Literature DB >> 32128119

Genomic signatures of host-associated divergence and adaptation in a coral-eating snail, Coralliophila violacea (Kiener, 1836).

Sara E Simmonds1, Allison L Fritts-Penniman1, Samantha H Cheng1,2, Gusti Ngurah Mahardika3, Paul H Barber1.   

Abstract

The fluid nature of the ocean, combined with planktonic dispersal of marine larvae, lowers physical barriers to gene flow. However, divergence can still occur despite gene flow if strong selection acts on populations occupying different ecological niches. Here, we examined the population genomics of an ectoparasitic snail, Coralliophila violacea (Kiener 1836), that specializes on Porites corals in the Indo-Pacific. Previous genetic analyses revealed two sympatric lineages associated with different coral hosts. In this study, we examined the mechanisms promoting and maintaining the snails' adaptation to their coral hosts. Genome-wide single nucleotide polymorphism (SNP) data from type II restriction site-associated DNA (2b-RAD) sequencing revealed two differentiated clusters of C. violacea that were largely concordant with coral host, consistent with previous genetic results. However, the presence of some admixed genotypes indicates gene flow from one lineage to the other. Combined, these results suggest that differentiation between host-associated lineages of C. violacea is occurring in the face of ongoing gene flow, requiring strong selection. Indeed, 2.7% of all SNP loci were outlier loci (73/2,718), indicative of divergence with gene flow, driven by adaptation of each C. violacea lineage to their specific coral hosts.
© 2020 The Authors. Ecology and Evolution published by John Wiley & Sons Ltd.

Entities:  

Keywords:  RAD‐seq; adaptation; coral reefs; ecological divergence; gastropods; population genomics

Year:  2020        PMID: 32128119      PMCID: PMC7042750          DOI: 10.1002/ece3.5977

Source DB:  PubMed          Journal:  Ecol Evol        ISSN: 2045-7758            Impact factor:   2.912


INTRODUCTION

While ecological speciation has been documented for almost three decades across a wide variety of organisms on land (Case & Willis, 2008; Feder et al., 1994; Jiggins, 2008; Martin et al., 2013; Schluter, 2009; Seehausen et al., 2008; Sorenson, Sefc, & Payne, 2003; Thorpe, Surget‐Groba, & Johansson, 2010; Waser & Campbell, 2004) and in freshwater (Hatfield & Schluter, 1999; Langerhans, Gifford, & Joseph, 2007; Puebla, 2009; Seehausen et al., 2008; Seehausen & Wagner, 2014), ecological speciation in the ocean was thought to be rare, and only recently has that viewpoint begun to change (Bird, Fernandez‐Silva, Skillings, & Toonen, 2012; Bird, Holland, Bowen, & Toonen, 2011; Bowen, Rocha, Toonen, Karl, & ToBo Laboratory, 2013; Foote & Morin, 2015; Hurt, Silliman, Anker, & Knowlton, 2013; Ingram, 2010; Litsios et al., 2012; Rocha, Robertson, Roman, & Bowen, 2005). There are a number of reasons for this reassessment. First, absolute physical barriers in the sea are exceedingly rare (Ludt & Rocha, 2015; Rocha & Bowen, 2008; Rocha et al., 2005). As a result, speciation must often proceed with varying levels of gene flow and aided by divergent selection in different habitats or hosts (Palumbi, 1994). Second, the strong interspecific interactions that can promote ecological speciation in terrestrial species (e.g., host–parasite, mutualisms) are also common in certain marine ecosystems (Blackall, Wilson, & van Oppen, 2015; Stella, Jones, & Pratchett, 2010). For example, reef‐building corals have tight ecological associations with a wide variety of invertebrate taxa (Zann, 1987), including ~900 named species of sponges, copepods, barnacles, crabs, shrimp, worms, bivalves, nudibranchs, and snails (reviewed by Stella et al., 2010). This wide array of symbiotic relationships creates tremendous potential for host shifting and the development of host specificity that can lead to sympatric speciation. Evidence from traditional genetic markers (i.e., microsatellites, RFLPs, allozymes, nuclear, mitochondrial, and ribosomal genes) demonstrates the potential for ecological speciation in marine taxa exhibiting symbiotic relationships (Bowen et al., 2013; Miglietta, Faucci, & Santini, 2011; Peijnenburg & Goetze, 2013; Potkamp & Fransen, 2019), including amphipods on macroalgae (Sotka, 2005), coral‐dwelling barnacles (Tsang, Chan, Shih, Chu, & Allen Chen, 2009), coral‐eating nudibranchs (Faucci, Toonen, & Hadfield, 2007; Fritts‐Penniman, Gosliner, Mahardika, & Barber, 2020), parasitic snails (Gittenberger & Gittenberger, 2011; Reijnen, Hoeksema, & Gittenberger, 2010), anemone‐associated shrimp (Hurt et al., 2013), anemone fish (Litsios et al., 2012), and coral‐dwelling gobies (Duchene, Klanten, Munday, Herler, & van Herwerden, 2013; Munday, van Herwerden, & Dudgeon, 2004). While encouraging, there are gaps in our knowledge that with the expansion of genomic technologies, we are now in a position to begin to fill. Detecting signatures of natural selection in populations where there is likely ongoing gene flow is now possible using genome‐wide data, lending insight into the mechanisms of ecological speciation (Bernal, Gaither, Simison, & Rocha, 2017; Campbell, Poelstra, & Yoder, 2018; Puebla, Bermingham, & McMillan, 2014; Westram et al., 2018). To date, however, no studies examining the genomic signatures of ecological divergence in marine host–parasite systems have been conducted. The ~6 million km2 Coral Triangle region is home to over 500 species of reef‐building corals (Veron et al., 2011) and thousands of unique species of fishes and invertebrates (Barber & Boyce, 2006; Briggs, 2003), making it the global center of marine biodiversity (Cowman & Bellwood, 2011; Hoeksema, 2007). Most of the literature examining the evolution of this biodiversity hotspot has focused on allopatric processes such as divergence across geological and oceanographic features such as the Sunda Shelf or Halmahera Eddy during Pleistocene low sea levels stands (for reviews, see Barber, Cheng, Erdmann, Tenggardjaja, & Ambariyanto 2011; Carpenter et al., 2011; Gaither & Rocha, 2013). Allopatric divergence is clearly an important factor in the biodiversity of the Coral Triangle. However, the extraordinary diversity in this region, combined with the prevalence of strong species–species interactions on coral reefs, makes it likely that ecological speciation also contributes to the evolution of biodiversity in this hotspot. The marine snail, Coralliophila violacea (Figure 1), is an obligate ectoparasite, living, feeding, and reproducing exclusively on corals in Poritidae, a highly abundant and diverse coral family (Kitahara, Cairns, Stolarski, Blair, & Miller, 2010), which is found in shallow reefs across the tropical Indo‐Pacific. The snails attach themselves to their host, form feeding aggregations, and drain energy from their host as it tries to repair damaged tissues (Oren, Brickner, & Loya, 1998). They are sequential hermaphrodites, a common trait of parasitic mollusks (Heller, 1993), and breed with conspecifics on their host coral colony. Two genetically distinct lineages of C. violacea occur sympatrically on reefs of the Coral Triangle, but each lineage occupies one of two groups of Porites corals, suggesting ecological divergence (Simmonds et al., 2018). A lack of evidence of genetic structure within each lineage of C. violacea inside the Coral Triangle precludes physical isolation as an explanation for the observed divergence. Host specificity commonly results from preferential larval settlement (Ritson‐Williams, Shjegstad, & Paul, 2003, 2007, 2009). This genetic evidence combined with observations of adult preference for specific coral hosts (unpubl. data S. Simmonds) strongly suggests ecological divergence driven by host association.
Figure 1

Violet coral snails, (a) Coralliophila violacea (Kiener, 1836), are obligate ectoparasites of corals in the family Poritidae. Their shells are usually fouled with crustose coralline algae because of their sedentary lifestyle, making them difficult to spot on their host corals. They are commonly found living among the branches of species such as (b) Porites cylindrica and can form aggregations on massive coral species like (c) P. lobata. (Photos by S.E. Simmonds)

Violet coral snails, (a) Coralliophila violacea (Kiener, 1836), are obligate ectoparasites of corals in the family Poritidae. Their shells are usually fouled with crustose coralline algae because of their sedentary lifestyle, making them difficult to spot on their host corals. They are commonly found living among the branches of species such as (b) Porites cylindrica and can form aggregations on massive coral species like (c) P. lobata. (Photos by S.E. Simmonds) To determine where diverging populations of C. violacea lie on the continuum of the speciation process (i.e., host‐associated lineages, sibling species or good species), it is important to examine patterns of realized gene flow between the divergent coral host‐associated lineages. Effective contemporary gene flow should result in linkage disequilibria between host‐associated marker loci in populations utilizing different hosts. However, if lower rates of gene flow (<1% per generation) are found, then populations should be considered incipient species (Drès & Mallet, 2002; Malausa et al., 2007). Genomic tests of selection are key to distinguishing between these possibilities. If divergence among C. violacea lineages results purely from neutral processes, genetic drift and migration should have approximately equal effects on all parts of the genome (Nielsen, 2005), and frequencies of neutral loci should show similar levels of differentiation (Via, 2009). However, if divergent selection is driving diversification of C. violacea lineages, there should be clear signatures of divergent selection (Feder et al., 1994; Nosil, Funk, & Ortiz‐Barrientos, 2009), because natural selection affects non‐neutral parts of the genome, as well as linked loci, to a greater extent (Smith & Haigh, 1974). As such, frequencies of loci under selection (outlier loci) or linked loci should either be unusually high or unusually low, in host‐associated populations, depending on the type of selection occurring (Beaumont & Nichols, 1996). In this study, we use genome‐wide single nucleotide polymorphisms (SNPs) to investigate the possibility of ecological divergence with gene flow in populations of a corallivorous gastropod, C. violacea, from the Coral Triangle. Specifically, we (a) test for reduced gene flow between sympatric lineages of host‐associated snails, (b) identify outlier loci under putative selection between hosts, and (c) annotate possible functions of linked genes that might be necessary for adaptation to hosts.

MATERIALS AND METHODS

Sample collection

We collected snails on snorkel during 2011–2013 from six sympatric populations of two lineages of C. violacea representing unique parasite–host groups (Table 1, Figure 2, Appendix S1). We chose snails from the most abundant Porites species from each group (P. lobata, P. cylindrica, Dana, 1846, Figure 1) to maximize the number of samples and reduce potentially confounding effects of differences among hosts within the same group. To further reduce confounding effects resulting from taxonomic complexity within P. lobata (Forsman, Barshis, Hunter, & Toonen, 2009; Prada et al., 2014), we used coral host species identifications from Simmonds et al. (2018) that were confirmed through RAD‐seq data.
Table 1

Coralliophila violacea collection locations, latitude, longitude, coral host species, and number of samples collected

LocationCountryProvinceLatitudeLongitudeCoral host species
Porites lobata Porites cylindrica
1. PemuteranIndonesiaBali−8.1400114.65407
2. Nusa PenidaIndonesiaBali−8.6750115.51301110
3. Pulau MengyatanIndonesiaEast Nusa Tenggara−8.5570119.685043
4. LembehIndonesiaNorth Sulawesi1.4790125.251071
5. BunakenIndonesiaNorth Sulawesi1.6120124.783096
6. DumaguetePhilippinesNegros Oriental9.3320123.312027
    Total N 3334
Figure 2

Collection locations for Coralliophila violacea from coral host species Porites lobata and P. cylindrica. 1. Pemuteran, 2. Nusa Penida, 3. Pulau Mengyatan, 4. Lembeh, 5. Bunaken, 6. Dumaguete. Map made with vector and raster map data available at http://naturalearthdata.com

Coralliophila violacea collection locations, latitude, longitude, coral host species, and number of samples collected Collection locations for Coralliophila violacea from coral host species Porites lobata and P. cylindrica. 1. Pemuteran, 2. Nusa Penida, 3. Pulau Mengyatan, 4. Lembeh, 5. Bunaken, 6. Dumaguete. Map made with vector and raster map data available at http://naturalearthdata.com

Creation of RAD libraries

We extracted genomic DNA from 20 mg of foot tissue from 67 individual C. violacea (34 from P. cylindrica and 33 from P. lobata; Table 1) using a DNeasy® Blood and Tissue Kit (QIAGEN), following manufacturer's instructions, save for elution of DNA with molecular grade H2O rather than AE buffer. We estimated initial DNA concentrations using a NanoDrop™ 2000 Spectrophotometer (Thermo Scientific™) and visualized DNA quality on a 1% agarose gel stained with SYBR® Safe DNA Gel Stain (Invitrogen™). We used only high‐quality DNA with a bright high molecular weight band and minimal smearing. We dried DNA extractions using a SpeedVac™ (Thermo Scientific™) on medium heat and reconstituted using molecular grade H2O to a final uniform 250 ng/µl DNA concentration. We created reduced representation libraries to survey SNP variation following published protocols (Wang, Meyer, McKay, & Matz, 2012) as updated by Dr. Eli Meyer (http://people.oregonstate.edu/~meyere/docs/Preparing2bRAD.pdf). AlfI restriction enzyme digest reduced representation (1/16th) libraries were labeled with individual barcodes and subjected to 18–20 PCR amplification cycles. The number of PCR cycles varied based on the optimal number determined in the test‐scale PCR to find the minimum number of cycles to produce a visible product at 166 bp. We electrophoresed products on a 2% agarose gel in 1 × TBE buffer and ran at 150 V for 90 min, visualized target bands (165 bp) with SYBR® Safe DNA Gel Stain (Invitrogen™), and excised them from the gel. Then, we purified the excised bands using a QIAquick® Gel Extraction Kit (QIAGEN). A final cleaning step used Agencourt® AMPure® XP beads (Beckman Coulter). QB3 Genomics at the University of California, Berkeley performed quality checks (qPCR, BioAnalyzer) and sequencing, multiplexing 10–20 snails per lane in 5 lanes of a 50 bp Single‐End run on an Illumina HiSeq 2000 sequencer.

RAD‐seq data processing

To prepare raw sequence data for SNP identification, we truncated all raw sequence reads to the insert size (36 bp), filtered for quality (PHRED scores >20), and discarded empty constructs. We then processed the resulting data using custom scripts written by Misha Matz, available on the 2bRAD GitHub site (https://github.com/z0on/2bRAD_denovo). First, we counted unique tag sequences (minimum sequencing depth 5×) and the number of sequences in reverse‐complement orientation and then merged these tags into one table. Then, we clustered all sequences in CD‐HIT (Fu, Niu, Zhu, Wu, & Li, 2012) using a 91% similarity threshold. Next, we defined the most abundant sequence in the cluster as a reference sequence and then filtered a locus‐annotated table from the previous two steps, excluding reads below 5× depth and those exhibiting strand bias. Lastly, we flipped the orientation of the resulting clustered sequences to match the most abundant tag in a cluster. To call genotypes (as population‐wide RAD‐tag haplotypes), we used GATK (McKenna et al., 2010) and applied mild allele filters (10× total depth, allele bias cutoff 10, and strand bias cutoff 10), with the additional requirement that alleles appear in at least two individuals. We then applied locus filters allowing a maximum of 50% heterozygotes at a locus, no more than two alleles, genotyped in 30% of samples and polymorphic. Finally, we removed loci with the fraction of heterozygotes >75% (potential lumped paralogs) and missing >70% of genotypes. The final set of SNPs was then thinned to one per tag (that with the highest minor allele frequency) for F ST and STRUCTURE analysis to remove linked loci.

Individual sample filtering steps

To maximize the quality of the final dataset, we further filtered out individuals (N = 11) with low genotyping rates, indicating low DNA quality, by taking the log10 of the number of sites genotyped per individual, and removing any individuals that were outside one standard deviation (SD) of the mean. We used VCFtools (Danecek et al., 2011) to estimate inbreeding coefficients and removed individuals (N = 5) with inbreeding coefficients outside the normal range (±2 SD of mean F) indicating possible low coverage sequencing or lumped paralogs (https://github.com/z0on/2bRAD_denovo). The remaining 51 individuals were used in analyses of population genetic structure. The final data file was in VCF format and converted to other formats using PGDSpider v2.0.8.0 (Lischer & Excoffier, 2012).

Genetic structure

To test whether the patterns observed in a mitochondrial locus were present in loci genome‐wide, we inferred the population genetic structure of the full RAD‐seq dataset (2,718 loci), outlier loci only (73 loci), and neutral loci only (2,645 loci), from 51 individuals using two methods. First, we ran the Bayesian model‐based clustering method STRUCTURE (Pritchard, Stephens, & Donnelly, 2000) using a burn‐in period of 20,000 followed by 50,000 MCMC replicates for K = 1–12, and 10 runs for each K. We used the admixture model, with allele frequencies correlated among populations. The results from STRUCTURE were then analyzed in CLUMPAK v1.1 (Kopelman, Mayzel, Jakobsson, Rosenberg, & Mayrose, 2015) to select for the best K and graphically display the results.

Outlier analyses

To test for evidence of natural selection in relation to coral host, we compared SNPs between lineages of snails on different hosts, pooled across six localities, with two datasets: (a) including all individuals and (b) excluding migrants and admixed individuals that we identified using STRUCTURE. First, we performed an outlier loci analysis using BayeScan v2.1 (Foll & Gaggiotti, 2008) with a prior of 10, a sample size of 5,000, and 100,000 iterations, using a burn‐in of 50,000, and 20 pilot runs of 5,000 each. To explore the impact of misleading data, we employed a 10% false discovery rate. To further explore outlier loci, we used a second method to detect loci under selection (FDIST2) as implemented in ARLEQUIN (Excoffier & Lischer, 2010). We ran 100 demes per group and 50 groups for 50,000 simulations. This model compares a simulated neutral distribution of F ST to the observed distribution and identifies outliers. Loci with significant F ST p values (<0.01) were considered to be under selection (Excoffier & Lischer, 2010).

Candidate gene identification and annotation

To annotate the putative functions of genes linked to outlier loci, we aligned sequences containing SNP outlier loci to nucleotide collections (nr/nt) available on the NCBI website, in Blast2GO 5 Basic version (October 7, 2019) using the BLASTn algorithm (Altschul et al., 1997) with a taxonomic filter for Mollusca (taxid:6447). We adjusted parameters (expected threshold 10, word size 7, no low complexity filter, no mask for look‐up table only) to accommodate short read sequences. We only examined hits with a high query coverage (>80%). Then, we identified and annotated any associated genes using NCBI and GeneCards®.

RESULTS

After removing empty constructs and filtering for quality, we obtained an average of 5,710,091 unique sequence reads per individual at a minimum 5× depth. In total, we sequenced and genotyped 17,676 high‐quality RAD‐seq loci with ≥25× coverage, in 67 snails collected from two different coral host species, at six locations. After filtering for 30% maximum missing data per locus, this total decreased to 5,999 loci and then to 2,718 SNPs following thinning to one SNP per loci to remove any physically linked SNPs for STRUCTURE and F ST analyses. Next, we removed 16 individuals that had either low DNA quality (missing data ≥ +1SD from the mean) or potential contamination issues (inbreeding coefficient ≥ +2SD from the mean), leaving 51 individuals. Tests of genetic differentiation between sympatric snail lineages on different coral hosts revealed moderate but significant structure (mean F ST = 0.047, weighted F ST = 0.090 (Weir & Cockerham, 1984)), between host‐associated lineages of snails (Figure 3). CLUMPAK analysis of the STRUCTURE results indicated K = 2 as the best K value (Appendix S2). At K = 2, the majority (88%) of all snails grouped by their coral host (Figure 4). Grouping by host was stronger in snails collected from P. lobata (97%) than from P. cylindrica (79%). Neutral loci (2,645) and outlier loci only (73) showed similar patterns of population structure in STRUCTURE to the full dataset of SNPs (Appendix S3).
Figure 3

Histogram of variation in F ST between lineages of Coralliophila violacea on two different coral hosts (Porites lobata and P. cylindrica) across all SNPs, excluding migrants and admixed individuals. F ST calculated using FDIST in ARLEQUIN. Red line indicates the mean F ST value (0.075)

Figure 4

Bar plot of Bayesian assignment probability from STRUCTURE for K = 2 using 2,718 loci from 51 Coralliophila violacea. Each vertical bar corresponds to an individual. The proportion of each bar represents an individual's assignment probability to cluster one (green) or two (gold), shown grouped by coral host and then by location as numbered in Table 1, Figure 2

Histogram of variation in F ST between lineages of Coralliophila violacea on two different coral hosts (Porites lobata and P. cylindrica) across all SNPs, excluding migrants and admixed individuals. F ST calculated using FDIST in ARLEQUIN. Red line indicates the mean F ST value (0.075) Bar plot of Bayesian assignment probability from STRUCTURE for K = 2 using 2,718 loci from 51 Coralliophila violacea. Each vertical bar corresponds to an individual. The proportion of each bar represents an individual's assignment probability to cluster one (green) or two (gold), shown grouped by coral host and then by location as numbered in Table 1, Figure 2

Migration and admixture

Inferring the ancestry of individuals in STRUCTURE, using host as a prior, revealed strong differences among C. violacea living on different coral hosts (P. lobata and P. cylindrica, Figure 4), despite some migration and admixing between sympatric lineages. Moreover, migration rates were strongly asymmetric between snails living on these two hosts. In total, 19% (5 of 26 samples) of the snails collected from P. cylindrica had P. lobata genetic ancestry, while no snails (0 of 25 samples) with P. cylindrica ancestry were ever found on P. lobata (Appendix S4 and S5). Admixed individuals were only found at locations where migration was also observed (Dumaguete and Pulau Mengyatan; Appendix S5). After excluding migrants and admixed individuals, the mean F ST across all loci increased from 0.047 to 0.075 and the weighted F ST from 0.090 to 0.150.

Host‐specific directional selection

Because STRUCTURE identified 9/51 individuals that were either migrants from one coral host to the other, or of admixed ancestry (Appendix S5), we used two different datasets for detecting host‐specific selection: (a) all individuals in the filtered dataset and (b) excluding migrants and admixed individuals. We then searched for loci under selection using two methods. The first involved a Bayesian model, BayeScan (Foll & Gaggiotti, 2008). Using the default false discovery rate (FDR) of 10%, we identified six loci as outliers (pairwise F ST = 0.241–0.354, mean F ST = 0.305, Figure 5a, Table 2) in the dataset with all snails. Three of these outlier loci (tag21753, tag39884, tag52997) had log10 (PO)> 1 giving substantial‐to‐strong support as candidate loci, based on criteria from (Jeffreys, 1961). After excluding all admixed and migrant individuals, the number of outlier loci only increased to eight (pairwise F ST = 0.419–0.543, mean F ST = 0.480, Figure 5b, Table 2). Four of these outlier loci (tag21753, tag28478, tag39884, and tag25141) had log10 (PO)> 1 giving substantial‐to‐strong support as candidate loci, based on criteria from (Jeffreys, 1961). All outlier loci had positive alpha values, indicating they are under directional selection between snails on different coral hosts.
Figure 5

(a)–(b). Results from BayeScan analysis of full RAD‐seq dataset (2,718 loci) from Coralliophila violacea. Filled gray dots are F ST outlier loci. (a) All individuals, 6 outlier loci identified FDR = 0.10, (b) excluding migrants and admixed individuals, 8 outlier loci identified FDR = 0.10. (c)–(d). Results from FDIST2 analysis implemented in ARELQUIN using the hierarchical island model of migration. Full RAD‐seq dataset (2,718 loci) from Coralliophila violacea. Filled black dots are F ST outlier loci above the 99% quantile (red line). (c) All individuals, 51 outliers, (d) excluding migrants and admixed individuals, 65 outliers

Table 2

Outlier loci analysis from Coralliophila violacea found on different coral hosts (Porites lobata, P. cylindrica), BLAST hits, and functional annotations

Outlier analysisBLAST search resultsGene ontology
DatasetMethodFSTlog10(PO)Tag IDDNA sequenceOrganismDescriptionScoreCoverage (%)E‐valueIdentity (%)Gene symbolGO termsPredicted function
all ind.FDIST20.716 21753AGGTCCTCTCTGGCACTGAGCTGCCAAGCTTCCACA Mizuhopecten yessoensis Prosaposin‐like35.680%0.2386% PSAPL1 Lipid metabolic processNA
all ind.Bayescan0.3542.465Adenylate cyclase‐inhibiting G protein‐coupled receptor signaling pathway
no mig./adm.FDIST20.885 Sphingolipid metabolic process
no mig./adm.Bayescan0.4741.125Regulation of metabolic process
all ind.FDIST20.665 28478CATCCCCTCTATGCAACAGTATGCAAGTCCCCCTCT         
all ind.Bayescan0.2410.585         
no mig./adm.FDIST20.948          
no mig./adm.Bayescan0.5342.446         
all ind.FDIST20.718 39884GGGTTGGCTGTAGCAACCTGCTGCCCCCAAAACCTT         
all ind.Bayescan0.35112.2244         
no mig./adm.FDIST20.905          
no mig./adm.Bayescan0.4841.2823         
all ind.FDIST20.6591.74352997CCAGGGATCAGCAGTCTCCTGCCACTGTTCCACAAG Aplysia californica Hemocyanin 134.686%0.8184% KLH1 Metal‐ion bindingNA
no mig./adm.FDIST20.91Oxidoreductase activity
all ind.Bayescan0.507 
all ind.FDIST20.6541.45625141GGCTAAAAAGTTGCATTGCTGTGCACAAAAAGTTCA         
no mig./adm.FDIST20.869         
no mig./adm.Bayescan0.488         
all ind.FDIST20.633 14249AGACAAATTGCCGCACACACATGCAGACAAAACACA Aplysia californica Histone–lysine N‐methyltransferase 2D‐like38.380%0.06690% KMT2D Metal‐ion bindingNA
Methyltransferase activity
all ind.Bayescan0.3211.378Transcription coactivator activity
no mig./adm.FDIST20.798 DNA binding
all ind.FDIST20.702 19628GGCTATGGGTTTGCAAGGGAGTGCACTCTGCAATCA         
no mig./adm.FDIST20.893          
no mig./adm.Bayescan0.4030.603         
all ind.FDIST20.54 36127TGATCAAGCTTCGCATCGGTCTGCGCTCTCTTCTTC         
no mig./adm.FDIST20.869          
no mig./adm.Bayescan0.4190.508         
all ind.FDIST20.588 30631AGCAAGAGAATTGCACAAGGATGCGACCACAGAATG         
no mig./adm.FDIST20.83         
all ind.FDIST20.65 37258GATGATCCTGCAGCAGTGTACTGCCTCTCTCTCTCT Lottia gigantea Hypothetical protein36.5100%0.2384%Hypothetical proteinNANA
no mig./adm.FDIST20.823 
all ind.FDIST20.478 10161CACCCCCTCTATGCAACAATATGCACGTCCCCCTCT         
no mig./adm.FDIST20.795         
all ind.FDIST20.627 30668AGCTGCTCTCTAGCAGGTGACTGCATGTTGTGTACG         
no mig./adm.FDIST20.794          
all ind.FDIST20.461 21640AGCCTGGATACTGCAGTAACCTGCTTTACAGGAGCA         
no mig./adm.FDIST20.788          
all ind.FDIST20.515 24247AGTTGCGGCAGGGCAGACTACTGCATTGACGATCCC         
no mig./adm.FDIST20.784          
all ind.FDIST20.572 38182CGACGGCTAGTGGCAATGCTTTGCAATCGAACATCA Lottia gigantea Hypothetical protein32.883%2.883%HypotheticalNANA
no mig./adm.FDIST20.775 
all ind.FDIST20.55 17358CAGAATGTTCATGCAGTCCCATGCCATGTCTCAACT Mizuhopecten yessoensis Uncharacterized37.483%0.06687%UncharacterizedNANA
no mig./adm.FDIST20.768 
all ind.FDIST20.541 38553AGCACACGACATGCATTTCTGTGCCTGAGAAATGCC         
no mig./adm.FDIST20.742          
all ind.FDIST20.485 33555AGGCCTTCATCAGCATCCCAGTGCATCTCAGGAACA         
no mig./adm.FDIST20.735          
all ind.FDIST20.518 22329TGCTAACACAAGGCATAGTATTGCGACATATAACCG Crassostrea gigas Uncharacterized38.391%0.06685%UncharacterizedNANA
no mig./adm.FDIST20.729 
all ind.FDIST20.536 21872CGACTCGCGAATGCATTCTTTTGCTGCCTCTTTTTC         
no mig./adm.FDIST20.727          
all ind.FDIST20.456 39420TGTTTGGCTATGGCAGCTGTGTGCTACAACAGAATT         
no mig./adm.FDIST20.721          
all ind.FDIST20.468 33550TGAGGAAACACAGCATTAGTTTGCAAATTTATTTCT         
no mig./adm.FDIST20.705          
all ind.FDIST20.415 30176AGGCCTTTTATGGCAAACAGCTGCAACATACTGCCA         
no mig./adm.FDIST20.679          
all ind.FDIST20.526 32580CACCGTTATCTGGCACAACAGTGCGACGCCTGAACT         
no mig./adm.FDIST20.673          
all ind.FDIST20.525 28305TGCTTGCAACATGCACGCATATGCACACCACAAACT         
no mig./adm.FDIST20.67          
all ind.FDIST20.471 10755GGTGTGAAATTGGCAGGCAAATGCCTTACTCATCCT         
no mig./adm.FDIST20.659          
all ind.FDIST20.498 24085GGATAAAAGCGCGCACCAAAATGCGCATAATTTTCT Pomacea canaliculata PR domain zinc finger protein 8‐like30.186%9.981% PRDM8 Metal‐ion bindingNA
Histone methyltransferase activity
no mig./adm.FDIST20.652Chromatin binding
all ind.FDIST20.462 32708TGTGATACTCTTGCACTTTACTGCAAAGGCCATGTT Octopus bimaculoides AP2‐associated protein kinase 1‐like35.691%0.2385% AAK1 Kinase, serine/threonine‐protein kinase, transferaseNA
no mig./adm.FDIST20.646DNA binding, ATP binding, endocytosis
all ind.FDIST20.57 24158GGCCTGATCACTGCAGGATCTTGCTGGTATTTGTCA         
no mig./adm.FDIST20.634          
all ind.FDIST20.429 28347AGAAAAAGAGGCAGAGAAAGATATGGGAGAAGAACA Aplysia californica Nuclear hormone receptor HR96‐like39.2100%0.01983% HR96 Metal‐ion bindingXenobiotic detoxification
DNA binding
Receptor
no mig./adm.FDIST20.617 
all ind.FDIST20.417 37421AACTCAAAAATCGCATTTGTTTGCTTTAGTTGCGCT         
no mig./adm.FDIST20.614          
all ind.FDIST20.463 22275TGCAATTGCGAAGCAAATGTCTGCTCTGGTGCGCCG         
no mig./adm.FDIST20.611          
all ind.FDIST20.404 24087TGCATATTGTGTGCAGTGCCTTGCAGAGTATATGCC         
no mig./adm.FDIST20.599          
all ind.FDIST20.427 16452AGTGACTGGAGAGCACTTGTTTGCGGCCTATGTTCC Littorina saxatilis NA4188%0.00588%Uncharacterized  
no mig./adm.FDIST20.587   
all ind.FDIST20.432 27928CGTGACAACGCCGCAACAGAGTGCCTTGGGGACGCC         
no mig./adm.FDIST20.557          
all ind.FDIST20.458 48048GACACGACAACTGCAGCCAGTTGCTTCCCTTGATCG         
no mig./adm.FDIST20.556          
all ind.FDIST20.414 17029TGGTGTTACCTTGCAGTCAACTGCATTTATTCCTCT         
no mig./adm.FDIST20.554          
all ind.FDIST20.374 34705AGCAGTCTCACTGCAGTTTTCTGCACTGCATAAACT         
no mig./adm.FDIST20.526          
all ind.FDIST20.34 20904TGGCAAGACCTGGCAAACAGCTGCTGAGATGGGACC         
no mig./adm.FDIST20.522          
all ind.FDIST20.372 20142AGATTCATGCCAGCACAATCCTGCAAGACACTATCC         
no mig./adm.FDIST20.52          
all ind.FDIST20.388 21098TGAGAAAAAGTTGCATGTGAGTGCGTGCATGGCGCG         
no mig./adm.FDIST20.516          
all ind.FDIST20.334 27266TGCAATGAAAACACATAAAAACACCTGTGTGCACTC         
no mig./adm.FDIST20.471          
all ind.FDIST20.407 15079GGCTGAGCAGAGGCAGACGGCTGCGGAGCAGGAGGA Pomacea canaliculata Sodium‐dependent proline transporter‐like43.786%0.00290% SLC6A7 NeurotransmitterGastropod feeding behavior
no mig./adm.FDIST20.451 Sodium symporter activity
no mig./adm.FDIST20.748 42043CGCAATCGTATTGCAAAATTGTGCAATTGCTCCACT         
no mig./adm.FDIST20.676 31609CGAACAGATGTGGCAAAAGACTGCTGCCTTGGACCA         
no mig./adm.FDIST20.651 22586AGAGACAGAGTTGCATCCCTTTGCGTCGCACTCACC Octopus vulgaris Uncharacterized30.1100%9.978%UncharacterizedNANA
no mig./adm.FDIST20.636 22561TGTGTGTGTGTTGCACCTACATGCACCTAAGTTACG         
no mig./adm.FDIST20.624 31557CGGAGGTTTGTAGCAGAGCCTTGCCTGCCATAGTCT Aplysia californica Neurogenic protein mastermind‐like31.983%2.887% MAM Developmental protein, neurogenesis, differentiationNA
no mig./adm.FDIST20.559 21042AGGCTTTGAAGTGCATGCATGTGCAGCCGTCTGTCA         
no mig./adm.FDIST20.555 33474TGACACTAGTCAGCAGATAGATGCCAGGGATGGCCC         
no mig./adm.FDIST20.514 11613GGTCCGTGGCTTGCACAGGGATGCAATGCAATGTCT         
no mig./adm.FDIST20.492 15069TGAACATGTCCAGCACCCTTTTGCGCTAAAGAACCT         
no mig./adm.FDIST20.486 18108CACATCCATCTCGCATAGTTCTGCTGATCCAGAGCA Crassostrea gigas NA39.286%0.01987%UncharacterizedNANA
no mig./adm.FDIST20.478 27744GAAGTTACACAAGCACTGCCATGCGTAAAAATGACT         
no mig./adm.FDIST20.476 32951TACCTTGGGTATGCAACCCGATGCCAAGACCAAGAT         
no mig./adm.FDIST20.448 33996CACGTCCTGACAGCACAAACCTGCACTGATGTCTCT         
no mig./adm.FDIST20.44 16737TGTGTTGTGTGTGCAGGTTCATGCAGCTGATTGGTG         
no mig./adm.FDIST20.431 13930AGGTGAAATAAAGCAATGAAATGCAGGGCCGTGTCA Pomacea canaliculata Protein draper‐like 91%0.8182% DRPR Transmembrane receptor, phagocytosisLarval locomotory behavior
no mig./adm.FDIST20.428 34999GGATCTGTCTCTGCAAAAGCTTGCCTGCTGATCTTG         
no mig./adm.FDIST20.424 27749TGAGACGTTAACGCATACGGCTGCTTTTAAGTAGCC         
no mig./adm.FDIST20.424 17800TGTGCTTCCTTGGCAGAACCCTGCAAAAATAATCTG         
no mig./adm.FDIST20.407 13296AGAAAATTCTTGGCACTGTGCTGCTATTGCTTATCA         
no mig./adm.FDIST20.404 17181AGCACACAGCACGCACGTGTTTGCACACCAAGAGCA         
no mig./adm.FDIST20.373 16929GGGTAATCCAAAGCAACTCAGTGCCTTACCCCCCCT         
no mig./adm.FDIST2−0.033 23096CACCCCCTCTATGCAAAGTCATGCAAGTCTGCCTCT         
all ind.FDIST20.638 21172GGTACTAAAAAAGCAACCGTATGCGTAATCGTCTCA         
all ind.Bayescan0.2550.655         
all ind.FDIST20.593 20062CACCATGTCTATGCACGTGCATGCAGACACTGGGCA         
all ind.FDIST20.491 38482AGGGCACACAGGGCACACAGATGCACATCTTACTCA         
all ind.FDIST20.417 32340GAGTTGTCCAAGGCAAAATTCTGCAGAAAGGAAACA         
all ind.FDIST20.366 33003TGAGGCTATTTTGCATGCAGCTGCTAGATCTCTTCC         
all ind.FDIST20.323 9230TGCAAGCTTTTTGCATTCCTTTGCAAATCGAAGGCT         
all ind.FDIST20.225 19533TGCTCATTACTCGCATACTGTTGCTCTGTTCAGACT         
all ind.FDIST20.195 11006CGCAGAAGGAAGGCAAGCAGATGCCTAATAATCGCT         

Only the results that met cutoff statistics are shown.

Abbreviations: adm., admixed; ind., individuals; mig., migrants.

(a)–(b). Results from BayeScan analysis of full RAD‐seq dataset (2,718 loci) from Coralliophila violacea. Filled gray dots are F ST outlier loci. (a) All individuals, 6 outlier loci identified FDR = 0.10, (b) excluding migrants and admixed individuals, 8 outlier loci identified FDR = 0.10. (c)–(d). Results from FDIST2 analysis implemented in ARELQUIN using the hierarchical island model of migration. Full RAD‐seq dataset (2,718 loci) from Coralliophila violacea. Filled black dots are F ST outlier loci above the 99% quantile (red line). (c) All individuals, 51 outliers, (d) excluding migrants and admixed individuals, 65 outliers Outlier loci analysis from Coralliophila violacea found on different coral hosts (Porites lobata, P. cylindrica), BLAST hits, and functional annotations Only the results that met cutoff statistics are shown. Abbreviations: adm., admixed; ind., individuals; mig., migrants. In the second method, FDIST2, we used the infinite island model of migration to identify 51 outlier loci (pairwise F ST = 0.177–0.729, mean F ST = 0.492, Figure 5c) in the dataset with all snails. After removing migrants and admixed individuals, the number of outliers increased to 65 with higher F ST values (pairwise F ST = 0.320–0.925, mean F ST = 0.620, Figure 5d) indicating directional selection, resulting in a combined total of 73 outlier loci across the two methods and datasets. Of these 73, a total of 43 outlier loci were shared between the two datasets; 8 were unique to the all‐individual dataset, and 22 were unique to the dataset that excluded migrants and admixed individuals (Table 2). Three outlier loci (tag28478, tag21753, and tag39884) were common among all datasets and methods (Table 2).

Mapping and annotation of outlier loci

The majority (78%) of putative outlier loci did not align to any other mollusk sequences currently available in the NCBI database (11/2019, Table 2). Sixteen outlier loci DNA sequences aligned with a variety of mollusks including four gastropods (Aplysia californica, Littorina saxatilis, Lottia gigantea, and Pomacea canalicutata), three bivalves (Mizuhopecten yessoensis, Crassostrea gigas, and C. virginica), and two cephalopods (Octopus bimaculoides and O. vulgaris) (Table 2). Of these loci, 7 mapped to hypothetical or uncharacterized proteins. The remaining 9 loci mapped to gene regions with predicted functions. The annotated genes had various associated gene ontology terms including lipid metabolism, metal‐ion binding, methyltransferase activity, immune response, chromatin binding, DNA binding, and serine/threonine‐protein kinase. The top two hits (lowest e‐values) were a neurotransmitter gene (tag15079, SLC6A7 gene) that plays a role in gastropod feeding behavior (Miller, 2019), and a hormone receptor gene (tag28347, HR96 gene) involved in the regulation of xenobiotic detoxification (Lindblom & Dodd, 2006; Richter & Fidler, 2014). At tag28347, there were two alleles that occurred in almost equal frequency (43%, 57%) in the P. lobata‐associated lineage of snails but were nearly fixed (97%) for one allele in the P. cylindrica‐associated lineage of snails. Another gene of interest (tag13930, DRPR gene) codes for receptors involved in larval locomotory behavior (Freeman, Delrow, Kim, Johnson, & Doe, 2003).

DISCUSSION

Genome‐wide SNP data from six sympatric populations of C. violacea revealed two clearly differentiated clusters that were largely concordant with coral host, consistent with results from mitochondrial DNA (Simmonds et al., 2018). As with insects (Jean & Jean‐Christophe, 2010; Simon et al., 2015), this genome‐wide differentiation supports the conclusion of ecological divergence based on host association and adds to a small but growing literature on ecological divergence in marine environments (Fritts‐Penniman et al., 2020; Potkamp & Fransen, 2019; Titus, Blischak, & Daly, 2019). While SNP data reveal significant divergence between host‐specific lineages of C. violacea, divergence was substantially lower in genome‐wide SNPs compared to mtDNA (F ST = 0.047 vs. ΦCT = 0.561). This result may partially be a function of the smaller effective population size of the mitochondrial genome (Palumbi, Cipriano, & Hare, 2001). However, lower divergence values also suggest intermediate levels of gene flow between distinct host‐associated lineages (Nm>10), values that are similar to other cases of sympatric host‐associated divergence (e.g., Gouin et al., 2017; Peccoud, Ollivier, Plantegenest, & Simon, 2009; Smadja et al., 2012). Divergence with gene flow is further supported by the presence of admixed genotypes and unidirectional gene flow from one host lineage to the other. Moreover, considerable detection of outlier loci under directional selection (2.7% of all SNP loci; 73/2,718) strongly suggests that selection by coral host is likely contributing to the partitioning of C. violacea lineages.

Divergence with gene flow

In parasitic species such as C. violacea, divergence with gene flow likely occurs through two mechanisms of premating isolation (Nosil, Vines, & Funk, 2005). The first is host preference for egg laying and/or recruitment to their host (either individual or species). Divergence occurs when mating takes place solely on that host, eventually leading to speciation (Funk, Filchak, & Feder, 2002; Hawthorne & Via, 2001). Second is host adaptation, where selection acts against immigrants from another host via immigrant inviability (Nosil, 2007; Nosil et al., 2005; Porter & Benkman, 2017). Our study suggests that both mechanisms may be occurring in C. violacea. All migrants were individuals that genetically sorted to the lineage associated with P. lobata but were instead living on P. cylindrica. Additionally, only admixed individuals were observed on P. lobata. This pattern suggests that gene flow and admixture between host‐associated lineages are unidirectional—from lobata to cylindrica. Such unidirectional gene flow could result from two possible scenarios, either the failure of larvae to recruit, or the failure of recruited larvae to survive. Larval recruitment processes could promote asymmetrical gene flow if the lineage associated with P. cylindrica strongly prefers P. cylindrica as a host over P. lobata or does not respond to chemical settlement cues from P. lobata, preventing the recruitment of P. cylindrica‐associated larvae to P. lobata. In addition, larvae from P. lobata would need to be less selective in their recruitment, occasionally landing on P. cylindrica rather than P. lobata. Such a mechanism makes sense, given that there are twice as many coral species (N = 8) in the clade of Porites to which P. lobata belongs, than in that to which P. cylindrica belongs. An alternative, but not mutually exclusive explanation is that asymmetry in gene flow and admixture could result from postsettlement processes. For example, if larvae from P. cylindrica‐associated individuals settle on P. lobata, but are less likely to survive and reproduce, this could lead to immigrant inviability (Ingley & Johnson, 2016; Nosil et al., 2005; Richards & Ortiz‐Barrientos, 2016) and asymmetry in admixture. Under such a scenario, genes beneficial to snails living on P. cylindrica would likely be less helpful on P. lobata and we should see some indication of a selective sweep in the derived lineage with respect to the standing genetic variation of the ancestral lineage (Przeworski, Coop, & Wall, 2005). Indeed, results showed some outlier loci (e.g., HR96, detoxification gene) that were in equal proportions in P. lobata (43%, 57%) but were at near fixation in P. cylindrica (97%), indicating a soft sweep on standing genetic variation at that locus. Regardless of whether the limited misalignment of snails and coral hosts results from pre‐ or postrecruitment processes, the fact that the vast majority of snails sort by host coral in the face of hybridization and gene flow indicates that natural selection must be relatively strong to counteract gene flow of Nm>10 (Funk, Egan, & Nosil, 2011). Moreover, the high fidelity of the snails occupying P. cylindrica and lower fidelity of snails occupying P. lobata, combined with selective sweeps in P. cylindrica, suggest that snails parasitizing P. lobata are the ancestral lineage. This conjecture is consistent with the observation that specialist species often evolve from generalist ancestors (Nosil, 2002), likely because specialization constrains further evolution by reducing genetic variation (Moran, 1988). If it is generally true that specialists evolve from generalists (Kawecki, 1996, 1998), then host specialization could be an important mechanism of divergence within the Coral Triangle (Briggs, 2005) as increased diversity should raise niche partitioning, leading to more opportunities for host specialization (Janz, Nylin, & Wahlberg, 2006).

Candidate genes involved in adaptation to host

Outlier loci can provide insights into the targets of natural selection (Storz, 2005) and are a useful starting point for determining how selection may be acting on lineages diverging on different hosts. Our analysis revealed 73 putative gene regions with F ST values significantly higher than neutral expectations, suggesting that they are likely under selection and could be involved in adaptation to coral hosts, or linked to such genes via hitchhiking (Via, 2012). There is no a priori information on the types of genes involved in the adaptation of mollusks to different hosts and, due to a lack of genomic resources for C. violacea, only 9 of 73 outlier loci mapped to gene regions with predicted functions. However, a useful comparison can be found in ectoparasitic phloem‐feeding insects adapting to different host plants (Oren et al., 1998). Genes under selection in these insect–plant interactions include genes involved in sensing hosts, that protect insects against plant defenses and facilitate feeding, and that code for digestive and detoxifying enzymes to neutralize plant toxins (e.g., metal‐ion binding, Simon et al., 2015). Experimental evidence suggests genes with metal‐ion binding functions are repeatedly under selection in stick insects adapting to different host plants (Soria‐Carrasco et al., 2014). Indeed, four of the C. violacea candidate genes we identified in outlier tests are involved in metal‐ion binding (KTM2D, KLH1, PRDM8, and HR96). Very little is known about how corals and their algal symbionts chemically defend themselves against or react to parasites and predators. Symbiodinium species do produce toxins—Zooxanthellatoxins—(Gordon & Leggat, 2010), but it is unknown whether these toxins are upregulated in response to parasites or predators. Additional evidence for detoxification playing a role in host divergence comes from HR96, a nuclear hormone receptor involved in xenobiotic detoxification (Richter & Fidler, 2014). Interestingly, HR96 was nearly fixed for one allele in C. violacea from P. cylindrica (97%) but was at 50% in C. violacea from P. lobata, which indicates a selective sweep at that locus. This result, combined with the four metal‐ion binding gene regions, suggests that there may be important differences in host‐associated detoxification processes in the different C. violacea lineages. If adaptation to host‐specific toxins drives host specificity, mismatches between snail metabolic abilities and coral hosts could explain the strong asymmetry in snails being found on an atypical coral host. While the above results suggest a putative detoxification role for some outlier loci, two other genes with predicted functions, a neurotransmitter (SLC6A7) important for gastropod feeding behavior (Miller, 2019) and a transmembrane receptor (DRPR) involved in larval locomotory behavior, indicate a possible role of behavior in adaptation (Freeman et al., 2003). Notably, this is only the first genomic exploration of C. violacea and a broader survey of genomic diversity would be needed to pin down areas of the genome that are crucial for adaptations to coral hosts. Future work would benefit from a fully annotated genome of C. violacea that would allow us to examine the genomic architecture of divergence with gene flow and quantitative trait loci. In turn, this would allow us to better pinpoint regions of the genome under selection, and the specific functions of genes involved in adapting to different hosts.

Ecological divergence in the sea

John Briggs originally proposed the idea of sympatric speciation as an important diversification mechanism within the Coral Triangle (i.e., “Center of Origin” hypothesis), as well as in the export of species formed under intense competition within the region (Briggs, 1999, 2005). To support his hypothesis, he pointed to multiple cases of sympatric sibling species with distributions centered on the Coral Triangle, where the older of the two species has a wide range, while the younger has a much more restricted range limited to the Coral Triangle (Briggs, 1999). Our study provides the first genomic evidence to support his assertion that ecological divergence with gene flow could be generating biodiversity in the Coral Triangle. In addition, spatial patterning of C. violacea sympatric host lineages also matches the pattern Briggs described, with the ancestral P. lobata host lineage having a broad geographic distribution, and the derived P. cylindrica host lineage restricted to the Coral Triangle (Simmonds et al., 2018). As the global epicenter of marine biodiversity, there is a large and diverse literature on the processes shaping the Coral Triangle (Barber, Erdmann, & Palumbi, 2006; Bowen et al., 2013; Carpenter et al., 2011; Gaither et al., 2011; Hoeksema, 2007; Kochzius & Nuryanto, 2008; Tornabene, Valdez, Erdmann, & Pezold, 2015). While there is ongoing debate (Evans, McKenna, Simpson, Tournois, & Genner, 2016; Huang, Goldberg, Chou, & Roy, 2018; Di Martino, Jackson, Taylor, & Johnson, 2018; Matias & Riginos, 2018), there is clearly a multiplicity of processes driving diversification in this region (Barber & Meyer, 2015). Given the results of this study, it is important to expand our thinking beyond models that focus solely on allopatry to advance our understanding of marine speciation and origins of the Coral Triangle biodiversity hotspot.

AUTHOR CONTRIBUTIONS

SES conceived of and designed the study. SES, AFP, and SHC collected samples, prepared libraries, and analyzed genomic data. All authors worked on and approved of the manuscript. Click here for additional data file.
  82 in total

Review 1.  Divergence hitchhiking and the spread of genomic isolation during ecological speciation-with-gene-flow.

Authors:  Sara Via
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2012-02-05       Impact factor: 6.237

2.  Speciation along a depth gradient in a marine adaptive radiation.

Authors:  Travis Ingram
Journal:  Proc Biol Sci       Date:  2010-09-01       Impact factor: 5.349

3.  Genomic signatures of sympatric speciation with historical and contemporary gene flow in a tropical anthozoan (Hexacorallia: Actiniaria).

Authors:  Benjamin M Titus; Paul D Blischak; Marymegan Daly
Journal:  Mol Ecol       Date:  2019-08-05       Impact factor: 6.185

4.  Sympatric speciation in killer whales?

Authors:  A D Foote; P A Morin
Journal:  Heredity (Edinb)       Date:  2015-01-14       Impact factor: 3.821

5.  Assessing the Potential Contributions of Reduced Immigrant Viability and Fecundity to Reproductive Isolation.

Authors:  Cody K Porter; Craig W Benkman
Journal:  Am Nat       Date:  2017-03-09       Impact factor: 3.926

6.  Speciation by host switch in brood parasitic indigobirds.

Authors:  Michael D Sorenson; Kristina M Sefc; Robert B Payne
Journal:  Nature       Date:  2003-08-21       Impact factor: 49.962

7.  Diversity begets diversity: host expansions and the diversification of plant-feeding insects.

Authors:  Niklas Janz; Sören Nylin; Niklas Wahlberg
Journal:  BMC Evol Biol       Date:  2006-01-18       Impact factor: 3.260

8.  Mutualism with sea anemones triggered the adaptive radiation of clownfishes.

Authors:  Glenn Litsios; Carrie A Sims; Rafael O Wüest; Peter B Pearman; Niklaus E Zimmermann; Nicolas Salamin
Journal:  BMC Evol Biol       Date:  2012-11-02       Impact factor: 3.260

9.  CD-HIT: accelerated for clustering the next-generation sequencing data.

Authors:  Limin Fu; Beifang Niu; Zhengwei Zhu; Sitao Wu; Weizhong Li
Journal:  Bioinformatics       Date:  2012-10-11       Impact factor: 6.937

10.  Clines on the seashore: The genomic architecture underlying rapid divergence in the face of gene flow.

Authors:  Anja M Westram; Marina Rafajlović; Pragya Chaube; Rui Faria; Tomas Larsson; Marina Panova; Mark Ravinet; Anders Blomberg; Bernhard Mehlig; Kerstin Johannesson; Roger Butlin
Journal:  Evol Lett       Date:  2018-08-07
View more
  1 in total

1.  Low genome-wide divergence between two lizard populations with high adaptive phenotypic differentiation.

Authors:  Alejandro Llanos-Garrido; Javier Pérez-Tris; José A Díaz
Journal:  Ecol Evol       Date:  2021-12-09       Impact factor: 2.912

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.