. with some minor modifications[31]. The median lethal concentration (LC50) of amitraz to honeybees is 94 mg/L [32]. Herein we used amitraz(99% purity) which was obtained from aladdin company(Shanghai, China) at a sublethal concentration (9.4 mg/L). A stock solution of amitraz (1000 mg/L) was prepared in acetone. Working solution (9.4 mg/L) was prepared by dissolving the stock solution in 50% sucrose-water solution. Sucrose–water solution added the equivalent acetone without amitraz as a negative controls. Three-day-old bees were used for assays (45 bees/replicate, three replicates/treatment). After 10 d, all bees were collected and placed at 4°C for 5 min to anesthetized them; the bees were then dissected on ice, using liquid nitrogen to flash freeze the sample and the midgut was removed and stored at −80°C.

RNA extraction, library preparation and sequencing

Ten midguts from each replicate were pooled for RNA extraction using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA concentration was quantified and RNA integrity verified. Sequencing libraries were generated using a NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, CA, USA) following the recommended protocol; 3 μg RNA from each sample were used to prepare the library. Index codes were added to link sequences with the sample from which they originated. mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. mRNA was fragmented in 5× NEBNext First Strand Synthesis Reaction Buffer at elevated temperature. First strand cDNA was synthesized using random hexamer primers and M-MuLV Reverse Transcriptase (RNase H). Second strand cDNA was synthesized using DNA Polymerase I and RNase H. Overhangs were blunted using exonuclease/polymerase. 3′-ends of DNA fragments were adenylated and ligated with NEBNext Adaptors. DNA fragments (150–200 bp long) were selected by purification using an AMPure XP system (Beckman Coulter, Beverly, MA, USA). USER Enzyme (3 μL; NEB) was incubated with the size-selected, adaptor-ligated cDNA at 37°C for 15 min, then 5 min at 95°C. PCR was performed with Phusion High-Fidelity DNA polymerase, universal PCR primers. The amplicons obtained were purified using the AMPure XP system, and library quality was assessed on an Agilent Bioanalyzer 2100. Clustering of the index-coded samples was performed on a cBot Cluster Generation System using the TruSeq PE Cluster Kit v3-cBot-HS (Illumina). Then, the library preparations were sequenced (Illumina HiSeq 4000); 150-bp paired-end reads were generated.

Read processing

Raw reads (FASTQ) were initially processed using in-house Perl scripts. Clean reads were obtained by removing low-quality reads, and those containing adapter sequences or poly-N. All downstream analyses used high-quality clean reads. At the same time, the Q20, Q30, and GC contents were calculated. The index of the honeybee genome (NCBI: assembly Amel_HAv3.1) was built using Bowtie v2.2.3, and reads were aligned to the genome using TopHat v2.0.12. HTSeq v0.6.1 was used to count read numbers mapped to each gene.

Analysis of differential expression

Differential expression analysis used the DESeq R package v2.15.3. The resulting P-values were adjusted using the Benjamini and Hochberg approach for controlling false discovery rate; genes with adjusted P-value <0.05 were considered to be differentially expressed. Gene ontology (GO) enrichment analysis of DEGs was performed using the GOseq R package (gene length bias was corrected); GO terms with corrected P-values <0.05 were considered significantly enriched by DEGs. For Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, we used KOBAS to assess the statistical enrichment of DEGs.

Real-time quantitative PCR (qPCR) analysis

We selected seven DEGs identified following RNA-Seq (LOC725381, CYP4C3, LOC41332, Pla2, LOC724386, LOC100577456, and LOC551385) for verification by qPCR analysis. RpS5 and β-actin was used as the reference gene, and all the primers used were given in Table 1. We used 0.5 μg of total RNA (same as the total RNA for RNA-seq) for each sample. ReverTra Ace qPCR RT Master Mix Kit (Toyobo, Osaka, Japan) and a SuperReal PreMix Plus (SYBR Green) Kit (TIANGEN, Beijing, China) were used to obtain cDNA and perform qPCR, respectively. The relative expression levels of genes was calculated using the 2−ΔΔCt method [33]. Primer sets are listed in Table 1. Student’s t-test was used to assess differences in gene expression levels between amitraz-treated bees and controls. We used three replicates per group for qPCR validation.
Table 1

Primer sequences.

GenesPrimer Sequences (5'~3')amplification efficiency (%)
LOC725381Forward: CTAACCGCATTTCCCTTT95.6
Reverse: ATTCCGCATACAACAACG
CYP4C3Forward: ATTTGTCTTGCGATGAGC97.8
Reverse: ACGACGAAACAGTAGGGA
LOC413324Forward: ATTGGCGGCACTCCTGAT101.5
Reverse: TCCACGGGAAGGCGATTA
Pla2Forward: GCGACGACAAGTTCTATGAT95.9
Reverse: GTAGTGAAGACAACGACCCTC
LOC724386Forward: CATTTTGTTCTGGGAGTGGGT96.8
Reverse: CGTATTTGCGGTGCTCTTCAT
LOC1100577456Forward: CGTTCTCCTCGCTTATACCGT100.4
Reverse: GAATGATTTCAGCCCTCCACT
LOC551385Forward: CTTGCTGCCCTCCCGAAACTC103.7
Reverse: CGAGAACACGCCGCAGAAAAG
RpS5[34]Forward: AATTATTTGGTCGCTGGAATTG99.5
Reverse: TAACGTCCAGCAGAATGTGGTA
β-actin[35]Forward: TGCCAACACTGTCCTTTCTG95.2
Reverse: AGAATTGACCCACCAATCCA

Results

Survival

As shown in Fig 1, the average survival rate on day ten for the forager bees exposed to 9.4 mg/L amitraz and control of 50% sucrose-water solution were 77.8% and 88.9%, respectively. There were no significant differences among all treatments (Log-rank χ2 = 2.024, df = 1, P = 0.1548; Fig 1). The 9.4 mg/L amiteaz is a sublethal concentration.
Fig 1

Survival of forager bees subjected to chronic exposure to field-realistic concentrations of amitraz after 10 d.

Raw read processing and quantitative gene expression

Six libraries were created from amitraz-treated bees and controls: amitraz-1, amitraz-2, amitraz-3, control-1, control-2, and control-3, which generated 46588584, 38742446, 39577344, 42787014, 47048748, and 44719946 usable reads, respectively. The Q20 were 99.97%, 99.97%, 99.97%, 99.97%, 99.97% and 99.97%, respectively, while the Q30 were 97.04%, 97.06%, 96.99%, 97.00%, 97.30% and 96.93%, respectively. Q20, Q30, and GC contents were listed in S2 Table. After mapping to the reference genome (NCBI: assembly Amel_HAv3.1) and junction database, 44944558, 37354986, 38094470, 41341014, 45468272 and 43453530 total mapped reads were acquired, respectively. The numbers of uniquely mapped reads were 27182392, 21407197, 24815509, 26929339, 28752629 and 27107676 respectively. Among these unique reads, 57.31%–65.14% were mapped to exons (S1 Table). The sequencing data are available in the SRA database (https://dataview.ncbi.nlm.nih.gov/object/PRJNA593612?reviewer=elfpv4vmb047ik7k9efhmla825) of the NCBI system. The average number of genes expressed in the treatment and control groups was 11410 and 11303, respectively; 11034 genes were expressed in both groups (Fig 2).
Fig 2

Average number of genes specifically expressed in amitraz and control libraries.

Shown as the number of genes expressed in each class.

Average number of genes specifically expressed in amitraz and control libraries.

Shown as the number of genes expressed in each class. In each library, 9.91%–11.74% of reads had reads per kilobase per million mapped reads (RPKM) values of <0.1; 9.76%–10.98% of reads had RPKM values of 0.1–0.3; 36.58%–37.69% of reads had RPKM values of 0.3–3.57; 19.12%–20.62% of reads had RPKM values of 3.57–15; 11.25%–12.29% of reads had RPKM values of 15–60; and 9.41%–10.07% of reads had RPKM values of >60 (S3 Table). Thus, a few genes were expressed at very high levels, but most were expressed at low levels, indicating that the distribution of our gene expression dataset was normal.

DEGs, GO enrichment analysis, and KEGG pathway analysis

Overall, 279 DEGs were detected in honeybees exposed to 9.4 mg/L amitraz for 10 d: 237 (84.9%) were upregulated and 42 (15.1%) were downregulated (Fig 3 and S4 Table). S5 Table lists the 23 most significantly differentially expressed genes; of these, one was downregulated and 22 were upregulated. Fig 4 shows the 30 most enriched GO terms. In GO classification “biological process”, most DEGs were involved in translation and metabolic and biosynthetic processes. In category “cellular components”, most DEGs were associated with the ribosome. Finally, considering classification “molecular function”, most DEGs were enriched in structural constituents of the ribosome, structural molecule activity, and oxidoreductase activity.
Fig 3

Volcano plot of differentially expressed genes in honeybees exposed to 9.4 mg/L of amitraz for 10 days.

Genes with an adjusted P value of <0.05 (FDR correction method) were considered to be differentially expressed. Red: upregulated genes in amitraz-treated bees; green: downregulated genes in amitraz-treated bees; blue: no significant difference.

Fig 4

Gene ontology enrichment analysis of differentially expressed genes (DEGs) in honeybees exposed to 9.4mg/L amitraz for 10 days.

Green bars: DEGs enriched for biological process; orange bars: DEGs enriched for cellular components; purple bars: DEGs enriched for molecular function. * indicates that GO terms were significantly enriched by DEGs (corrected P values of <0.05, FDR correction method).

Volcano plot of differentially expressed genes in honeybees exposed to 9.4 mg/L of amitraz for 10 days.

Genes with an adjusted P value of <0.05 (FDR correction method) were considered to be differentially expressed. Red: upregulated genes in amitraz-treated bees; green: downregulated genes in amitraz-treated bees; blue: no significant difference.

Gene ontology enrichment analysis of differentially expressed genes (DEGs) in honeybees exposed to 9.4mg/L amitraz for 10 days.

Green bars: DEGs enriched for biological process; orange bars: DEGs enriched for cellular components; purple bars: DEGs enriched for molecular function. * indicates that GO terms were significantly enriched by DEGs (corrected P values of <0.05, FDR correction method). In total, 135 DEGs (116 upregulated and 19 downregulated) were mapped to 67 KEGG pathways, 10 of which were significantly enriched (Table 2).
Table 2

The five significantly enriched pathways, corrected P-value < 0.05.

PathwaysPathway IDGenes numberCorrected P-value
Relaxin signaling pathwayko0492620.01
Platelet activationko0461120.01
Protein digestion and absorptionko0497420.01
AGE-RAGE signaling pathway in diabetic complicationsko0493340.01
Amoebiasisko0514620.01
Cutin, suberine and wax biosynthesisko0007320.02
Cellular senescenceko0421820.03
Leukocyte transendothelial migrationko0467010.04
Taste transductionko0474210.04
D-Glutamine and D-glutamate metabolismko0047110.04

qPCR analysis

To validate our RNA-Seq data, seven DEGs (LOC725381, CYP4C3, LOC41332, Pla2, LOC724386, LOC100577456, and LOC551385) were checked by qPCR. Consistent with our sequencing data, LOC724386 was downregulated in amitraz-treated bees, while LOC725381, CYP4C3, LOC41332, Pla2, LOC100577456, and LOC551385 were upregulated (Fig 5) (The reference gene is RPS5 and β-actin, LOC725381: t = 18.978, df = 2, P = 0.0276; CYP4C3: t = 3.165, df = 2, P = 0.0258; LOC413332: t = 15.623, df = 2, P = 0.0262; Pla2: t = 15.812, df = 2, P = 0.0063; LOC724386: t = −19.756, df = 2, P = 0.0095; LOC100577456: t = 8.232, df = 2, P = 0.0092; LOC551385: t = 4.551, df = 2, P = 0.0226).
Fig 5

Real-time quantitative PCR and RNA-seq analysis of LOC725381, CYP4C3, LOC41332, Pla2, LOC724386, LOC100577456, and LOC551385 genes expression multiple in honeybees exposed to 9.4 mg/L of amitraz for 10 days.

Reference gene were RPS5 and β-actin. Values represent means ± SEM. * indicates a significant difference in comparison with controls (P < 0.05) and ** indicates a statistically significant difference in comparison with controls (P < 0.01).

Real-time quantitative PCR and RNA-seq analysis of LOC725381, CYP4C3, LOC41332, Pla2, LOC724386, LOC100577456, and LOC551385 genes expression multiple in honeybees exposed to 9.4 mg/L of amitraz for 10 days.

Reference gene were RPS5 and β-actin. Values represent means ± SEM. * indicates a significant difference in comparison with controls (P < 0.05) and ** indicates a statistically significant difference in comparison with controls (P < 0.01).

Discussion

Herein, we exposed honeybees to 9.4 mg/L amitraz for 10 d, which led to the identification of 279 DEGs (237 upregulated and 42 downregulated genes) in the honeybee transcriptome. In order to further study the metabolic pathways influenced in honey bees after amitraz exposure, 91 detailed related pathways of the differential genes were constructed using KEGG pathway analysis. Among these, four pathways, relaxin signaling pathway, platelet activation, protein digestion and AGE-RAGE signaling pathway in diabetic complications were extremely significantly affected (P<0.01). Previous reviews have showed that a relaxin was a factor communicating abnormal growth status of Drosophila larval imaginal discs to the neuroendocrine centers that control the timing of the onset of metamorphosis.[36, 37]. Herein, we found that the relaxin signaling pathway were activated in honeybees after exposure to amitraz, which indicates that amitraz potentially influenced developmental processes of honeybees. To facilitate feeding, certain hematophagous invertebrates possess inhibitors of collagen-induced platelet aggregation in their saliva, inhibited platelet aggregation need inhibit signal transduction necessary for platelet activation by collagen[38]. The hemocytes phagocytosis may play an important role in the cellular immune responses in insects, and the platelet-activating factor can influence phagocytosis of cells[39]. In our study, up-regulation of two genes (LOC113219380 and LOC113219382) of Platelet activation pathway after exposure to amitraz (P <0.01), indicating that amitraz might influence the honeybees immunity. Previous study indicated that imidacloprid was involved in the intoxication of honeybees, it could compromise the viability of the midgut epithelium and affected protein digestion and absorption[40]. Comparison of transcriptome profiling between HearNPV-infected and control healthy Helicoverpa armigera larvae during an early stage post-inoculation, KEGG analysis indicated an enrichment of these differently expressed genes some pathways, including protein digestion and absorption, proved that the DEGs participated in nutritional digestion and exhibited specific expression patterns in a continuous time-course assessment[41]. In this study, we believe that in response to amitraz challenge, honeybees could repair the damages by inducing the expression levels of the protein digestion and absorption pathway. The study showed that six key pathways might be associated with longevity of Drosophila including the AGE-RAGE-signalling pathway in diabetic complications[42]. Comparison between control and Cr (VI)-treated samples of mantis shrimp, AGE-RAGE signaling pathway in diabetic complications were significantly enriched[43]. In honeybees, AGE-RAGE signaling pathway in diabetic complications governs the neural activity to drive the age-specific labor division[44]. In this study, expression levels of four genes (LOC113219380, LOC113219382, Plc and LOC724607) of AGE-RAGE signaling pathway in diabetic complications upregulated by exposure to amitraz (P <0.01), Chouquet et al. clarified the role of Plc in Spodoptera littoralis olfactory transduction[45]. Our study suggest that amitraz probably affected longevity, developmental processes and olfactory transduction of honeybees. At the individual level, honeybees elicit both cellular and humoral innate immune responses against extraneous substances [19]. Antimicrobial peptides (AMPs) are a class of peptides with low molecular weight; they are encoded by specific genes and are important effectors of natural immunity [46]. Many studies have reported that pesticides affect immunocompetence by regulating the gene expression levels of AMPs in honeybees. For example, exposure to imidacloprid caused most immune related AMP genes (encoding apidaecin, hymenoptaecin and defensin-1) to be downregulated in white- and brown-eyed pupae, but in adults caused an increase in honey bee immune response[47]. Thiamethoxam treated honey bees were further exposed to either thiamethoxam or Nosema, which caused AMP genes abaecin, defensin-1 and defensin-2 to be upregulate[48]. In this study, AMP genes, like apidaecin (Apid1), were induced in amitraz-treated bees, indicating that amitraz also triggers the immune response in honeybees. Among the identified DEGs, four serine/threonine-protein kinase (STK) genes were present: STK CG31145, STK A2, STK PAKm, and STK MKNK1II. STKs are enzymes involved in metabolism, cell differentiation, gene expression, disease resistance, and other processes [49, 50]. STKs participate in stress resistance in insects [51]. In honeybees, STKs are related to cold and heat stress [52, 53]. Herein, we found that the expression levels of STK CG31145, STK A2, STK PAKm, and STK MKNK1II were upregulated by exposure to amitraz, which indicates that they are potentially involved in conferring tolerance to amitraz. Further, we found that two detoxification-related genes, CYP4C3 (encoding cytochrome P450 4c3) and CaE-I1 [encoding carboxylesterase (CarE) clade I], were differentially expressed. Cytochrome P450 monooxygenase (CYP) enzymes have been linked to insecticide resistance (i.e., detoxification) or environmental response [54]. Many xenobiotics and pesticides are metabolized by CYPs, such as pyrethroid lambda-cyhalothrin [55, 56], neonicotinoid insecticides [57, 58], aflatoxins [59], and the organophosphate coumaphos [60]. Honey bee are known to have the far fewer numbers of CYP family genes compared to other insects[61, 62], and some subfamilies that have been analyzed include CYP6 and CYP9. The CYP6 subfamily is insect-specific [54] and is involved in phytochemical metabolism [63]. The CYP9 subfamily is responsible for the degradation of various classes of plant protection products [56, 57], such as organophosphates, the pyrethroid cypermethrin, and chlorantraniliprole [64]. CYP9Q3 is known to metabolize tau-fluvalinate, and CYP9Q1 and CYP9Q2 are responsible for degrading bifenthrin [15]. However, the function of CYP4C3 has not yet been elucidated in honeybees. A previous study used transcriptome sequencing and bioinformatic analysis to compare transcription levels between a susceptible and resistant strain of Aedes aegypti; it was reported that the expression of genes such as CYP4C3 were significantly upregulated in resistant strain, suggesting the existence of a potential relationship between the expression of genes participating in metabolic processes and insecticide resistance [65]. CarEs include a group of enzymes involved in endocrine control, detoxification, and metabolism of nonpolar carboxyl hydrolases [66-68], such as malathion [66], methyl parathion [69], dichlorvos [70], and thiamethoxam [71, 72]. CarE has six isoforms in A. mellifera [73]; three isoforms (CarE1, CarE2, and CarE3) are involved in the metabolism of pesticides [74]. For example, CarE1 is directly involved in the detoxification of imidacloprid [71]. In the current study, the expression levels of CYP4c3 and CaE-I1 were upregulated by exposure to amitraz, indicating that these genes may be involved in amitraz degradation in honeybees. Among the identified DEGs, genes encoding the protein Big Brother, fibrillin-2, Ral GTPase-activating protein, and Brachyury protein are vital for the growth and development of insects. An earlier study reported that Big Brother proteins are required during Drosophila development [75], and the fibrillin-like protein AD10 was found to affect wing morphogenesis in Bombyx mori [76]. The small GTP-binding protein Ral was reported to control the cytoskeletal structure required for cell shape changes during Drosophila development [77], and Brachyury is known to regulate gastrulation in Drosophila [78]. Our data show that expression of genes encoding these four proteins was upregulated in response to amitraz treatment. A previous study found that acute exposure to amitraz caused cell death in the honeybee larvae midgut [22]. Thus, we believe that in response to amitraz challenge, honeybees could repair the damage to the midgut by inducing the expression levels of the four aforementioned genes.

Details of read counts in each library.

(XLSX) Click here for additional data file.

Sequencing sequence statistics and quality control.

(XLSX) Click here for additional data file.

Abundance distribution of unigenes.

(XLSX) Click here for additional data file.

Differentially-expressed genes.

(XLSX) Click here for additional data file.

23 genes with the most significant differential.

(XLSX) Click here for additional data file. 27 Nov 2019 PONE-D-19-30792 Transcriptomic Analysis to Elucidate the Response of Honeybees (Hymenoptera: Apidae) to Amitraz Treatment PLOS ONE Dear Dr Yu, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Jan 11 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Yulin Gao Academic Editor PLOS ONE gaoyulin@caas.cn Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set. PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field. Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data. For a full list of recommended repositories, see http://journals.plos.org/plosone/s/data-availability#loc-omics or http://journals.plos.org/plosone/s/data-availability#loc-sequencing. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Amitraz, an acaricide to control varroa mites, affects learning, memory, immunity, and various other physiological processes to honeybees. In this manuscript, the researchers investigated the transcriptome profiles of honeybees after exposure to amitraz for a certain days. The results of this study is potential for further understanding the molecular mechanisms underlying the function of amitraz on honeybees in the future. This manuscript is acceptable, if the authors correct the following mistakes and anwer the related questions. Comments to this manuscript: 1. In the part of Amitraz Treatment (1) the authors did not mention where was the Amitraz used in this experiment from, and lack of the neccessary information of the concentration or the status of purity of the chemical. Please add the related information. (2) In line 89. The authors conducted the experiment with the concentration of amitraz 9.4 mg/L, the problem is whether in this experiment, 9.4 mg/L of the amitraz is the sublethal doses to honeybees. Enven though one reference (Ref 24) listed in the manuscript has shown that in the previous study 9.4 mg/L of the amitraz is the sublethal doses to honeybees. For the reason that in this study, the amitraz maybe different with the chemical which the reference listed. Therefore, please add related information that amitraz 9.4 mg/L is truly sublethal to honeybees in this experiment. (3) The authors used expression of the concentration of amitraz both of “sublethal” and “subchronic”. Are there any difference between sublethal and subchronic? (4) In line 95-96, the authors treated the sample with the method “After 10 d, all bees were collected and placed at 4°C for 5 min to make them dizzy; the bees were then dissected on ice, and the midgut was removed and stored at −80°C”. Why did the authors not use liquid nitrogen to quickly ice the sample before the bees were dissected on ice and stored at -80°C? 2. Line 155-157. “mapped reads were 27,182,392, 21,407,197, 24,815,509, 156 26,929,339, 28,752,629, and 157 27,107,676, respectively”. The number here are confusing, please correct them clearly. 3. Authors choosed midgut and sequenced the midgut by transcriptomic methods to find the changes of the gene expression after exposed the honeybees in amitraz . If possible, please privide reasons why the authors choose the midgut as the target tissue. Some genes such as Antimicrobial peptides (AMPs) normally expressed higher in brain and hymolymph involved in the bees. Please disscussed them accordingly. 4. Please provide the BUSCO analysis of the transcriptome to measure genome assembly and annotation completeness. Moreover, please provide the essential information of the Q20 percentage to show the quality of sequencing reads. Reviewer #2: This paper presents a descriptive study of transcriptomic analysis of honey bees exposed to amitraz treatment, and there are some merits in doing midgut transcriptome of honey bees exposed to amitraz. However, I have some points that require clarification or rewriting, and I hope these comments may be helpful for authors to improver this manuscript. Comments 1. In the introduction part, the authors should provide more information about effects of amitraz on honey bees and more information regarding the function of midgut in honey bees. 2. RNA sequencing data must be deposited in NCBI Sequence Read Archive (SRA), and accession numbers must be provided in the paper. 3. Lines 33-34, please specify upregulated or downregulated in honey bees exposed to amitraz? 4. Line 64, the authors used midgut for transcriptome study, here is an example of a section of the intro that is relevant for the study. The authors should have expanded this part more. 5. Line 80, “a health colony”, how to define a colony is health or not? By the number of varroa mites in the colony or by virus titer of honey bees? Please specify more clearly. 6. Line 85, bee bread or pollen? Bee bread means that the authors collected it directly from the comb. 7. Line 94, why 10 days of treatment? 8. Line 114, it seems that primer pairs in table 1 were used for validation of RNA-seq data, why authors list primer information here? 9. Line 126, why the authors didn’t use the latest version of representative genome of Apis mellifera (assembly Amel_HAv3.1)? 10. Lines 139-140, why these genes were chosen for validating the RNA-seq data? 11. Line, 141, it’s better to use two reference genes for qPCR analysis to obtain rigorous validation data. 12. Line 176, “23 most significantly differentially expressed genes”, these genes were selected by fold change or by p value? Also, the authors said adjusted p value or corrected p value were used for analysis, but in Supp Table, only p values were shown. 13. Line 199, did the authors do amplification efficiencies analysis before using the 2−ΔΔCt method? 14. Lines 226-236, this part of discussion is poor, and the authors just listed references, but didn’t discuss their data with previous studies well. 15. Line 252, “46 CYPs…”, again I suggest the authors should check the latest version of representative genome of Apis mellifera. 16. Overall, in the discussion part, the authors should discuss more about the biological significances of their data in honey bees. Also, the authors discuss little about GO function and KEGG Pathway analysis. 17. Figure 1 is the same to figure 2? Please check. 11 Dec 2019 Response to PLOS ONE Q: 1. We note the following previous request has not been addressed: * We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set. PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field. Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data. A: Thank you for great suggestions. The sequencing data are available in the SRA database (SRR10595519-SRR10595524) of the NCBI system. Response to Reviewers #1 1. In the part of Amitraz Treatment Q: (1) the authors did not mention where was the Amitraz used in this experiment from, and lack of the neccessary information of the concentration or the status of purity of the chemical. Please add the related information. A: Thank you for your suggests. We had added relevant information in the article. Q: (2) In line 89. The authors conducted the experiment with the concentration of amitraz 9.4 mg/L, the problem is whether in this experiment, 9.4 mg/L of the amitraz is the sublethal doses to honeybees. Enven though one reference (Ref 24) listed in the manuscript has shown that in the previous study 9.4 mg/L of the amitraz is the sublethal doses to honeybees. For the reason that in this study, the amitraz maybe different with the chemical which the reference listed. Therefore, please add related information that amitraz 9.4 mg/L is truly sublethal to honeybees in this experiment. A: It is a great suggests. Thank you! We had added the survival curve for treatment for the article (Fig. 1). Analysis this tab, we found that 9.4 mg/L of amitraz was truly sublethal to honeybees in this experiment. Q: (3) The authors used expression of the concentration of amitraz both of “sublethal” and “subchronic”. Are there any difference between sublethal and subchronic? A: Good suggest. Sublethal and subchronic are difference. Sublethal means having an effect less than lethal and is divided into acute and chronic. Subchronic means chronic sublethal. In article, the means of sublethal and subchronic was coinciding with reference. Q: (4) In line 95-96, the authors treated the sample with the method “After 10 d, all bees were collected and placed at 4°C for 5 min to make them dizzy; the bees were then dissected on ice, and the midgut was removed and stored at −80°C”. Why did the authors not use liquid nitrogen to quickly ice the sample before the bees were dissected on ice and stored at -80°C? A: Thank you for your suggests. We had used liquid nitrogen to quickly freeze the sample before the bees were dissected on ice and stored at -80°C, but not write in the article before and the detail information had been provided in materials and methods. Q: 2. Line 155-157. “mapped reads were 27,182,392, 21,407,197, 24,815,509, 156 26,929,339, 28,752,629, and 157 27,107,676, respectively”. The number here are confusing, please correct them clearly. A: Good suggestion. Thank you, This error has been corrected in article. Q: 3. Authors choosed midgut and sequenced the midgut by transcriptomic methods to find the changes of the gene expression after exposed the honeybees in amitraz. If possible, please privide reasons why the authors choose the midgut as the target tissue. Some genes such as Antimicrobial peptides (AMPs) normally expressed higher in brain and hymolymph involved in the bees. Please disscussed them accordingly. A: Midgut is an absorptive organ and the first affected organ for chemical compounds, additionally, the midgut epithelium is responsible for detoxification of ingested xenobiotics. We choose the midgut as the target tissue. AMPs genes normally expressed higher in brain and hymolymph involved in the honey bee, but in this study two AMP genes, encoding apidaecin (Apid1) and glycine-rich cell wall structural protein, were induced in amitraz-treated bees. The gene expression levels of AMPs will affect immunocompetence, therefore in our article we discussed the changes of AMPs gene expression in midgut. Q: 4. Please provide the BUSCO analysis of the transcriptome to measure genome assembly and annotation completeness. Moreover, please provide the essential information of the Q20 percentage to show the quality of sequencing reads. A: Thank you for great suggestions. All necessary informations about the Q20 percentage are provided in S2_Table. Response to Reviewers #2 Q: 1. In the introduction part, the authors should provide more information about effects of amitraz on honey bees and more information regarding the function of midgut in honey bees. . A: Great suggestions. Some detail information of the effects of amitraz and function of midgut on honeybees are provided in introduction. Q: 2. RNA sequencing data must be deposited in NCBI Sequence Read Archive (SRA), and accession numbers must be provided in the paper. A: Thank you for great suggestions. The sequencing data are available in the SRA database (SRR10595519-SRR10595524) of the NCBI system. Q: 3. Lines 33-34, please specify upregulated or downregulated in honey bees exposed to amitraz? A: Thank you for great suggestions. The specify DEGs are showed in Table S4 in results. Q: 4. Line 64, the authors used midgut for transcriptome study, here is an example of a section of the intro that is relevant for the study. The authors should have expanded this part more. A: We have expanded this part more. Q: 5. Line 80, “a health colony”, how to define a colony is health or not? By the number of varroa mites in the colony or by virus titer of honey bees? Please specify more clearly. A: Greet suggests. All honeybees were collected from a strong colony. All bee samples were strong and not infected with the parasite. Q: 6. Line 85, bee bread or pollen? Bee bread means that the authors collected it directly from the comb. A: We provided pollen to feed honeybees in this study and revised it inmethod part. Q: 7. Line 94, why 10 days of treatment? A: We are according to methods previously reported by Shi et al.(2017), and many studies research the effect of xenobiotics on honey bee by treated 10 days(O’Neal, Scott T et al., 2017; Du Yali et al., 2019) Q: 8. Line 114, it seems that primer pairs in table 1 were used for validation of RNA-seq data, why authors list primer information here? A: Sorry. Table 1 was appeared in the wrong place and we have revised it in article. Q: 9. Line 126, why the authors didn’t use the latest version of representative genome of Apis mellifera (assembly Amel_HAv3.1)? A: Sorry. Actually we truly use the latest version of representative genome of Apis mellifera (assembly Amel_HAv3.1) and we have revised it in article Q: 10. Lines 139-140, why these genes were chosen for validating the RNA-seq data? A: Firstly, the expression of these genes were significant different. Secondly, they were involved in the immunity and growth of honeybee. Q: 11. Line, 141, it’s better to use two reference genes for qPCR analysis to obtain rigorous validation data. A: Thank you for suggests. We had added an experiment by used other reference gene (β-actin) for qPCR analysis and showed in results. Q: 12. Line 176, “23 most significantly differentially expressed genes”, these genes were selected by fold change or by p value? Also, the authors said adjusted p value or corrected p value were used for analysis, but in Supp Table, only p values were shown. A: Thank you for suggests. Yes, these genes were selected by p value. We had added information and improved our Supp Table 5. Q: 13. Line 199, did the authors do amplification efficiencies analysis before using the 2−ΔΔCt method? A: Yes, we did. Thank you. Q: 14. Lines 226-236, this part of discussion is poor, and the authors just listed references, but didn’t discuss their data with previous studies well. A: Thank you for great suggestions. The discussion had been enriched. Q: 15. Line 252, “46 CYPs…”, again I suggest the authors should check the latest version of representative genome of Apis mellifera. A: Thank you for great suggestions. We check the number, there are only 46 CYPs in genome of A. mellifera (Johnson 2012), and we do not found new CYP genes in honeybee at 2012 to 2019. However we revised the sentence to “Honey bee are known to have the far fewer number of CYP family genes than other insect.” Q: 16. Overall, in the discussion part, the authors should discuss more about the biological significances of their data in honey bees. Also, the authors discuss little about GO function and KEGG Pathway analysis. A: Great suggestions. The discussion part had been enriched Q: 17. Figure 1 is the same to figure 2? Please check. A: Sorry. The fig 1 was the same to fig 2, we deleted the fig 1 and replaced it with venn diagram. Submitted filename: Response to Reviewers.docx Click here for additional data file. 2 Jan 2020 PONE-D-19-30792R1 Transcriptomic Analysis to Elucidate the Response of Honeybees (Hymenoptera: Apidae) to Amitraz Treatment PLOS ONE Dear Dr Yu, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Feb 16 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Yulin Geo Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: I Don't Know ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors corrected all the mistakes in the manuscript according to the reviewers' comments. It is acceptable for publication. Reviewer #2: Comments for PONE-D-19-30792R1: 1. Page 5, lines 87-88, the first major methodological concern that I have concerns the use of just one colony for the study. I see this as a major flaw in the experimental design, as everybody working with social insects like honeybees should know that some replications is always needed at the colony level in addition to replication at the individual level. At least two or three colonies are always recommended for any type of study on social insects if the authors want to obtain results that can be generalized. In fact, all individuals within the same colonies are highly related genetically, and therefore there might be a specific effect of that colony affecting the results and the authors will not be able to identify these effects. 2. Page 5, line 102, a second major methodological concern that I have concerns the use of acetone in amitraz-treated bees, but only sucrose–water solution was used in untreated bees. Amitraz was dissolved in acetone, so acetone-treated control bees should be used in the study. Therefore, acetone might have effects on gene expression of honey bees, and the authors will not be able to distinguish whether changing in gene expression is due to amitraz or acetone. 3. Page 8, line 159, because 2−ΔΔCt method was used, please show amplification efficiency of each primer in the manuscript. 4. Page 13, line 240-241, only RPS5 was used? ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 2 Jan 2020 Response to Reviewers #1 Thank you for your comments. Response to Reviewers #2 Q: 1. Page 5, lines 87-88, the first major methodological concern that I have concerns the use of just one colony for the study. I see this as a major flaw in the experimental design, as everybody working with social insects like honeybees should know that some replications is always needed at the colony level in addition to replication at the individual level. At least two or three colonies are always recommended for any type of study on social insects if the authors want to obtain results that can be generalized. In fact, all individuals within the same colonies are highly related genetically, and therefore there might be a specific effect of that colony affecting the results and the authors will not be able to identify these effects. A: Great suggestions. Compared to treatment in only one colony, several colonies have a advantage of genetical diversity and avoid a specific effect of one colony. Some study researched the influence of environment stress above physiological response[1-3]. However, in the past decade several studies choose honey bees which was from same colony as samples [4-8]. Reference those studies, we explored the effect of amitraz on honeybees to by treat the honey bees from same colony. Q: 2. Page 5, line 102, a second major methodological concern that I have concerns the use of acetone in amitraz-treated bees, but only sucrose–water solution was used in untreated bees. Amitraz was dissolved in acetone, so acetone-treated control bees should be used in the study. Therefore, acetone might have effects on gene expression of honey bees, and the authors will not be able to distinguish whether changing in gene expression is due to amitraz or acetone. A: Thank you for great suggestions. We had acetone-treated control bees in the study, and revised in materials and methods. Q: 3. Page 8, line 159, because 2−ΔΔCt method was used, please show amplification efficiency of each primer in the manuscript. A: Thank you for great suggestions. We added amplification efficiency of each primer in Table 1 Q: 4. Page 13, line 240-241, only RPS5 was used? A: Sorry, this a mistake here. We truly use two reference genes (Rps5 and β-actin) for qPCR and we have revised it in article. 1. Rutter L, Carrillo-Tripp J, Bonning BC, Cook D, Toth AL, Dolezal AG. Transcriptomic responses to diet quality and viral infection in Apis mellifera. BMC Genomics. 2019;20(1):412. Epub 2019/05/24. doi: 10.1186/s12864-019-5767-1. PubMed PMID: 31117959; PubMed Central PMCID: PMCPMC6532243. 2. Zhu L, Qi S, Xue X, Niu X, Wu L. Nitenpyram disturbs gut microbiota and influences metabolic homeostasis and immunity in honey bee (Apis mellifera L.). Environ Pollut. 2019;258:113671. Epub 2019/12/20. doi: 10.1016/j.envpol.2019.113671. PubMed PMID: 31855676. 3. Mondet F, Rau A, Klopp C, Rohmer M, Severac D, Le Conte Y, et al. Transcriptome profiling of the honeybee parasite Varroa destructor provides new biological insights into the mite adult life cycle. BMC Genomics. 2018;19(1):328. Epub 2018/05/08. doi: 10.1186/s12864-018-4668-z. PubMed PMID: 29728057; PubMed Central PMCID: PMCPMC5936029. 4. Alburaki M, Karim S, Lamour K, Adamczyk J, Stewart SD. RNA-seq reveals disruption of gene regulation when honey bees are caged and deprived of hive conditions. The Journal of Experimental Biology. 2019;222(18). doi: 10.1242/jeb.207761. 5. Christen V, Schirrmann M, Frey JE, Fent K. Global Transcriptomic Effects of Environmentally Relevant Concentrations of the Neonicotinoids Clothianidin, Imidacloprid, and Thiamethoxam in the Brain of Honey Bees ( Apis mellifera). Environ Sci Technol. 2018;52(13):7534-44. Epub 2018/06/01. doi: 10.1021/acs.est.8b01801. PubMed PMID: 29851480. 6. Shi TF, Wang YF, Liu F, Qi L, Yu LS. Sublethal Effects of the Neonicotinoid Insecticide Thiamethoxam on the Transcriptome of the Honey Bees (Hymenoptera: Apidae). J Econ Entomol. 2017;110(6):2283-9. Epub 2017/10/19. doi: 10.1093/jee/tox262. PubMed PMID: 29040619. 7. Emery O, Schmidt K, Engel P. Immune system stimulation by the gut symbiont Frischella perrara in the honey bee (Apis mellifera). Mol Ecol. 2017;26(9):2576-90. Epub 2017/02/17. doi: 10.1111/mec.14058. PubMed PMID: 28207182. 8. Mao W, Schuler MA, Berenbaum MR. Disruption of quercetin metabolism by fungicide affects energy production in honey bees (Apis mellifera). Proc Natl Acad Sci U S A. 2017;114(10):2538-43. Epub 2017/02/15. doi: 10.1073/pnas.1614864114. PubMed PMID: 28193870; PubMed Central PMCID: PMCPMC5347564. Submitted filename: Response to Reviewers.docx Click here for additional data file. 17 Jan 2020 PONE-D-19-30792R2 Transcriptomic Analysis to Elucidate the Response of Honeybees (Hymenoptera: Apidae) to Amitraz Treatment PLOS ONE Dear Dr Yu, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Mar 02 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Yulin Gao Academic Editor PLOS ONE Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #2: Comments for PONE-D-19-30792R2: 1. Lines 87-88, ‘a healthy colony’ should be ‘an apparently healthy colony’. 2. Lines 153, where is the total RNA for qPCR validation from? How many replicates were used for qPCR validation? More details needed here. 3. Line 157, for Table 1, the author should cite references if primer sequences were from published papers. Also, please check the primer sequences carefully, the reverse primer sequences of actin is wrong. 4. Line 181, ‘…were calculated using result in S2 Table’? Please check and rephrase the sentence. 5. Line 224, I got confused with the qPCR analysis result, the authors calculated the expression level of the gene of interest using RPS5 and actin respectively, and the qPCR data was shown in fig5a and 5b respectively. Actually, the authors should calculate the geometric mean of references genes first and then calculate the expression level of each target gene based on the geometric mean of references genes. Please refer to (Garrido et al., 2013; Wu et al., 2017). 6. Lines 260-262, Please cite references here. Also, should be “… in different developmental stages of honey bees”. 7. Lines 262-264, this sentence just repeats the content of lines 260-262 and is redundant. Please delete or rephrase the sentence. 8. Line 265, ‘Thiamethoxam treated honey…exposed to either thiamethoxam…’, again further treated with the same pesticide? Please check. 9. Lines 265-266, gene names and Nosema should be printed in italics. 10. Line 267, why the authors conclude that glycine-rich cell wall structural protein is antimicrobial peptides. 11. Lines 287-290, the content regarding phytochemical metabolism, furanocoumarins, and quercetin is not closely related to the topic of this study. Please delete. 12. Line 297, ‘…were significantly upregulated in susceptible strain…’? Please specify. 13. As I mentioned earlier, the authors should discuss more about GO function and KEGG pathway analysis in the discussion part. 14. The author should incorporate the response to reviewer comments into the revised manuscript. For example, the justification for only one colony was used for sample preparation in the study. 19 Jan 2020 Response to Reviewers #2 Q: 1. Lines 87-88, ‘a healthy colony’ should be ‘an apparently healthy colony’. A: Thank you for great suggestions. We have revised it in article Q: 2. Lines 153, where is the total RNA for qPCR validation from? How many replicates were used for qPCR validation? More details needed here. A: Great suggestions. The total RNA for qPCR is the same as the total RNA for RNA-seq. We used three replicates for qPCR validation. We have added relevant information in the article. Q: 3. Line 157, for Table 1, the author should cite references if primer sequences were from published papers. Also, please check the primer sequences carefully, the reverse primer sequences of actin is wrong. A: Sorry. The reverse primer sequences of actin is wrong, we have revised it and cite references in article. Q: 4. Line 181, ‘…were calculated using result in S2 Table’? Please check and rephrase the sentence. A: Thank you for good suggestions. We have rephrased this sentence in article. Q: 5. Line 224, I got confused with the qPCR analysis result, the authors calculated the expression level of the gene of interest using RPS5 and actin respectively, and the qPCR data was shown in fig5a and 5b respectively. Actually, the authors should calculate the geometric mean of references genes first and then calculate the expression level of each target gene based on the geometric mean of references genes. Please refer to (Garrido et al., 2013; Wu et al., 2017). A: Thank you for great suggestions. Refer to this way, we make a new fig to show our qPCR results. Q: 6. Lines 260-262, Please cite references here. Also, should be “… in different developmental stages of honey bees”. A: Great suggestions. We have revised it and add relevant information in the article. Q: 7. Lines 262-264, this sentence just repeats the content of lines 260-262 and is redundant. Please delete or rephrase the sentence. A: It is a great suggests. Thank you! We have rephrased the sentence in the article. Q: 8. Line 265, ‘Thiamethoxam treated honey…exposed to either thiamethoxam…’, again further treated with the same pesticide? Please check. A: Thank you for great suggestions. We check this referenc, they again further treated with the same pesticide truly. Q: 9. Lines 265-266, gene names and Nosema should be printed in italics. A: Good suggestions. We have revised it in article Q: 10. Line 267, why the authors conclude that glycine-rich cell wall structural protein is antimicrobial peptides. A: Sorry, we have revised it in article Q: 11. Lines 287-290, the content regarding phytochemical metabolism, furanocoumarins, and quercetin is not closely related to the topic of this study. Please delete. A: Thank you for great suggestions. We have deleted it in article Q: 12. Line 297, ‘…were significantly upregulated in susceptible strain…’? Please specify. A: It is a great suggests. Thank you! We have specified it in article. Q: 13. As I mentioned earlier, the authors should discuss more about GO function and KEGG pathway analysis in the discussion part. A: Great suggestions. The discussion part had been enriched Q: 14. The author should incorporate the response to reviewer comments into the revised manuscript. For example, the justification for only one colony was used for sample preparation in the study. A: Great suggestions. We have incorporated the response to reviewer comments into the revised manuscript. Submitted filename: Response to Reviewers.docx Click here for additional data file. 28 Jan 2020 Transcriptomic Analysis to Elucidate the Response of Honeybees (Hymenoptera: Apidae) to Amitraz Treatment PONE-D-19-30792R3 Dear Dr. Yu, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Yulin Gao Academic Editor PLOS ONE 28 Feb 2020 PONE-D-19-30792R3 Transcriptomic analysis to elucidate the response of honeybees (Hymenoptera: Apidae) to amitraz treatment Dear Dr. Yu: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Yulin Gao Academic Editor PLOS ONE
  60 in total

1.  Multiple sites of associative odor learning as revealed by local brain microinjections of octopamine in honeybees.

Authors:  M Hammer; R Menzel
Journal:  Learn Mem       Date:  1998 May-Jun       Impact factor: 2.460

Review 2.  Basophil-activation tests in Hymenoptera allergy.

Authors:  Anthony E J Dubois; Sicco van der Heide
Journal:  Curr Opin Allergy Clin Immunol       Date:  2007-08

3.  Esterase isozymes of Apis mellifera: substrate and inhibition characteristics, developmental ontogeny, and electrophoretic variability.

Authors:  M M Bitondi; M A Mestriner
Journal:  Biochem Genet       Date:  1983-10       Impact factor: 1.890

4.  Effects of three common pesticides on survival, food consumption and midgut bacterial communities of adult workers Apis cerana and Apis mellifera.

Authors:  Yang Yang; Shilong Ma; Zhenxiong Yan; Feng Liu; Qingyun Diao; Pingli Dai
Journal:  Environ Pollut       Date:  2019-03-27       Impact factor: 8.071

5.  Synergistic interactions between in-hive miticides in Apis mellifera.

Authors:  Reed M Johnson; Henry S Pollock; May R Berenbaum
Journal:  J Econ Entomol       Date:  2009-04       Impact factor: 2.381

6.  Enzymatic biomarkers as tools to assess environmental quality: a case study of exposure of the honeybee Apis mellifera to insecticides.

Authors:  Stephan M Carvalho; Luc P Belzunces; Geraldo A Carvalho; Jean-Luc Brunet; Alexandra Badiou-Beneteau
Journal:  Environ Toxicol Chem       Date:  2013-07-18       Impact factor: 3.742

7.  The prpZ gene cluster encoding eukaryotic-type Ser/Thr protein kinases and phosphatases is repressed by oxidative stress and involved in Salmonella enterica serovar Typhi survival in human macrophages.

Authors:  Sébastien P Faucher; Charles Viau; Pierre-Paul Gros; France Daigle; Hervé Le Moual
Journal:  FEMS Microbiol Lett       Date:  2008-02-27       Impact factor: 2.742

8.  Dilp8 requires the neuronal relaxin receptor Lgr3 to couple growth to developmental timing.

Authors:  Andres Garelli; Fabiana Heredia; Andreia P Casimiro; Andre Macedo; Catarina Nunes; Marcia Garcez; Angela R Mantas Dias; Yanel A Volonte; Thomas Uhlmann; Esther Caparros; Takashi Koyama; Alisson M Gontijo
Journal:  Nat Commun       Date:  2015-10-29       Impact factor: 14.919

9.  Sublethal effects of acaricides and Nosema ceranae infection on immune related gene expression in honeybees.

Authors:  Paula Melisa Garrido; Martín Pablo Porrini; Karina Antúnez; Belén Branchiccela; Giselle María Astrid Martínez-Noël; Pablo Zunino; Graciela Salerno; Martín Javier Eguaras; Elena Ieno
Journal:  Vet Res       Date:  2016-04-26       Impact factor: 3.683

10.  Evolutionary conservation of early mesoderm specification by mechanotransduction in Bilateria.

Authors:  Thibaut Brunet; Adrien Bouclet; Padra Ahmadi; Démosthène Mitrossilis; Benjamin Driquez; Anne-Christine Brunet; Laurent Henry; Fanny Serman; Gaëlle Béalle; Christine Ménager; Frédéric Dumas-Bouchiat; Dominique Givord; Constantin Yanicostas; Damien Le-Roy; Nora M Dempsey; Anne Plessis; Emmanuel Farge
Journal:  Nat Commun       Date:  2013       Impact factor: 14.919

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.